Triple-negative breast cancer (TNBC) exhibits a high mortality rate and is the most aggressive subtype of breast cancer. As previous studies have shown that histone deacetylases (HDAC) may represent molecular targets for TNBC treatment, we screened a small library of synthetic molecules and identified a potent HDAC inhibitor (HDACi), YF438, which exerts effective anti-TNBC activity both in vitro and in vivo. Proteomic and biochemical studies revealed that YF438 significantly downregulated mouse double minute 2 homolog (MDM2) expression. In parallel, loss of MDM2 expression or blocking MDM2 E3 ligase activity rendered TNBC cells less sensitive to YF438 treatment, revealing an essential role of MDM2 E3 ligase activity in YF438-induced inhibition of TNBC. Mechanistically, YF438 disturbed the interaction between HDAC1 and MDM2, induced the dissociation of MDM2-MDMX, and subsequently increased MDM2 self-ubiquitination to accelerate its degradation, which ultimately inhibited growth and metastasis of TNBC cells. In addition, analysis of clinical tissue samples demonstrated high expression levels of MDM2 in TNBC, and MDM2 protein levels closely correlated with TNBC progression and metastasis. Collectively, these findings show that MDM2 plays an essential role in TNBC progression and targeting the HDAC1–MDM2–MDMX signaling axis with YF438 may provide a promising therapeutic option for TNBC. Furthermore, this novel underlying mechanism of a hydroxamate-based HDACi in altering MDM2 highlights the need for further development of HDACi for TNBC treatment.

Significance:

This study uncovers the essential role of MDM2 in TNBC progression and suggests that targeting the HDAC1–MDM2–MDMX axis with a hydroxamate-based HDACi could be a promising therapeutic strategy for TNBC.

Breast cancer is the most common female cancer type, and it exhibits high lethality (1, 2). Recently, encouraging results have been observed in therapies targeting estrogen receptor (ER) and HER2 (3, 4). However, triple-negative breast cancer (TNBC), a subtype lacking the expression of ER, progesterone receptor, and HER2, still presents a great challenge for developing new therapeutic agents (5, 6). Studies have shown that TNBC accounts for approximately 20% of all breast cancers and primarily occurs in young women (7). Compared with other subtypes of breast cancers, TNBC features increased cellular proliferation and invasion that are accompanied by a poor prognosis and high recurrence rate (8). Because of the lack of specific molecular targets or no identified chemotherapeutic vulnerabilities, the survival rate of patients with TNBC currently remains relatively low, and traditional chemotherapies are often used in the current treatment of TNBC. However, many chemotherapy drugs have been associated with severe side effects, and a significant proportion of patients also develop resistance to chemotherapy. Hence, exploring potential molecular targets and developing more effective therapeutic drugs are urgently needed for TNBC inhibition.

Numerous studies have recently shown that histone deacetylases (HDAC) can be used as molecular targets for metastatic breast cancer or TNBC treatment (9, 10). HDAC inhibitors (HDACi) have demonstrated favorable anticancer activities in both preclinical and clinical settings (11, 12), and may also serve as a promising class of novel anticancer agents for TNBC (13). However, most of the existing HDACis lack visible efficacy when used as a single agent, displaying obvious limitations in the course of clinical trials (14, 15). Moreover, most current HDACis exhibit only moderate effects against solid tumors with toxic side effects and readily produce drug resistance (16, 17). Thus, it is necessary to develop new HDACis with improved therapeutic effects and decreased toxicities. In addition, the regulatory mechanisms underlying HDACi action and the potential targets for TNBC therapy also need to be explored.

The mouse double minute2 homolog (MDM2) has been characterized as an oncoprotein due to its binding to and its facilitation of the degradation of the tumor suppressor p53 (18, 19). MDM2 plays important roles in regulating cell cycle, apoptosis, and cancer development and progression due to its prevalent expression as well as its interactions with p53 and other signaling molecules (20, 21). In recent years, many investigators have demonstrated that MDM2 expression is upregulated in a variety of human tumors, including breast cancer (22, 23). A recent analysis showed that the overexpression of MDM2 and its homolog MDMX in TNBC promotes circulating tumor cells and potential metastasis (24). In addition, tumor cells expressing high levels of MDM2 also showed high invasive potential (25, 26). These findings have led to the conjecture that regulating of MDM2 protein alteration might be a promising therapeutic strategy for TNBC.

As the major contribution of MDM2 to the development of cancer is via the inhibition of the p53 tumor-suppressor protein, most MDM2 inhibitors have been designed to block the p53-MDM2 protein–protein interaction, and several of these are being evaluated in preclinical or clinical trials (27, 28). However, increasing evidence suggests that MDM2 also induces spontaneous tumorigenesis independent of p53 (25, 29). Therefore, the identification of novel small molecules that can regulate the expression of MDM2 protein may constitute a more effective strategy for cancer therapy.

Herein we have identified a new HDACi, YF438 that significantly inhibits TNBC cell growth and metastasis and exerts effective antitumor activity both in vitro and in vivo. Further mechanistic studies have revealed that YF438 blocks the interaction between HDAC1 and MDM2, induces the dissociation of MDM2-MDMX, subsequently increases self-ubiquitination and protein degradation of MDM2, and finally results in TNBC inhibition. In addition, the YF438-induced degradation of MDM2 was dependent upon its RING-finger domain, and the tumor-suppressing effect of YF438 on TNBC materialized in a p53-independent manner. In conclusion, our results demonstrated that YF438 can serve as a promising candidate for TNBC prevention, and that targeting the HDAC1–MDM2–MDMX signaling axis by YF438 may present a promising therapeutic strategy for TNBC treatment.

Ethics statement

All animal experiments were performed according to guidelines approved by the Institutional Animal Care and Use Committee, and performed in accordance with the guidelines for animal experimentation of Qingdao University (Qingdao, Shandong, P.R. China) and approved by the Committee for Animal Experimentation.

Cell culture and materials

MDA-MB-231, 4T1, BT549, MCF10A, HEK293T (293T), and HeLa cells were obtained from the ATCC. MDA-MB-231, 293T, and HeLa cells were maintained in DMEM with 10% [volume for volume (v/v)] FBS. 4T1 and BT549 cells were maintained in RPMI1640 medium with 10% (v/v) FBS. All cell lines tested negative for Mycoplasma contamination. The cells were passaged for fewer than 6 months after resuscitation and were authenticated prior to use by short tandem repeat profiling. MDM2-knockdown plasmids were generated by inserting CCGGACACTTATACTATGAAAGAGGCTCGAGCCTCTTTCATAGTATAAGTGTTTTTTG into the AgeI and EcoRI restriction sites of pLKO.1. To construct the MDM2 knockdown rescue system, RNAi-resistant MDM2-WT and C464A expression plasmids were generated using the following primer: GTCTGTTGGTGCACAAAAAGACACCTACACGATGAAGGAAGTTCTTTTTTATCTTGGCCAGTA (mutated nucleotides underlined). MDM2 deletion mutants were constructed by PCR from Flag-MDM2. The human MDM2 and HDAC1 expression plasmids were amplified from human cDNA and inserted into pCDNA 3.0, PET28a, and PGEX4T-1 vectors, respectively. Antibodies against Flag and Actin were purchased from Sigma. MDM2 antibody was purchased from Proteintech (27883-1-AP) for immunoprecipitation and immunofluorescence assay. MDM2 antibody was purchased from Abclonal (A0345) for IHC assay. Antibodies against GST and His were purchased from Proteintech. Antibodies against acetyl-histone H3, acetyl-histone H4, HDAC1, E-cadherin, vimentin, ZEB1, and cleaved PARP were purchased from Cell Signaling Technology. Activated-caspase-3 was purchased from Bioworld. DMSO, cycloheximide, MG132, and Flag-M2 agarose were obtained from Sigma. Protein A/G agarose was purchased from Santa Cruz Biotechnology. Glutathione-Sepharose 4B Resin was purchased from Solarbio. Matrigel was purchased from BD Biosciences. YF438 was synthesized as described previously (30). Compounds were dissolved in DMSO and stored at −20°C as small aliquots.

Animal experiments

Female BALB/c mice (6–8 weeks) were purchased from Institute of Laboratory Animal Science of Chinese Academy of Medical Sciences (Beijing, P.R. China). Animal studies were performed in accordance with the guidelines for Animal Experimentation of Qingdao University (Qingdao, Shandong, P.R. China) and approved by the Committee for Animal Experimentation. 4T1 cells (1 × 105) were injected into the mammary fat pad of female BALB/c mice. Mice were divided into five groups (n = 5/group) on day 7 and received intraperitoneal injection of YF438 and suberoylanilide hydroxamic acid (SAHA), and control group were injected with DMSO. Primary tumor size was measured every week and tumor volume was calculated. After 35 days, all mice were sacrificed. Primary tumors weight in each group was measured, and tumors were lysed and applied to immunoblotting with the indicated antibodies, or fixed and paraffin embedded by IHC analysis, respectively. Another independent animal experiment (n = 6/group) was performed by using female BALB/c mice for toxicity study. Lung metastases were manually counted using a dissecting microscope by three individuals who do not have personal biases with the experiment.

Blood chemistry analysis

BALB/c mice were administrated with DMSO (vehicle) or YF438 (30 mg/kg) each day for 28 days. Mice were sacrificed 24 hours after the last treatment, blood samples were collected from each mouse. Routine blood examination was conducted 24 hours after the last administration in mice of each group. The serum concentrations of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and blood urea nitrogen (BUN) were measured using Fuji DRI-CHEM 7000i (Fujifilm).

HDAC inhibitory assay

HDACi activity assay was performed by using the HDACi screening kit (BioVision, Inc) according to the manufacturer's instruction. Briefly, HeLa nuclear extract or MDA-MB-231 cell lysate were incubated with the candidate HDACis or SAHA in the presence of HDAC fluorometric substrate containing an acetylated lysine side chain at 37°C for 1 hour. The fluorescence intensities were determined on a fluorometer with 350–380 nm excitation and 440–460 nm emission.

LC/MS-MS analyses

For each sample, approximately 2 μg peptides were separated and analyzed with a nano-UPLC coupled to Q-Exactive mass spectrometry (Thermo Finnigan). Separation was performed using a reversed-phasecolumn. Mobile phases were H2O with 0.1% formic acid (FA; LC-MS), 2% acetonitrile (ACN; LC-MS; phase A) and 80% ACN (LC-MS), 0.1% FA (LC-MS). Separation of sample was executed with a 120 minutes gradient at 300 nL/minute flow rate. Gradient B: 8% to 30% for 92 minutes, 30% to 40% for 20 minutes, 40% to 100% for 2 minutes, 100% for 2 minutes, 100% to 2% for 2 minutes, and 2% for 2 minutes. Data-dependent acquisition was performed in profile and positive mode with Orbitrap analyzer at a resolution of 70,000 (200 m/z) and m/z range of 350–1,600 for MS1. For MS2, the resolution was set to 17,500 with a dynamic first mass. The dynamic exclusion time window was 30 seconds.

Immunoprecipitation and Western blotting

Cells were lysed in lysis buffer and centrifuged for 10 minutes at 10,000 × g, and the insoluble debris was discarded. Cell lysates were further analyzed by Western blotting. For co-immunoprecipitation, cell lysates were immunoprecipitated with anti-Flag-M2 agarose or protein A/G agarose plus anti-MDM2 antibody for 6 hours at 4°C. The beads were washed extensively with lysis buffer, boiled in SDS sample buffer, fractionated by SDS-PAGE, and analyzed by Western blotting using specific antibodies.

In vitro binding assay

GST or GST-MDM2 was incubated with His-HDAC1 in binding buffer (100 mmol/L NaCl, 15 mmol/L EGTA, 50 mmol/L Tris-HCl pH 7.5, 1 mmol/L PMSF, 1 mmol/L DTT, and 0.2% Triton X-100) for 4 hours at 4°C. Protein complex was pulled down with glutathione-agarose beads for 4 hours at 4°C, washed and subjected to Western blot analysis.

Immunofluorescence staining

Cells were fixed in 4% formaldehyde for 10 minutes, incubated with primary antibody for 2 hours at room temperature or overnight at 4°C, followed by a 2-hour exposure to the fluorescently conjugated secondary antibody at room temperature. Immunofluorescence was visualized by fluorescence microscopy.

IHC staining

IHC staining analysis was performed as reported previously (31). The human breast cancer tissue chips containing both tumor and the adjacent tissue sections were purchased from Wuhan Servicebio. Antibodies against MDM2 and Ac-H3/H4 were used for IHC staining, respectively.

In vivo ubiquitination assay

Cells were transfected as indicated. Cells were lysed in buffer A (6 mol/L guanidinium-HCl, 0.1 mol/L Na2HPO4/NaH2PO4, 0.01 mol/L Tris-HCl pH 8.0, 5 mmol/L imidazole, 10 mmol/L β-mercaptoethanol) and incubated with Ni-NTA beads (Qiagen) for 4 hours at room temperature. The beads were washed with buffers A, B (8 mol/L urea, 0.1 mol/L Na2PO4/NaH2PO4, 0.01 mol/L Tris-HCl pH 8.0, 10 mmol/L β-mercaptoethanol), and C (8 mol/L urea, 0.1 mol/L Na2PO4/NaH2PO4, 0.01 mol/L Tris-HCl pH 6.3, 10 mmol/L β-mercaptoethanol), and bound proteins were eluted with buffer D (200 mmol/L imidazole, 0.15 mol/L Tris-HCl pH 6.7, 30% glycerol, 0.72 mol/L β-mercaptoethanol, 5% SDS). The eluted proteins were analyzed by Western blot analysis.

Cell viability assay

TNBC cells (5 × 103 cells/well) were seeded in 96-well plates. After 24 hours, cells were treated with different concentrations of YF438 or SAHA. Cell viability was measured by MTS assay, the Aqueous one Solution (Promega) was used according to manufacturer's instructions, and the absorption at 490 nm was measured.

Cell death analyses

Apoptosis analyses were measured by Annexin V-FITC/propidium iodide (PI) assay using the flow cytometry. Briefly, cells were stained using the Annexin V-FITC/PI apoptosis detection kit and measured by using a BD Biosciences FACS Aria flow cytometer.

Colony formation assay

TNBC cells were seeded in a 6-well plate, and 24 hours later, cells were treated with different concentrations of YF438. Culture medium was refreshed every other day. Cells were cultured for 10 days. Then the clones were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted manually.

Invasion assay

TNBC cells were first starved overnight, and then cells were resuspended in 100 μL serum-free medium with or without YF438 and added to each transwell (5 × 104 cells/well), precoated with 1 mg/mL Matrigel. A total of 12 hours post-seeding, invaded cells on the undersurface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Noninvaded cells on the upper side of the transwells were removed using cotton swabs. Images were acquired using an inverted microscope (Olympus) and cells were counted manually.

RNAi assay

siRNAs targeting HDAC1, MDM2, or nonspecific control were transfected into the TNBC cells according to the manufacturer's instruction. SiRNAs were synthesized in TsingKe, and 48 hours after transfection, the cell lysates were collected and subjected to Western blot analysis. The sequences of siRNAs against HDAC1 were 5′-TAAGGTTCTCAAACAGTCG-3′ and 5′-AAGCCGGUCAUGUCCAAAGUA-3′. The sequences of siRNAs against MDM2 were 5′-ACACTTATACTATGAAAGA-3′ and 5′-CAACATATTGTATATTGTT-3′.

RT-PCR

RNA samples from TNBC cells were prepared using TRIzol (Invitrogen) according to the manufacturer's protocols. Total RNA (1 μg) was converted to cDNA using oligodT primer. The relative expression of MDM2 was analyzed by RT-PCR with GAPDH as an internal control. The primer sequences used for PCR for MDM2 were 5′-TGTTGGTGCACAAAAAGACACTT-3′ and 5′-GCACGCCAAACAAATCTCCTA-3′. PCR products were separated on 1.2% agarose gel and then stained with ethidium bromide.

Statistical analyses

The results are expressed as mean ± SD of triplicate samples from one representative experiment from at least three independent experiments, unless otherwise specified. Statistical significance was assessed by two-tailed Student t tests. All experiments were performed at least three times except for animal experiments. Data with a P value of less than 0.05 were considered significant.

Identification of YF438

At present, HDACis comprise a promising class of novel anticancer agents for TNBC; however, most of the current HDACis exhibit weak antitumor activities. To specifically identify new lead compounds for TNBC, we screened an in-house library of small-molecule hydroxamate-based HDACis against TNBC cells. We used a colorimetric HDAC activity assay kit and cell viability assay to test the inhibitory activity of the newly synthesized HDACis (Fig. 1A; Supplementary Table S1). The acetylation levels of H3 and H4 were also evaluated as shown in Supplementary Fig. S1A, and we found that YF438 was the most potent inhibitor with respect to TNBC cells. Fig. 1B showed that YF438 significantly inhibited cell growth of TNBC cells in a dose-dependent manner. In addition, we also examined the responses of other TNBC cells (MDA-MB-468, HCC-1937, MDA-MB-346, BT20, HCC-1143), other tumor cell lines (A549, H1299, HCT116, SW480, BGC-823), MCF10A and MCF7 with regard to YF438 treatment, and ascertained the low cytotoxicity of YF348 on non-TNBC cells (Supplementary Fig. S1B and S1C). The chemical structure of YF438 is shown in Fig. 1C and the design and synthetic details are as described previously (30). Supplementary Figure S1D showed that the inhibitory efficacy of YF438 was stronger than that of SAHA, which was the first approved HDAC inhibitor by the FDA for clinical treatment, and used as a positive control in our experiments (32). In addition, YF438 significantly increased the acetylation of H3 and H4 compared with SAHA (Supplementary Fig. S1E and S1F). Collectively, these results suggested that YF438 is a potent HDACi that shows remarkable inhibitory effects on TNBC cells.

Figure 1.

Identification of YF438. A, TNBC cells were treated with the indicated compounds. Cell lysates were coincubated with a fluorometric substrate for HDAC, and the HDAC activity was measured with SAHA as a positive control. B, A panel of cell lines (MCF10A, MDA-MB-231, 4T1, BT549) was treated with the indicated concentrations of YF438, and after 48 hours, we performed an MTS assay. Bars, mean ± SD. C, Chemical structure of the HDACi YF438. D, TNBC cells were seeded on 6-well plates, and after 12 hours, cells were treated with the indicated concentrations of YF438. On day 10, the number of colonies was counted in experiments that were repeated three times, and results represent the average of three replicates. E, TNBC cells were treated with different doses of YF438 or SAHA for 48 hours, and we evaluated apoptosis using Annexin V/PI staining and flow cytometry. F, TNBC cells were treated with different concentrations of YF438 and allowed to invade through the Matrigel. Images were obtained after incubation (top) for 12 hours. Data show the mean ± SD from three independent experiments. G, TNBC cells were treated with the indicated concentrations of YF438, and the expression of EMT-related proteins was detected by Western immunoblotting assay with the indicated antibodies. The band intensity was quantified by densitometry of the immunoblots relative to the density of the first band of each blot strip; the units are presented below the blot.

Figure 1.

Identification of YF438. A, TNBC cells were treated with the indicated compounds. Cell lysates were coincubated with a fluorometric substrate for HDAC, and the HDAC activity was measured with SAHA as a positive control. B, A panel of cell lines (MCF10A, MDA-MB-231, 4T1, BT549) was treated with the indicated concentrations of YF438, and after 48 hours, we performed an MTS assay. Bars, mean ± SD. C, Chemical structure of the HDACi YF438. D, TNBC cells were seeded on 6-well plates, and after 12 hours, cells were treated with the indicated concentrations of YF438. On day 10, the number of colonies was counted in experiments that were repeated three times, and results represent the average of three replicates. E, TNBC cells were treated with different doses of YF438 or SAHA for 48 hours, and we evaluated apoptosis using Annexin V/PI staining and flow cytometry. F, TNBC cells were treated with different concentrations of YF438 and allowed to invade through the Matrigel. Images were obtained after incubation (top) for 12 hours. Data show the mean ± SD from three independent experiments. G, TNBC cells were treated with the indicated concentrations of YF438, and the expression of EMT-related proteins was detected by Western immunoblotting assay with the indicated antibodies. The band intensity was quantified by densitometry of the immunoblots relative to the density of the first band of each blot strip; the units are presented below the blot.

Close modal

YF438 significantly inhibits the growth and metastasis of TNBC cells

Colony formation is considered to accurately simulate the growth and pathologic processes of tumor cells in vivo. As shown in Fig. 1D, YF438 significantly inhibited TNBC cell colony formation. In addition, apoptosis was significantly increased by YF438 treatment in TNBC cell lines (Fig. 1E; Supplementary Fig. S2A). In addition, the expression levels of proliferating cell nuclear antigen (PCNA) and PARP were significantly decreased, while cleaved PARP was noticeably upregulated after YF438-treatment (Supplementary Fig. S2B). Blocking tumor-cell migration and invasion is an effective strategy for cancer therapy (33). As shown in Fig. 1F and Supplementary Fig. S2C, the cellular invasive ability of TNBC cells was significantly depressed by YF438 treatment. The epithelial–mesenchymal transition (EMT) endows an invasive phenotype to cancer cells and is pivotal for the metastasis of breast cancer (34), and regulating the expression of EMT-related proteins may comprise a feasible strategy for suppressing metastasis. Figure 1G showed that YF438 treatment markedly increased the expression of the epithelial marker E-cadherin; conversely, the expression of β-catenin, vimentin, and ZEB1 was drastically reduced in the presence of YF438. Collectively, these results demonstrated that YF438 selectively suppressed cell growth of TNBC cells, and also displayed a potent inhibitory effect on the metastasis of TNBC cells.

YF438 exhibits potent antitumor activity in a preclinical animal model

We next examined the in vivo antitumor effects of YF438 using an orthotopic autograft model. 4T1 cells were injected subcutaneously into the fourth abdominal mammary fat pad of BALB/c mice that were treated 7 days later by intraperitoneal injection of YF438 or SAHA over 35 days, and tumor growth was continuously monitored after treatment. As shown in Fig. 2A–C, treatment of mice with YF438 significantly inhibited tumor growth and induced a marked reduction in tumor volume compared with the control group and SAHA treatment at the same concentrations. Consistent with our in vitro results, YF438 treatment dramatically diminished breast tumor metastasis to the lung (Fig. 2D). The Ac-H3 and Ac-H4 levels in these primary tumor tissues confirmed the greater inhibitory effect of YF438 compared with SAHA on histone deacetylases (Fig. 2E and F). These results were consistent with our in vitro data observed in TNBC cells treated with YF438, confirming the HDAC inhibitory effect of YF438 in vivo, and also providing evidence that YF438 acts as a potential agent in TNBC therapy.

Figure 2.

YF438 exhibits potent antitumor activity in a preclinical animal model. A, 4T1 cells (1 × 105) were injected into the mammary fat pad of female BALB/c mice, and mice were allocated to five groups (n = 5/group) 7 days after tumor-cell implantation. After 35 days, all mice were sacrificed. Representative images of the primary tumors removed from mice after administration of YF438 or SAHA for 28 days. B, Primary tumor weight in each group was measured. **, P < 0.01; ***, P < 0.001. C, Primary tumor volume was measured each week. *, P < 0.05; **, P < 0.01; ***, P < 0.001. D, Metastatic lung nodules were visualized and then counted manually, and differences were evaluated with Student t test; ***, P < 0.001. E, Primary tumors were fixed and paraffin embedded. Five-micrometer (5-μm) sections were analyzed by IHC using anti-Ac-H3 and Ac-H4 antibodies. Scale bar, 50 μm. F, Primary tumors were lysed and applied to immunoblots using the indicated antibodies, with actin as a loading control. Acetylated H3/H4 protein levels in primary tumor tissue were detected using Western blot analysis.

Figure 2.

YF438 exhibits potent antitumor activity in a preclinical animal model. A, 4T1 cells (1 × 105) were injected into the mammary fat pad of female BALB/c mice, and mice were allocated to five groups (n = 5/group) 7 days after tumor-cell implantation. After 35 days, all mice were sacrificed. Representative images of the primary tumors removed from mice after administration of YF438 or SAHA for 28 days. B, Primary tumor weight in each group was measured. **, P < 0.01; ***, P < 0.001. C, Primary tumor volume was measured each week. *, P < 0.05; **, P < 0.01; ***, P < 0.001. D, Metastatic lung nodules were visualized and then counted manually, and differences were evaluated with Student t test; ***, P < 0.001. E, Primary tumors were fixed and paraffin embedded. Five-micrometer (5-μm) sections were analyzed by IHC using anti-Ac-H3 and Ac-H4 antibodies. Scale bar, 50 μm. F, Primary tumors were lysed and applied to immunoblots using the indicated antibodies, with actin as a loading control. Acetylated H3/H4 protein levels in primary tumor tissue were detected using Western blot analysis.

Close modal

MDM2 plays essential roles in YF438-induced inhibition of TNBC

We subsequently sought to explore the detailed molecular mechanisms by which YF438 suppresses TNBC cell growth and metastasis. 4T1 cells were treated with or without YF438, and proteomic analysis was performed to compare the differences between protein expressions by examining whole-cell protein extracts obtained from 4T1 cells. Clustering analysis using a heatmap showed that there were significant differences in protein expression between YF438-treated and YF438-untreated cells (Fig. 3A). Supplementary Table S2 shows the top 10 significantly upregulated and downregulated proteins with YF438 treatment by LC/MS-MS analysis, and we then analyzed these top 10 significant proteins using Western blot assay. Of the top 10 significantly upregulated proteins, the protein expression of Lxn and Eps1511 was not examined because of the lack of corresponding antibodies. As shown in Supplementary Fig. S3A and S3B, MDM2 expression was significantly decreased under YF438 treatment compared with other proteins, suggesting that YF438 may exert its antitumor effects via MDM2. Further study revealed that YF438 decreased the level of MDM2 protein in a dose-dependent manner (Fig. 3B). Previous investigators have demonstrated that stabilization of the E2F1 protein plays an important role in MDM2-mediated tumorigenesis (35). As illustrated in Fig. 3C, MDM2 knockdown significantly downregulated the expression of E2F1 and vimentin, while p21 expression was unaffected; concomitantly, we found similar results when TNBC cells were exposed to increasing amounts of YF438 (Fig. 3D). Moreover, MDM2-knockdown cells were less sensitive to YF438-induced inhibition of cell growth and the apoptosis-promoting effect compared with control cells (Fig. 3E and F), MDM2 knockdown also blocked the YF438-induced inhibition of cellular invasiveness (Fig. 3G). These results were confirmed in other MDM2-knockdown TNBC cells (Supplementary Fig. S4A–S4C). In summary, our results indicated that MDM2 was required for YF438-induced TNBC inhibition, and that this selective inhibitory effect of YF438 may be due to the high expression of MDM2 protein in TNBC.

Figure 3.

MDM2 is downregulated by YF438 in TNBC cells and MDM2 plays essential roles in YF438-induced inhibition of TNBC. A, Clustering heatmap of all significant proteins. Pearson distance was used if there were three or more samples, otherwise, we used the Euclidean distance. Missing values are indicated with “-.” B, TNBC cells were treated with the indicated concentrations of YF438, and the expression of MDM2 protein was analyzed by Western blotting. Actin was used as a loading control. C, TNBC cells were transfected with siRNAs targeting MDM2 (Si-MDM2 #1 and #2) or nonspecific control (Si-Ctrl). Western blot analysis was performed to detect the levels of the indicated proteins. D, TNBC cells were treated with the indicated concentrations of YF438, and the expression of E2F1 and P21 was analyzed using Western blot assay. Actin was used as a loading control. E, 4T1 cells were transfected with siRNAs targeting MDM2 (Si-MDM2 #1 and #2) or nonspecific control (Si-Ctrl), and 24 hours later, cells were treated with or without YF438 (0.5 μmol/L) for 24 hours. Cell viability was assessed with the MTS assay (n = 3). Data show the mean ± SD from three independent experiments. F, The above 4T1 cells were treated with YF438 (0, 2, or 5 μmol/L) for 24 hours. Apoptosis was assessed by Annexin V/PI staining and flow cytometry. G, The above 4T1 were treated with or without YF438 (0.5 μmol/L) for 24 hours and then allowed to invade the Matrigel. Images were obtained after 12 hours of incubation. Data show the mean ± SD from three independent experiments. ***, P < 0.001.

Figure 3.

MDM2 is downregulated by YF438 in TNBC cells and MDM2 plays essential roles in YF438-induced inhibition of TNBC. A, Clustering heatmap of all significant proteins. Pearson distance was used if there were three or more samples, otherwise, we used the Euclidean distance. Missing values are indicated with “-.” B, TNBC cells were treated with the indicated concentrations of YF438, and the expression of MDM2 protein was analyzed by Western blotting. Actin was used as a loading control. C, TNBC cells were transfected with siRNAs targeting MDM2 (Si-MDM2 #1 and #2) or nonspecific control (Si-Ctrl). Western blot analysis was performed to detect the levels of the indicated proteins. D, TNBC cells were treated with the indicated concentrations of YF438, and the expression of E2F1 and P21 was analyzed using Western blot assay. Actin was used as a loading control. E, 4T1 cells were transfected with siRNAs targeting MDM2 (Si-MDM2 #1 and #2) or nonspecific control (Si-Ctrl), and 24 hours later, cells were treated with or without YF438 (0.5 μmol/L) for 24 hours. Cell viability was assessed with the MTS assay (n = 3). Data show the mean ± SD from three independent experiments. F, The above 4T1 cells were treated with YF438 (0, 2, or 5 μmol/L) for 24 hours. Apoptosis was assessed by Annexin V/PI staining and flow cytometry. G, The above 4T1 were treated with or without YF438 (0.5 μmol/L) for 24 hours and then allowed to invade the Matrigel. Images were obtained after 12 hours of incubation. Data show the mean ± SD from three independent experiments. ***, P < 0.001.

Close modal

The E3 ligase activity of MDM2 is essential for YF438-induced TNBC inhibition

Because MDM2 protein expression was significantly downregulated by YF438, we then sought to explore whether YF438 treatment attenuated MDM2 mRNA levels. As shown in Fig. 4A and B, there is no significant effect on MDM2 mRNA levels in TNBC cells treated with YF438, suggesting that the YF438-induced reduction in MDM2 protein may be due to increasing MDM2 protein degradation. As shown in Fig. 4C, in the presence of cycloheximide (a protein synthesis inhibitor), YF438 significantly accelerated the degradation rate of the MDM2 protein, indicating that downregulation of MDM2 by YF438 may occur via a protein-degradation mechanism. We then constructed a series of MDM2-deletion mutants. As shown in Fig. 4D, the RING-finger domain of MDM2 was required for YF438-induced MDM2 degradation, and the MDM2-C464A mutant lacking E3 ubiquitin ligase activity was unable to undergo degradation upon YF438 treatment (Fig. 4E). These results indicated that YF438 promoted MDM2 protein degradation via the E3 ligase activity of MDM2. In addition, the expression level of PCNA was significantly decreased while cleaved PARP and cleaved caspase-3 were obviously upregulated after YF438 treatment in MDM2-WT but not in MDM2-C464A–rescued cell lines (Fig. 4F). We also noted obvious cell-growth inhibition and increasing apoptosis in MDM2-WT but not in MDM2-C464A–rescued cell lines under YF438 treatment (Fig. 4G and H; Supplementary Fig. S5A and S5B). In conclusion, these results indicated that YF438-promoted MDM2 protein degradation was dependent upon the E3 ligase activity of MDM2, and that the accelerated degradation of MDM2 protein was essential for the anti-TNBC activity of YF438.

Figure 4.

MDM2 E3 ligase activity is essential for YF438-induced TNBC inhibition. A and B, A panel of TNBC cell lines (MDA-MB-231, 4T1, BT549) was treated with YF438 at the indicated concentrations for 24 hours and then analyzed for MDM2 mRNA expression by RT-PCR (A) or quantitative RT-PCR (B). C, 4T1 cells were treated with or without 0.5 μmol/L YF438 for 4 hours, followed by the addition of the protein synthesis inhibitor cycloheximide (CHX; 50 μg/mL). Stability of endogenous MDM2 was examined by Western blot assay. D, 293T cells were transfected with MDM2-deletion mutants, and after 12 hours, the cells were treated with or without 0.5 μmol/L YF438 for 24 hours. Cells were finally lysed and analyzed by Western blot assay with anti-MDM2 antibodies. The band intensity was quantified by densitometry of the immunoblots relative to the intensity of the band in the absence of YF438. Samples were separated on 12% SDS-PAGE gels. E, 293T cells were transfected with MDM2-WT or MDM2-C464A plasmids, and 12 hours later, the cells were treated with YF438 at the indicated concentrations. The MDM2 protein levels were ultimately detected using Western blot assay. F, MDM2-WT and MDM2-C464A–rescued TNBC cells (MDA-MB-231, 4T1, BT549) were treated with or without YF438 (0.5 μmol/L) for 24 hours. MDM2, PCNA, cleaved caspase-3, and cleaved PARP were then evaluated by Western blot assay. G, MDM2-WT and MDM2-C464A-rescued 4T1 cells were treated with or without YF438 (0.5 μmol/L) for 24 hours, and cellular viability was assessed by MTS assay (n = 3). H, MDM2-WT and MDM2-C464A–rescued 4T1 cells were treated with or without YF438 (5 μmol/L) for 24 hours, and apoptosis was assessed by Annexin V/PI staining and flow cytometry. **, P < 0.01; ***, P < 0.001.

Figure 4.

MDM2 E3 ligase activity is essential for YF438-induced TNBC inhibition. A and B, A panel of TNBC cell lines (MDA-MB-231, 4T1, BT549) was treated with YF438 at the indicated concentrations for 24 hours and then analyzed for MDM2 mRNA expression by RT-PCR (A) or quantitative RT-PCR (B). C, 4T1 cells were treated with or without 0.5 μmol/L YF438 for 4 hours, followed by the addition of the protein synthesis inhibitor cycloheximide (CHX; 50 μg/mL). Stability of endogenous MDM2 was examined by Western blot assay. D, 293T cells were transfected with MDM2-deletion mutants, and after 12 hours, the cells were treated with or without 0.5 μmol/L YF438 for 24 hours. Cells were finally lysed and analyzed by Western blot assay with anti-MDM2 antibodies. The band intensity was quantified by densitometry of the immunoblots relative to the intensity of the band in the absence of YF438. Samples were separated on 12% SDS-PAGE gels. E, 293T cells were transfected with MDM2-WT or MDM2-C464A plasmids, and 12 hours later, the cells were treated with YF438 at the indicated concentrations. The MDM2 protein levels were ultimately detected using Western blot assay. F, MDM2-WT and MDM2-C464A–rescued TNBC cells (MDA-MB-231, 4T1, BT549) were treated with or without YF438 (0.5 μmol/L) for 24 hours. MDM2, PCNA, cleaved caspase-3, and cleaved PARP were then evaluated by Western blot assay. G, MDM2-WT and MDM2-C464A-rescued 4T1 cells were treated with or without YF438 (0.5 μmol/L) for 24 hours, and cellular viability was assessed by MTS assay (n = 3). H, MDM2-WT and MDM2-C464A–rescued 4T1 cells were treated with or without YF438 (5 μmol/L) for 24 hours, and apoptosis was assessed by Annexin V/PI staining and flow cytometry. **, P < 0.01; ***, P < 0.001.

Close modal

YF438 promotes MDM2 self-ubiquitination in TNBC cells by disrupting the formation of the MDM2–HDAC1–MDMX complex

An earlier study had depicted a specific interaction between HDAC1 and MDM2, which is required for efficient degradation of p53, and this then blocks active tumor suppression (36). This observation raises an interesting possibility that the HDAC1–MDM2 interaction may be essential for MDM2 oncoprotein function and protein stability. In addition, YF438 was identified as a new HDACi in our study, and molecular docking models showed that YF438 interacted with the active site of HDAC1 (Supplementary Fig. S6A and S6B; ref. 30). These findings provided evidence that YF438-induced MDM2 inhibition might occur through competitive perturbation of the HDAC1–MDM2 interaction, enabling MDM2 released and then free to be degraded. Figure 5A showed that YF438 significantly disrupted the binding between HDAC1 and MDM2. In vivo assay confirmed the direct interference of YF438 on the interaction of HDAC1 and MDM2 (Fig. 5B). Subcellular distribution analysis revealed that YF438 treatment significantly interfered their colocalization in the nucleus (Fig. 5C). We also observed a diminished MDM2 protein level in the HDAC1-knockdown cells when compared with cells transfected with control siRNA (Fig. 5D), and inhibiting the expression of HDAC1 significantly increased MDM2 self-ubiquitination (Fig. 5E). Previous study reported that MDMX interacts with MDM2 to increase the steady-state levels of MDM2 protein and maintain protein stability of MDM2 (37), further study confirmed that YF438 significantly blocked the complex formation of HDAC1–MDM2–MDMX, and knockdown of HDAC1 markedly attenuated the interaction of MDMX and MDM2 (Fig. 5F and G). Consequently, MDM2 self-ubiquitination was notably increased in YF438-treated cells (Fig. 5H). Collectively, these results revealed that YF438 blocked the interaction of HDAC1 and MDM2, resulting in the dissociation of MDM2-MDMX and subsequent increase the ubiquitin-mediated degradation of MDM2 protein. In summary, we identified the novel HDACi, YF438 that blocks the complex formation of HDAC1–MDM2–MDMX, induces MDM2 self-ubiquitination and protein degradation, leads to inhibition of cell growth and metastasis, and ultimately inhibits TNBC progression (Fig. 5I).

Figure 5.

YF438 promotes MDM2 self-ubiquitination by disrupting the formation of the HDAC1–MDM2–MDMX complex in TNBC cells. A, 293T cells were cotransfected with the indicated plasmids for 12 hours, and cells were then treated with increasing concentrations of YF438 for 24 hours; the cell lysates were then immunoprecipitated using Flag-M2 beads, followed by Western blot analysis. B, Recombinant E. coli–expressed His-tagged HDAC1 protein was incubated with GST-MDM2 or GST proteins in the presence or absence of YF438 at 4°C for 4 hours, followed by GST pull-down assay and Western blotting. C, MDA-MB-231 cells were treated with or without YF438 (0.5 μmol/L) for 12 hours, immunostained for HDAC1 (red) and MDM2 (green), and then visualized by fluorescence microscopy. Scale bar, 20 μm. D, TNBC cells were transfected with siRNAs targeting HDAC1 (Si-HDAC1 #1 and #2) or nonspecific control (Si-Ctrl). The expression of HDAC1 and MDM2 was detected by Western blot analysis. E, MDA-MB-231 cells were transfected with siRNAs targeting HDAC1 or nonspecific control, and His-tagged ubiquitin (His-Ub) plasmid and cells were then treated with MG132 (10 μmol/L) for 6 hours prior to harvesting. Forty-eight hours after transfection, cell lysates were affinity purified with Ni-NTA-agarose beads (Invitrogen Corporation) and analyzed by immunoblotting with the indicated antibodies. F, MDA-MB-231 cells were treated with different concentrations of YF438. Cell extracts were precipitated using anti-MDM2 antibody or with IgG (mock IP), followed by Western blotting analysis with the indicated antibodies. G, MDA-MB-231 cells were transfected with siRNAs targeting HDAC1 or nonspecific control for 48 hours, and cells were then lysed and immunoprecipitated with MDM2 antibody or with IgG (mock IP). Coprecipitated MDMX was blotted with MDMX antibody. H, 293T cells were cotransfected with His-tagged ubiquitin (His-Ub) plasmid for 24 hours, and cells were then treated with different concentrations of YF438 for 12 hours. Cell lysates were finally affinity purified with Ni-NTA-agarose beads and analyzed by immunoblotting with the indicated antibodies. I, A model illustrating the role of YF438 in TNBC inhibition. In untreated tumor cells, HDAC1, MDM2, and MDMX form a complex to maintain MDM2 stability and to induce MDM2 protein at a relatively high level, and this ultimately induces tumorigenesis. Upon YF438 treatment, the interaction between HDAC1 and MDM2 is blocked, which induces the dissociation of MDM2-MDMX and results in increased MDM2 self-ubiquitination and protein degradation; the low level of MDM2 protein then eventually inhibits tumorigenesis.

Figure 5.

YF438 promotes MDM2 self-ubiquitination by disrupting the formation of the HDAC1–MDM2–MDMX complex in TNBC cells. A, 293T cells were cotransfected with the indicated plasmids for 12 hours, and cells were then treated with increasing concentrations of YF438 for 24 hours; the cell lysates were then immunoprecipitated using Flag-M2 beads, followed by Western blot analysis. B, Recombinant E. coli–expressed His-tagged HDAC1 protein was incubated with GST-MDM2 or GST proteins in the presence or absence of YF438 at 4°C for 4 hours, followed by GST pull-down assay and Western blotting. C, MDA-MB-231 cells were treated with or without YF438 (0.5 μmol/L) for 12 hours, immunostained for HDAC1 (red) and MDM2 (green), and then visualized by fluorescence microscopy. Scale bar, 20 μm. D, TNBC cells were transfected with siRNAs targeting HDAC1 (Si-HDAC1 #1 and #2) or nonspecific control (Si-Ctrl). The expression of HDAC1 and MDM2 was detected by Western blot analysis. E, MDA-MB-231 cells were transfected with siRNAs targeting HDAC1 or nonspecific control, and His-tagged ubiquitin (His-Ub) plasmid and cells were then treated with MG132 (10 μmol/L) for 6 hours prior to harvesting. Forty-eight hours after transfection, cell lysates were affinity purified with Ni-NTA-agarose beads (Invitrogen Corporation) and analyzed by immunoblotting with the indicated antibodies. F, MDA-MB-231 cells were treated with different concentrations of YF438. Cell extracts were precipitated using anti-MDM2 antibody or with IgG (mock IP), followed by Western blotting analysis with the indicated antibodies. G, MDA-MB-231 cells were transfected with siRNAs targeting HDAC1 or nonspecific control for 48 hours, and cells were then lysed and immunoprecipitated with MDM2 antibody or with IgG (mock IP). Coprecipitated MDMX was blotted with MDMX antibody. H, 293T cells were cotransfected with His-tagged ubiquitin (His-Ub) plasmid for 24 hours, and cells were then treated with different concentrations of YF438 for 12 hours. Cell lysates were finally affinity purified with Ni-NTA-agarose beads and analyzed by immunoblotting with the indicated antibodies. I, A model illustrating the role of YF438 in TNBC inhibition. In untreated tumor cells, HDAC1, MDM2, and MDMX form a complex to maintain MDM2 stability and to induce MDM2 protein at a relatively high level, and this ultimately induces tumorigenesis. Upon YF438 treatment, the interaction between HDAC1 and MDM2 is blocked, which induces the dissociation of MDM2-MDMX and results in increased MDM2 self-ubiquitination and protein degradation; the low level of MDM2 protein then eventually inhibits tumorigenesis.

Close modal

MDM2 is correlated with TNBC progression, and inhibition of MDM2 by YF438 shows promising anti-TNBC activity and chemosensitization

To further explore the potential role of MDM2 in TNBC tumorigenesis, we performed IHC analysis on normal ductal tissue from normal peritumoral specimens and tissues at different tumor stages of human TNBC. We demonstrated that MDM2 was highly expressed in stage III, stage IV, and lymph nodes of TNBC compared with adjacent normal ductal tissues (Fig. 6A; Supplementary Fig. S7A). MDM2 expression levels showed significant positive correlations with TNBC progression, and the high level of MDM2 was significantly involved in TNBC metastasis (Table 1). In addition, the expression of MDM2 is much higher in TNBC cells than in MCF10A and the non-TNBC MCF7 cells (Supplementary Fig. S7B), and the protein level of MDM2 in human TNBC samples is higher than those in conventional breast cancer samples and adjacent normal samples (Supplementary Fig. S7C). Collectively, these results indicated that MDM2 protein is highly expressed in TNBC and the level of MDM2 protein was closely correlated with the malignant degree of TNBC. Meanwhile, 80% of the aforementioned patient TNBC samples expressed mutant p53 (Supplementary Fig. S8A; Supplementary Table S3) and the p53 expression did not change significantly under YF438 treatment (Supplementary Fig. S8B), in addition, the expression of the mutant p53 protein is detectable in different TNBC cell lines (Supplementary Fig. S8C). These data indicated that the tumor-suppressing effect of YF438 on TNBC was driven by the downregulation of MDM2 consequent to the high expression of MDM2 protein in TNBC, but that it was not dependent on the status of p53. In addition, YF438 markedly downregulated MDM2 protein expression in primary tumors from the 4T1 breast cancer model (Fig. 6B), and the formation of the HDAC1–MDM2–MDMX complex was blocked by YF438 in primary tumors (Fig. 6C). In addition, the combination treatment of YF438 and doxorubicin displayed significant synergistic effects on TNBC, and that this combination more effectively inhibited tumor growth than doxorubicin alone (Fig. 6D–F), suggesting that the combination of YF438 and doxorubicin may provide a promising strategy for TNBC treatment.

Figure 6.

MDM2 was correlated with TNBC progression and inhibiting MDM2 by YF438 showed promising anti-TNBC activity and chemosensitization. A, IHC staining analysis on the expression of MDM2 in normal ductal tissue from peritumor normal specimens and tissues from different tumor stages of human TNBC; lymph node tissues were used for metastasis research. Scale bar, 100 μm. B, MDM2 protein levels in 4T1 primary tumor tissue were detected using IHC staining and Western blot analysis. Scale bar, 200 μm. Actin was used as a loading control. The MDM2 protein level in primary tumor tissue was detected using Western blot analysis. C, 4T1 primary tumors were lysed and immunoprecipitated with MDM2 antibody or with IgG (mock IP). Coprecipitated MDMX was blotted with MDMX antibody. D, 4T1 cells were injected subcutaneously into the fourth abdominal mammary fat pad of BALB/c mice. Seven days later, mice were treated with YF438 alone or in combination with doxorubicin every day for 35 days. Representative images of the primary tumors from each treatment group are shown. E, All mice underwent monitoring of tumor growth. Primary tumor volume was measured every week. Primary tumors were removed and weighed. F, Primary tumor weight in each group was measured. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 6.

MDM2 was correlated with TNBC progression and inhibiting MDM2 by YF438 showed promising anti-TNBC activity and chemosensitization. A, IHC staining analysis on the expression of MDM2 in normal ductal tissue from peritumor normal specimens and tissues from different tumor stages of human TNBC; lymph node tissues were used for metastasis research. Scale bar, 100 μm. B, MDM2 protein levels in 4T1 primary tumor tissue were detected using IHC staining and Western blot analysis. Scale bar, 200 μm. Actin was used as a loading control. The MDM2 protein level in primary tumor tissue was detected using Western blot analysis. C, 4T1 primary tumors were lysed and immunoprecipitated with MDM2 antibody or with IgG (mock IP). Coprecipitated MDMX was blotted with MDMX antibody. D, 4T1 cells were injected subcutaneously into the fourth abdominal mammary fat pad of BALB/c mice. Seven days later, mice were treated with YF438 alone or in combination with doxorubicin every day for 35 days. Representative images of the primary tumors from each treatment group are shown. E, All mice underwent monitoring of tumor growth. Primary tumor volume was measured every week. Primary tumors were removed and weighed. F, Primary tumor weight in each group was measured. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal
Table 1.

The percentages of tissues with different levels of staining for MDM2 in normal ductal tissues and TNBC tissues at different tumor stages.

MDM2
LowMediumHighTotal casesP (tumor vs. normal issue)
Normal ductal tissues 27 (90%) 3 (10%) 0 (0%) 30 <0.01 
Malignant tumor Stage I 2 (40%) 2 (40%) 1 (20%) <0.05 
 Stage II 2 (33.3%) 3 (50%) 1 (6.7%) <0.01 
 Stage III 1 (16.7%) 2 (33.3%) 3 (50%) <0.001 
 Stage IV 0 (0%) 2 (28.6%) 5 (71.4%) <0.01 
Metastasis 0 (0%) 1 (16.7%) 5 (83.3%) <0.01 
MDM2
LowMediumHighTotal casesP (tumor vs. normal issue)
Normal ductal tissues 27 (90%) 3 (10%) 0 (0%) 30 <0.01 
Malignant tumor Stage I 2 (40%) 2 (40%) 1 (20%) <0.05 
 Stage II 2 (33.3%) 3 (50%) 1 (6.7%) <0.01 
 Stage III 1 (16.7%) 2 (33.3%) 3 (50%) <0.001 
 Stage IV 0 (0%) 2 (28.6%) 5 (71.4%) <0.01 
Metastasis 0 (0%) 1 (16.7%) 5 (83.3%) <0.01 

Note: IHC staining analysis of the expression of MDM2 in normal ductal tissue from normal peritumoral specimens and tissues at different tumor stages of human TNBC. Levels of MDM2 expression were classified as high, medium, and low according to the staining signals for each group.

YF438 shows no potential toxicity in mice

To investigate the potential toxicity of YF438, female BALB/c mice were administered with either DMSO or YF438 for 28 days, and body weight was measured once a week. As shown in Supplementary Fig. S9A–S9C, we observed no apparent loss of weight and no obvious damage to the major organs in the YF438-treated group compared with the control group. The cytochrome P450 enzymes are membrane-bound hemoproteins that play a pivotal role in the detoxification of xenobiotics, cellular metabolism, and homeostasis (38). Supplementary Fig. S9D showed that YF438 only slightly modified the expression levels of the cytochrome P450 proteins. In addition, YF438 showed no effects on the hematologic parameters in BALB/c mice between the two groups by routine blood chemistry analysis (Supplementary Table S4). Levels of ALT and AST are representative indicators of liver function, and BUN is an indicator of kidney and liver conditions. We noted that ALT was slightly elevated in the group treated with YF438 compared with the DMSO-treated group, and that YF438 within the testing dose range did not obviously affect the AST and BUN levels (Supplementary Fig. S9E). These results collectively implied that YF438 manifested no systemic toxicity on mice at the therapeutic dose we used.

Prolonged exposure to YF438 significantly suppresses tumor growth and enhances the survival rate of mice with TNBC

To further examine the effect of prolonged exposure to YF438 on the incidence of TNBC formation, we adopted an orthotopic animal model. As shown in Supplementary Fig. S10A and S10B, the rate of tumor growth significantly decreased over 60 days in mice treated with YF438, as compared with mice injected with DMSO. Notably, the incidence of lung metastases in YF438-treated mice was also lower than that in the control group. Intriguingly, after prolonged exposure to YF438 for 60 days, the tumor growth was diminished relative to YF438 treatment for 30 days. These results indicated that prolonged exposure to YF438 attenuated the incidence of TNBC formation and ultimately inhibited tumor growth. In addition, YF438 significantly extended overall survival of mice with TNBC (Supplementary Fig. S10C). Collectively, these results indicated that prolonged exposure to therapeutic doses of YF438 significantly suppressed tumor growth and prolonged the survival of mice with TNBC. Our current work highlighted the possibility of HDACis as lead compounds that could be further developed for the potential prevention of TNBC.

TNBC represents the most aggressive subtype of breast cancer. At present, no specific molecular targets or chemotherapeutic vulnerabilities have been identified, which limit the development of therapeutic strategies for the disease, and novel therapeutic options are thus urgently needed (5, 6, 8). In this study, we screened an in-house library of hydroxamate-based small-molecule HDACis for new anti-TNBC drug candidates, and identified the promising anti-TNBC activity of YF438 both in vitro and in vivo. Further mechanistic studies revealed that YF438 induced accelerated degradation of MDM2 and finally downregulated MDM2 expression by blocking the formation of HDAC1–MDM2–MDMX complex. Our results also indicated that MDM2 may play essential roles in TNBC progression, and that targeting the HDAC1–MDM2–MDMX signaling axis might constitute a promising therapeutic strategy for the treatment of TNBC. Our current work highlighted the possibility of HDACis as lead compounds that could be further developed for the potential prevention of TNBC.

Numerous studies have demonstrated in recent years the pleiotropic antitumor activities of HDACis, and these molecules have been considered to comprise a promising class of novel anticancer agents for treating TNBC. There are currently over 20 different HDACis undergoing evaluation in different stages of clinical trials. However, most of the current HDACis exhibit only a moderate effect against solid tumors, are fraught with toxic side effects, and appear to easily induce drug resistance. Therefore, screening novel HDACis with high inhibitory activity and better therapeutic effect in TNBC are of paramount importance. In this study, we identified YF438 as a new HDACi that displays potent anti-TNBC activity both in vitro and in vivo, and demonstrated that the tumor-suppressing effect of YF438 on TNBC occurred in a p53-independent manner. We also investigated the molecular mechanisms by which YF438 inhibits TNBC. All of these results underscore our contention that YF438 may be a promising therapeutic candidate for TNBC.

Many studies have reported that the MDM2 proto-oncogene is overexpressed and amplified in a variety of human tumors, including breast cancer (20–23). Researchers recently demonstrated that a dual-target MDM2/MDMX inhibitor could be a useful agent in TNBC treatment (39). These results demonstrated the important roles of MDM2 in TNBC progression and also supported our conclusion that YF438 exerts its anti-TNBC activity via downregulating MDM2 expression. Most of the current direct MDM2 inhibitors exert their antitumor activity by blocking the p53-MDM2 protein–protein interaction and restoring the proapoptotic activity of p53 (27, 40). However, increasing evidence suggests that over 50% of all solid tumors carry the p53 mutation (41), and yet MDM2 has also been found to induce spontaneous tumorigenesis independent of p53 (25, 29). At present, the precise regulation of MDM2 protein levels and the detailed mechanisms underlying its inhibition of breast cancer have not yet been elucidated. Our study revealed that YF438 selectively suppressed TNBC cells due to the high expression of MDM2 protein, and that MDM2 played essential roles in YF438-induced inhibition of TNBC, and the HDAC1–MDM2–MDMX signaling axis functions as a novel target of YF438 for use in TNBC therapy.

Former studies had reported that downregulating MDM2 expression reduced cellular proliferation and induced dramatic apoptosis of breast cancer cells. However, in the current study, we demonstrated that knockdown of MDM2 alone did not induce obvious inhibition of cell growth and apoptosis in normal, unstressed TNBC cells, which is consistent with what had been reported previously (42). Moreover, published results with only knockdown of MDM2 in tumor-derived MDA-MB-231 cells showed no difference in the documented final weights of the tumors (43). Collectively, these results demonstrated that compared with YF438 treatment, knockdown of MDM2 alone in TNBC cells did not significantly inhibit tumor growth in vivo and in vitro under normal conditions. Use of direct MDM2 inhibitors would have killed cells expressing wild-type p53, and most MDM2 inhibitors require functional p53 to exert their antitumor effect. In our study, we demonstrated that the tumor-suppressing effect of YF438 on TNBC was p53 independent. Therefore, knockdown of MDM2 in TNBC cells under normal conditions would not activate p53 or further promote cellular apoptosis. In addition, the TNBC cells used in this study all expressing mutant p53, our results indicated that the level of mutant p53 in different TNBC cell lines is similar but not identical (Supplementary Fig. S8C). Results from the reported studies were consistent with those we had obtained in this study (44, 45). However, other studies showed that p53 is undetectable in 4T1 cells (46, 47). These seemingly contradictory results may be due to the different sources of 4T1 cell lines and the different p53 antibodies used in this study.

Many signaling pathways that are involved in regulating cell growth or apoptosis appear to be regulated by MDM2. For example, cell-cycle progression is mediated by MDM2 via p53 inhibition and by regulating the pRb/E2F complex. Growth and survival signaling in the PI3K/Akt pathway and the TGFβ growth-restrictive pathway are also regulated by MDM2 (48). A group previously reported that inhibiting FOXO3a via MDM2-mediated degradation promoted tumorigenesis (49). These results suggested that MDM2 appears to play a key role in controlling several reactions via the coordination and organization of different partners through its E3 ubiquitination ligase activity. In addition, we explored that YF438 could downregulate the expression of XIAP protein and XIAP overexpression partially rescued the cells from apoptosis under YF438 treatment (Supplementary Fig. S11A and S11B). This experiment indicated that downregulating the expression of XIAP may play essential role in YF438-induced apoptosis. Further study indicated that YF438 treatment could alter the E3 ligase activity of MDM2. As shown in the Supplementary Fig. S12A and S12B, YF438 treatment significantly increased the ubiquitination of E2F1 protein and E2F1 overexpression partially rescued the cells from growth suppression upon YF438 treatment, indicating that the downregulation of E2F1 via MDM2 may play a critical role in YF438-induced cell growth suppression. Given that MDM2 could regulate the stability of a variety of downstream proteins and there may exist other potential downstream targets that are selectively regulated by the altered MDM2 E3 ligase activity under YF438 treatment.

According to the results of proteomic analysis, there are also other significantly altered proteins in response to YF438 treatment. Among the top 10 upregulated proteins listed in Supplementary Table S2, the expression of Abracl protein was significantly increased under YF438 treatment as determined by Western blot analysis (Supplementary Fig. S3A). Abracl is a protein-coding gene that is associated with splenic artery aneurysm, and its role in TNBC has not been confirmed, it will be interesting to further explore the potential role of Abracl in YF438-induced inhibition of TNBC. The Dhcr24 gene encodes a flavin adenine dinucleotide–dependent oxidoreductase that is overexpressed in adrenal gland cancer cells. Further study revealed that the protein expression of Dhcr24 was not significantly decreased under YF438 treatment using Western blot analysis (Supplementary Fig. S3B). As substantiated by our study, no significant changes in MDMX expression were observed with YF438 treatment. Therefore, although structurally similar, genetic evidence suggests that MDMX cannot compensate for the loss of MDM2 expression during embryonic development in the mouse, nor can MDM2 compensate for the loss of MDMX expression (50), this suggests that the two proteins have nonoverlapping functions.

In summary, our studies have identified a novel HDACi, namely, YF438 that exerts effective anti-TNBC activity both in vitro and in vivo. YF438 significantly inhibited cell growth and metastasis of TNBC via inducing downregulation of MDM2 expression, and further studies revealed that the mechanism underlying YF438′s regulation of MDM2 protein alteration was blockage of the formation of the HDAC1–MDM2–MDMX complex. Our results reflected the essential role of MDM2 in TNBC development, and this raises the possibility of assessing the clinical association between MDM2 and TNBC progression. In addition, YF438 showed no potential toxicity in mice and prolonged exposure to therapeutic doses of YF438 significantly suppressed tumor growth, and enhanced the survival of mice with TNBC. Collectively, our studies suggest that YF438 may serve as a promising lead compound in TNBC prevention, and that targeting the HDAC1–MDM2–MDMX signaling axis by YF438 may constitute a promising therapeutic strategy for TNBC.

No disclosures were reported.

P. Shan: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, validation, visualization, methodology, writing–original draft, writing–review and editing. F. Yang: Conceptualization, resources, data curation, formal analysis, methodology. H. Qi: Validation, methodology. Y. Hu: Data curation, formal analysis. S. Zhu: Resources, methodology. Z. Sun: Funding acquisition. Z. Zhang: Methodology. C. Wang: Data curation, software. C. Hou: Data curation, validation. J. Yu: Data curation, software. L. Wang: Methodology. Z. Zhou: Resources, methodology. P. Li: Supervision, visualization. H. Zhang: Conceptualization, formal analysis, supervision, writing–original draft, project administration, writing–review and editing. K. Wang: Conceptualization, resources, validation, visualization, methodology, project administration.

This work was supported by the Major Research Program of the National Natural Science Foundation of China (grant no. 91849209); the National Natural Science Foundation of China (grant no. 81803016, 81703360); the Natural Science Foundation of Shandong Province (grant no. ZR2019HB012); the Qingdao Science and Technology Plan fund (grant no. RZ1900002629, 18-6-1-63-nsh); Qingdao Municipal Medical Research Guidance Plan 2019 (grant no. 2019-WJZD078, 2019-WJZD060). The authors thank C. Liu for supporting this study and for guidance and insightful discussions, and Y. Gao for technical support. The authors thank the participants and staff of Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Jemal
A
,
Center
MM
,
DeSantis
C
,
Ward
EM
. 
Global patterns of cancer incidence and mortality rates and trends
.
Cancer Epidemiol Biomarkers Prev
2010
;
19
1893
907
.
2.
DeSantis
C
,
Ma
J
,
Bryan
L
,
Jemal
A
. 
Breast cancer statistics, 2013
CA Cancer J Clin
2014
;
64
:
52
62
.
3.
Ahmed
S
,
Sami
A
,
Xiang
J
. 
HER2-directed therapy: current treatment options for HER2-positive breast cancer
.
Breast Cancer
2015
;
22
:
101
16
.
4.
Yu
KD
,
Di
GH
,
Wu
J
,
Lu
JS
,
Shen
KW
,
Liu
GY
, et al
Breast cancer patients with estrogen receptor-negative/progesterone receptor-positive tumors: being younger and getting less benefit from adjuvant tamoxifen treatment
.
J Cancer Res Clin Oncol
2008
;
134
:
1347
54
.
5.
Dawson
SJ
,
Provenzano
E
,
Caldas
C
. 
Triple negative breast cancers: clinical and prognostic implications
.
Eur J Cancer
2009
;
45
:
27
40
.
6.
Dent
R
,
Trudeau
M
,
Pritchard
KI
,
Hanna
WM
,
Kahn
HK
,
Sawka
CA
, et al
Triple-negative breast cancer: clinical features and patterns of recurrence
.
Clin Cancer Res
2007
;
13
:
4429
34
.
7.
Dolle
JM
,
Daling
JR
,
White
E
,
Brinton
LA
,
Doody
DR
,
Porter
PL
, et al
Risk factors for triple-negative breast cancer in women under the age of 45 years
.
Cancer Epidemiol Biomarkers Prev
2009
;
18
:
1157
66
.
8.
Haffty
BG
,
Yang
Q
,
Reiss
M
,
Kearney
T
,
Higgins
SA
,
Weidhaas
J
, et al
Locoregional relapse and distant metastasis in conservatively managed triple negative early-stage breast cancer
.
J Clin Oncol
2006
;
24
:
5652
7
.
9.
Luu
TH
,
Morgan
RJ
,
Leong
L
,
Lim
D
,
McNamara
M
,
Portnow
J
, et al
A phase II trial of vorinostat (suberoylanilide hydroxamic acid) in metastatic breast cancer: a california cancer consortium study
.
Clin Cancer Res
2008
;
14
:
7138
42
.
10.
Brouckaert
O
,
Wildiers
H
,
Floris
G
,
Neven
P
. 
Update on triple-negative breast cancer: prognosis and management strategies
.
Int J Womens Health
2012
;
4
:
511
20
.
11.
Khan
O
,
La Thangue
NB
. 
HDAC inhibitors in cancer biology: emerging mechanisms and clinical applications
.
Immunol Cell Biol
2012
;
90
:
85
94
.
12.
Bots
M
,
Johnstone
RW
. 
Rational combinations using HDAC inhibitors
.
Clin Cancer Res
2009
;
15
:
3970
7
.
13.
Bolden
JE
,
Peart
MJ
,
Johnstone
RW
. 
Anticancer activities of histone deacetylase inhibitors
.
Nat Rev Drug Discov
2006
;
5
:
769
84
.
14.
Catley
L
,
Weisberg
E
,
Tai
YT
,
Atadja
P
,
Remiszewski
S
,
Hideshima
T
, et al
NVP-LAQ824 is a potent novel histone deacetylase inhibitor with significant activity against multiple myeloma
.
Blood
2003
;
102
:
2615
22
.
15.
Qiu
T
,
Zhou
L
,
Zhu
W
,
Wang
T
,
Wang
J
,
Shu
Y
, et al
Effects of treatment with histone deacetylase inhibitors in solid tumors: a review based on 30 clinical trials
.
Future Oncol
2013
;
9
:
255
69
.
16.
Chun
P
. 
Histone deacetylase inhibitors in hematological malignancies and solid tumors
.
Arch Pharm Res
2015
;
38
:
933
49
.
17.
Federico
M
,
Bagella
L
. 
Histone deacetylase inhibitors in the treatment of hematological malignancies and solid tumors
.
J Biomed Biotechnol
2011
;
2011
:
475641
.
18.
Momand
J
,
Zambetti
GP
,
Olson
DC
,
George
D
,
Levine
AJ
. 
The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation
.
Cell
1992
;
69
:
1237
45
.
19.
Haupt
Y
,
Maya
R
,
Kazaz
A
,
Oren
M
. 
Mdm2 promotes the rapid degradation of p53
.
Nature
1997
;
387
:
296
9
.
20.
Freedman
DA
,
Wu
L
,
Levine
AJ
. 
Functions of the MDM2 oncoprotein
.
Cell Mol Life Sci
1999
;
55
:
96
107
.
21.
Oliner
JD
,
Saiki
AY
,
Caenepeel
S
. 
The role of MDM2 amplification and overexpression in tumorigenesis
.
Cold Spring Harb Perspect Med
2016
;
6
:
a026336
.
22.
McCann
AH
,
Kirley
A
,
Carney
DN
,
Corbally
N
,
Magee
HM
,
Keating
G
, et al
Amplification of the MDM2 gene in human breast cancer and its association with MDM2 and p53 protein status
.
Br J Cancer
1995
;
71
:
981
5
.
23.
Fontana
X
,
Ferrari
P
,
Abbes
M
,
Monticelli
J
,
Namer
M
,
Bussiere
F
. 
[Study of mdm2 gene amplification in primary breast tumors]
.
Bull Cancer
1994
;
81
:
587
92
.
24.
Gao
C
,
Xiao
G
,
Piersiga
A
,
Gou
J
,
Ogunwobi
O
,
Bargonetti
J
. 
MDM2 and MDMX promote p53-independent initiation of circulating tumor cells from triple negative breast cancers [abstract]
.
In
:
Proceedings of the American Association for Cancer Research Annual Meeting 2018
; 
2018
Apr 14–18
;
Chicago, IL. Philadelphia (PA)
:
AACR
;
Cancer Res 2018
;
78
(
13 Suppl
):
Abstract nr 5188
.
25.
Zhang
Z
,
Zhang
R
. 
p53-independent activities of MDM2 and their relevance to cancer therapy
.
Curr Cancer Drug Targets
2005
;
5
:
9
20
.
26.
Xiong
J
,
Yang
Q
,
Li
J
,
Zhou
S
. 
Effects of MDM2 inhibitors on vascular endothelial growth factor-mediated tumor angiogenesis in human breast cancer
.
Angiogenesis
2014
;
17
:
37
50
.
27.
Surmiak
E
,
Neochoritis
CG
,
Musielak
B
,
Twarda-Clapa
A
,
Kurpiewska
K
,
Dubin
G
, et al
Rational design and synthesis of 1,5-disubstituted tetrazoles as potent inhibitors of the MDM2-p53 interaction
.
Eur J Med Chem
2017
;
126
:
384
407
.
28.
Zhao
Y
,
Aguilar
A
,
Bernard
D
,
Wang
S
. 
Small-molecule inhibitors of the MDM2-p53 protein-protein interaction (MDM2 inhibitors) in clinical trials for cancer treatment
.
J Med Chem
2015
;
58
:
1038
52
.
29.
Jones
SN
,
Hancock
AR
,
Vogel
H
,
Donehower
LA
,
Bradley
A
. 
Overexpression of Mdm2 in mice reveals a p53-independent role for Mdm2 in tumorigenesis
.
Proc Natl Acad Sci U S A
1998
;
95
:
15608
12
.
30.
Yang
F
,
Shan
P
,
Zhao
N
,
Ge
D
,
Zhu
K
,
Jiang
CS
, et al
Development of hydroxamate-based histone deacetylase inhibitors containing 1,2,4-oxadiazole moiety core with antitumor activities
.
Bioorg Med Chem Lett
2019
;
29
:
15
21
.
31.
Shan
PP
,
Fan
GJ
,
Sun
LH
,
Liu
JQ
,
Wang
WF
,
Hu
C
, et al
SIRT1 functions as a negative regulator of eukaryotic poly(A)RNA transport
.
Curr Biol
2017
;
27
:
2271
84
.
32.
Mann
BS
,
Johnson
JR
,
Cohen
MH
,
Justice
R
,
Pazdur
R
. 
FDA approval summary: vorinostat for treatment of advanced primary cutaneous T-cell lymphoma
.
Oncologist
2007
;
12
:
1247
52
.
33.
Friedl
P
,
Wolf
K
. 
Tumour-cell invasion and migration: diversity and escape mechanisms
.
Nat Rev Cancer
2003
;
3
:
362
74
.
34.
Kalluri
R
,
Weinberg
RA
. 
The basics of epithelial-mesenchymal transition
.
J Clin Invest
2009
;
119
:
1420
8
.
35.
Zhang
Z
,
Wang
H
,
Li
M
,
Rayburn
ER
,
Agrawal
S
,
Zhang
R
. 
Stabilization of E2F1 protein by MDM2 through the E2F1 ubiquitination pathway
.
Oncogene
2005
;
24
:
7238
47
.
36.
Ito
A
,
Kawaguchi
Y
,
Lai
CH
,
Kovacs
JJ
,
Higashimoto
Y
,
Appella
E
, et al
MDM2-HDAC1-mediated deacetylation of p53 is required for its degradation
.
EMBO J
2002
;
21
:
6236
45
.
37.
Sharp
DA
,
Kratowicz
SA
,
Sank
MJ
,
George
DL
. 
Stabilization of the MDM2 oncoprotein by interaction with the structurally related MDMX protein
.
J Biol Chem
1999
;
274
:
38189
96
.
38.
Manikandan
P
,
Nagini
S
. 
Cytochrome P450 structure, function and clinical significance: a review
.
Curr Drug Targets
2018
;
19
:
38
54
.
39.
Fan
Y
,
Li
M
,
Ma
K
,
Hu
Y
,
Jing
J
,
Shi
Y
, et al
Dual-target MDM2/MDMX inhibitor increases the sensitization of doxorubicin and inhibits migration and invasion abilities of triple-negative breast cancer cells through activation of TAB1/TAK1/p38 MAPK pathway
.
Cancer Biol Ther
2019
;
20
:
617
32
.
40.
Kojima
K
,
Konopleva
M
,
Samudio
IJ
,
Shikami
M
,
Cabreira-Hansen
M
,
McQueen
T
, et al
MDM2 antagonists induce p53-dependent apoptosis in AML: implications for leukemia therapy
.
Blood
2005
;
106
:
3150
9
.
41.
Mazars
R
,
Spinardi
L
,
BenCheikh
M
,
Simony-Lafontaine
J
,
Jeanteur
P
,
Theillet
C
. 
p53 mutations occur in aggressive breast cancer
.
Cancer Res
1992
;
52
:
3918
23
.
42.
Xiong
J
,
Li
JS
,
Yang
Q
,
Wang
J
,
Su
TF
,
Zhou
S
. 
Gossypol has anti-cancer effects by dual targeting MDM2 and VEGF in human breast cancer
.
Breast Cancer Res
2017
;
19
:
27
.
43.
Hauck
PM
,
Wolf
ER
,
Olivos
DJ
 3rd
,
Batuello
CN
,
McElyea
KC
,
McAtarsney
CP
, et al
Early-stage metastasis requires Mdm2 and Not p53 gain of function
.
Mol Cancer Res
2017
;
15
:
1598
607
.
44.
Delphi
L
,
Sepehri
H
. 
Apple pectin: a natural source for cancer suppression in 4T1 breast cancer cells in vitro and express p53 in mouse bearing 4T1 cancer tumors, in vivo
.
Biomed Pharmacother
2016
;
84
:
637
44
.
45.
Wang
D
,
Xiao
F
,
Feng
Z
,
Li
M
,
Kong
L
,
Huang
L
, et al
Sunitinib facilitates metastatic breast cancer spreading by inducing endothelial cell senescence
.
Breast Cancer Res
2020
;
22
:
103
.
46.
Anand
S
,
Rollakanti
KR
,
Brankov
N
,
Brash
DE
,
Hasan
T
,
Maytin
EV
. 
Fluorouracil enhances photodynamic therapy of squamous cell carcinoma via a p53-independent mechanism that increases protoporphyrin IX levels and tumor cell death
.
Mol Cancer Ther
2017
;
16
:
1092
101
.
47.
Morrison
CD
,
Allington
TM
,
Thompson
CL
,
Gilmore
HL
,
Chang
JC
,
Keri
RA
, et al
c-Abl inhibits breast cancer tumorigenesis through reactivation of p53-mediated p21 expression
.
Oncotarget
2016
;
7
:
72777
94
.
48.
Levav-Cohen
Y
,
Haupt
S
,
Haupt
Y
. 
Mdm2 in growth signaling and cancer
.
Growth Factors
2005
;
23
:
183
92
.
49.
Yang
JY
,
Zong
CS
,
Xia
W
,
Yamaguchi
H
,
Ding
Q
,
Xie
X
, et al
ERK promotes tumorigenesis by inhibiting FOXO3a via MDM2-mediated degradation
.
Nat Cell Biol
2008
;
10
:
138
48
.
50.
Parant
J
,
Chavez-Reyes
A
,
Little
NA
,
Yan
W
,
Reinke
V
,
Jochemsen
AG
, et al
Rescue of embryonic lethality in Mdm4-null mice by loss of Trp53 suggests a nonoverlapping pathway with MDM2 to regulate p53
.
Nat Genet
2001
;
29
:
92
5
.