Oncogenic ERG Represses PI3K Signaling through Downregulation of IRS2

Tumorigenesis is a multifaceted process involving the complex interplay of several biologic systems that are highly dependent on the activation of pro-proliferative, survival, and migration pathways. Genomic rearrangements of the ETS family transcription factor ERG are the most common early initiating events in prostate cancer, occurring in approximately 50% of primary prostate cancers (1–3). Mouse modeling studies have demonstrated that overexpression of ERG alone confers a phenotype of mild prostatic hyperplasia but is not sufficient to promote prostate cancer development (4, 5). However, combined overexpression of ERG and loss of PTEN in preclinical models results in the development of a high-grade invasive prostate cancer (4, 5).

The PI3K pathway plays a dominant driver role in a variety of malignancies, most frequently activated through loss of the tumor suppressor PTEN. PI3K signaling originates at the cellular membrane through ligand and receptor binding of receptor tyrosine kinases, G-protein–coupled receptors, and other membrane bound receptors (6). This results in the active recruitment of the PI3K complex, which catalyzes the phosphorylation of downstream substrates from the generation of PIP3. PTEN is a phospholipid and protein phosphatase that is responsible for dephosphorylating PIP3 to PIP2, and thus serves the repressive gate keeper for PI3K signaling. The PI3K pathway is responsible for the regulation of numerous cellular processes play a significant role in normal cellular physiology, and when aberrantly active contribute to tumorigenesis (6). Loss of the tumor suppressor PTEN, promoting aberrant PI3K signaling, occurs in approximately 20% of primary prostate cancer and nearly 50% of metastatic prostate cancer (1). Previous preclinical studies have shown that loss of PTEN resulting in activation of PI3K signaling is a driver of prostate cancer progression and occurs in a dose-dependent fashion (7, 8).

Although activation of PI3K signaling is sufficient to initiate tumorigenesis in genetically engineered mouse (GEM) models, molecular profiling studies in prostate cancer suggest that loss of PTEN and activation of PI3K signaling are secondary progression events (1, 9). In contrast to the subclonal PTEN genomic alterations in prostate cancer suggestive of a secondary event, genomic rearrangements of ERG are highly clonal, providing evidence that ERG is an early initiating event in prostate cancer that enriches for concomitant loss of PTEN. Given the significant biologic interaction of ERG and PTEN in prostate tumorigenesis we sought to further define the molecular interaction of these two dominant pathways in prostate cancer.

Murine prostates were digested with Collagenase/Hyaluronidase (STEMCELL; 07912) and subsequently with TrypLE (GIBCO). Cells were cultured in suspension for 5 to 10 days and transferred to collagen-coated plates as described previously (10, 11). These cells were authenticated by PCR genotyping protocols established for the Pten^lox/lox and Rosa26-ERG Pten^lox/lox GEM models. The VCaP and 293FT were obtained from ATCC and validated by STR genotyping protocols. Normal human prostate organoids were generated by our group from a patient undergoing a radical prostatectomy after written and informed consent on our Institutional Review Board (IRB)-approved protocols (IRB 06-107 and 12-001) and grown using standard organoid culture methodology. These two protocols are approved by MSKCC IRB for fresh tissue acquisition for the establishment of prostate organoids from patients and all experiments were conducted in accordance with recognized ethical guidelines (e.g., Declaration of Helsinki, CIOMS, Belmont Report, U.S. Common Rule). All cell lines and prostate organoids used in our studies have tested negative for Mycoplasma using the MycoProbe Mycoplasma Detection Kit (R&D Systems). All cell lines and organoids were freshly thawed and only passaged to achieve the number of cells required for in vitro or in vivo experiments.

Cell lysates were prepared in RIPA buffer supplemented with proteinase and phosphatase inhibitors. Proteins were resolved on NuPAGE Novex 4% to 12% Bis-Tris Protein Gels (Thermo Fisher Scientific) and transferred electronically onto a polyvinylidene fluoride 0.45 μmol/L membrane (Millipore). All experiments were performed in triplicate and the representative blots are shown. Quantification was performed using ImageJ software.

The following antibodies were used for Western blotting and chromatin immunoprecipitation (ChIP): AR (Abcam; ab108341; 1:1,000 for Western blotting), β-actin (Abcam; ab49900; 1:50,000 for Western blotting), ERG (Abcam; ab92513; 1:1,000 for Western blotting), histone H3 (acetyl K27; Abcam; ab4729), IRS-1 (Cell Signaling Technology; 2390S; 1:1,000 for Western blotting), IRS-2 (Cell Signaling Technology; 4502S; 1:1,000 for Western blotting), phospho-AKT (Ser308; Cell Signaling Technology; 13038S; 1:1,000 for Western blotting), phospho-AKT (Ser473; Cell Signaling Technology; 4060L; 1:1,000 for Western blotting), PTEN (Cell Signaling Technology; 9559L; 1:1,000 for Western blotting), phospho-IGF1R (Cell Signaling Technology; 3024S; 1:1,000 for Western blotting), FKBP5(Cell Signaling Technology; 12210S; 1:1,000 for Western blotting), phospho-Pras40 (Cell Signaling Technology; 2997s; 1:1,000 for Western blotting), phospho-EGFR (Cell Signaling Technology; 3777S; 1:1,000 for Western blotting), phosphor-GSK3B (Cell Signaling Technology; 9336S; 1:1,000 for Western blotting).

To knockout AR and ERG in mouse organoids, three pairs of single guide RNA (sgRNA) sequences were designed for human ERG and two pairs for murine AR using the design tool from the Feng Zhang Lab (MIT) and cloned into the LentiCRISPRv2 (Addgene, 52962). Murine prostate cells were infected with lentivirus for 48 to 72 hours and selected with puromycin (4 μg/mL) for 7 to 10 days. The target guides sequences are as follows: sgERG-1: F: CACCGACACCGTTGGGATGAACTA; sgERG-1: R: AAACTAGTTCATCCCAACGGTGTC; sgERG-2: F: CACCGTTCCTTCCCATCGATGTTC; sgERG-2: R: AAACGAACATCGATGGGAAGGAAC; sgERG-3: F: CACCGTACAGACCATGTGCGGCAG; sgERG-3: R: AAACCTGCCGCACATGGTCTGTAC; sgAr-1: F: CACCGGTGGAAAGTAATAGTCGAT; sgAr-1: R: AAACATCGACTATTACTTTCCACC; sgAr-2: F: CACCGGGTGGAAAGTAATAGTCGA; sgAr-2: R AAACTCGACTATTACTTTCCACCC.

A hairpin sequence against Pten was cloned into Lenti (pRRL; a gift from the Zuber lab) to make lentiviral particles. The sequence was as follows: Pten shRNA: GCCAGCTAAAGGTGAAGATATA.

To knockdown IRS-2, Rosa26-ERG Pten^lox/lox –CrisprERG cells were transfected with predesigned siRNAs (25 nmol/L) to knockdown IRS2 (Ambion; 4390771-s118458) or Silencer select negative control (Life Tech; 4390844).

Mouse IRS-2 (Origene; MR227167) was cloned into a Myc-DDK-tagged Lenti plasmid (Origene; PS100092).

pCW-CFP and pCW-CFP-ERG were transfected into 293FT cells to make lentiviruses. Wild-type normal mouse and human prostate organoids were infected with the viruses and treated with puromycin (4 μg/mL) for 7 days for cell selection. Cells were then treated with doxycycline (1 μg/mL) to induce ERG expression at different time points.

A 1 kb segment of the human IRS2 promoter was cloned into a firefly luciferase promoter expression construct (Switchgear genomics; catalog no.: S711020) and cotransfections were performed in 293T cells with MSCV-GFP or MSCV-ERG. A dual luciferase reporter assay was performed, and signals was quantified with normalization to Renilla luciferase to control for transfection efficiency. All experiments were performed in triplicates, and the mean signals were reported.

QIAshredder (Qiagen; 79656) and RNeasy Mini Kit (Qiagen; 74106) were used to isolate RNA from cell lines. RNA sequencing (RNA-seq) was performed by New York genome center. RNA-seq libraries were prepared using the TruSeq Stranded mRNA Sample Preparation Kit in accordance with the manufacturer's instructions. Final libraries were quantified using the KAPA Library Quantification Kit (KAPA Biosystems), and were sequenced on an Illumina HiSeq2500 sequencer (v4 chemistry) using 2 × 50 bp cycles targeting 35M single-end reads per sample. RNA-seq data deposited GEO GSE112469.

Following the protocol previously described (12), chromatin isolation from mouse organoid cell lines and immunoprecipitation using antibodies AR, ERG, and H3K27ac was performed. Next-generation sequencing was carried out on an Illumina HiSeq2000 platform with 50 bp or 100 bp single reads.

To identify the AR and Erg binding sites on chromosome, CHIP-seq analyses were performed on the parental cells as well as AR or ERG Crispr knockout cell lines. Sequence reads were aligned to mm10 using bowtie program (13). MACS2 call peak program was used to call the peaks for each CHIP-seq samples compared with input sequence using standard parameters (14). Peaks were annotated using Homer Annotate Peaks program with default parameters identifying promoter, gene body, and intergenic binding sites (15). ChIP-seq data deposited GEO GSE112414.

Cells per well were plated (1 × 10³) in a collagen-coated 96-well plate. The number of viable cells were counted using Cell Titer-Glo Luminescent Cell Viability Assay Kit (Promega; G7573). Cell migration was analyzed using a xCELLigence real-time cell analyzer linked Boyden chamber assay.

A total of 2.0 × 10⁶ cells resuspended in 100 μL of 1:1 mix of growth media and Matrigel (Corning; 356237) were injected into 6 to 8 weeks old CB17-SCID male mice (Taconic). Tumor size was measured weekly by Peira TM900 (Peira Scientific Instruments). The volume of tumors was calculated using the formula: volume = length × width × height. A total of 10 tumors per group were used to assay tumor growth in vivo. All experiments were approved by our Institutional Animal Care and Use Committee protocol 06-07-012.

Xenografts were fixed using 4% paraformaldehyde for 2 to 3 days and embedded using a Leica ASP6025 tissue processor (Leica Biosystems).

To directly study the molecular interaction of ERG and PTEN loss on PI3K signaling, we took advantage of the prostate organoid culture methodology and generated prostate organoids from wild-type, Pb-Cre Rosa26-ERG, Pb-Cre Pten^lox/lox, and Pb-Cre Rosa26- ERG Pten^lox/lox GEM models. In concordance with previous GEM model data, ERG overexpression or Pten loss alone was not sufficient for tumorigenesis after injection of these organoids into the flanks of SCID mice whereas combined ERG overexpression and loss of Pten resulted in high-grade invasive prostate cancer (Fig. 1A and B). Surprisingly, we found that ERG expression was associated with reduced levels of pAkt both in the context of Pten wild-type and Pten loss prostate organoids (Fig. 1C). Interestingly, ERG overexpression, in the context of wild-type Pten, was associated with an increase in Pten protein levels. To address whether ERG could be a transcriptional activator of Pten, we performed qRT-PCR and found that Pten mRNA levels did not differ between ERG-positive and -negative prostate organoids (Supplementary Fig. S1A). Given that the repression of PI3K signaling in the setting of ERG overexpression occurred in both the presence and absence of Pten demonstrates that this phenotype was ERG and not Pten dependent. To further study this, we analyzed The Cancer Genome Atlas (TCGA) primary prostate cancer genomic profiling dataset categorizing tumors based on ERG/ETS and PTEN status. Indeed, we found that ERG genomic rearrangements are correlated with repression of a PI3K/AKT RNA expression signature and PTEN loss significantly enhances this signature, P < 0.001 (Fig. 1D; refs. 2, 16).

To determine if PI3K signaling was directly repressed in an ERG dependent manner, knockout of ERG in the ERG Pten-/- organoids was performed using the CRISPR system. These cells displayed a profound increase in pAkt (Fig. 2A). We then used a doxycycline inducible system in wild-type organoids and, demonstrated reduced levels of pAkt at T308, the direct PI3K-Pdk1 site, upon acute ERG expression (Fig. 2B; Supplementary Fig. S1B). We obtained similar results in the androgen regulated ERG-positive human prostate cancer cell line VCaP, where downregulation of ERG promoted a dose-dependent increase in PI3K signaling (Supplementary Fig. S1C). Thus, both gain- and loss-of-function experiments in mouse and human models establish that ERG suppresses PI3K activity in prostate cells.

One potential mechanism for the suppressive effect of ERG on PI3K signaling could be through direct interplay with AR, as we have previously shown that AR inhibits PI3K through a reciprocal feedback mechanism and ERG alters the AR cistrome and promotes AR transcriptional activity (5, 17). To address this question, we generated a series of organoids using CRISPR technology to knockout AR and ERG, respectively. As expected, knockout of AR results in upregulation of PI3K signaling in the setting of Pten loss alone. However, knockout of AR in ERG Pten^−/− prostate organoids only marginally increased PI3K signaling (Supplementary Fig. S2A), indicating that PI3K suppression in the context of constitutive ERG overexpression is not primarily mediated by AR. Although AR is not the direct dominant mechanism repressing PI3K signaling in the context of TMPRSS2:ERG rearrangements, it does indirectly influence PI3K signaling through regulation of ERG, adding complexity to our original PI3K-AR reciprocal feedback model, which was characterized in ERG-negative model systems.

To further elucidate the mechanism responsible for PI3K repression, we performed RNA-seq analysis across our panel of prostate organoids. We compared differential gene expression between ERG Pten^−/− and ERG Pten^−/− CRISPR ERG prostate cancer organoids and one of the top most significantly upregulated genes following CRISPR ERG was IRS2 (Fig. 2C; Supplementary Table S1). IRS2 is a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between IGF1R/INSR and PI3K (18–20). In accordance with this data, we analyzed the expression of IRS2 in ERG-positive prostate cancers profiled in TCGA, and indeed, ERG-positive tumors displayed a significant reduction in IRS2 levels (Fig. 2D).

To determine if ERG is a direct regulator of IRS2, we performed ERG ChIP-seq in our panel of ERG Pten^−/− prostate cancer organoids and identified an ERG binding peak in the IRS2 promoter at an ETS consensus sequence, and this peak was absent after CRISPR deletion of ERG (Fig. 2E; Supplementary Fig. S1D). To further investigate the role of ERG in directly repressing the IRS2 promoter, we transfected 293T cells with an IRS2-promoter-firefly luciferase construct and examined the impact of ERG expression on IRS2 promoter activity, controlling for transfection efficiency through normalization to a Renilla luciferase reporter. Indeed, we observed that ERG overexpression repressed the transcriptional activity of the IRS2 promoter (Fig. 3A). Next, we examined the levels of ERG and IRS2 in wild-type and Rosa26-ERG prostate organoids following doxycycline-inducible expression of ERG in wild-type prostate organoids. IRS2 levels were suppressed in the context of ERG expression (Fig. 3B; Supplementary Fig. S2A). Conversely, Crispr deletion of ERG in Rosa26- ERG Pten^−/− organoids resulted in increased protein levels of IRS2 (Fig. 3C). Furthermore, acute AR inhibition of in vivo VCaP tumors demonstrated reduced ERG levels, leading to increased IRS2 levels and enhanced PI3K signaling (Supplementary Fig. S2B). Importantly, siRNA knockdown of the increased IRS2 levels in the Rosa26- ERG Pten^−/− organoids following ERG deletion reduced pAkt, consistent with a model whereby ERG impairs PI3K signaling by repression of IRS2 expression (Fig. 3D; Supplementary Fig. S2C).

Given the role of IRS2 in mediating RTK signal transduction to PI3K, we took a focused look at the expression of a variety of RTK PI3K signaling mediators and did not observe any other differentially expressed genes (Supplementary Fig. S2D). An exploratory phosphor-RTK array analysis was performed, which demonstrated diminished pRTK signaling across several RTKs in the setting of ERG expression (Supplementary Fig. S3A). We then explored the phosphorylation and total protein levels of Igf1r in our Pten^−/−, ERG Pten^−/−, and ERG Pten^−/− Crispr ERG organoids. Interestingly, ERG overexpression was associated with reduced phosphorylation and total protein levels of Igf1r, and upon ERG knockout, phosphorylation of Igf1R increase significantly with an associated increase in total Igf1r levels (Fig. 3E). To demonstrate that the changes in RTK phosphorylation were IRS2 dependent, we evaluated the levels of Igf1r in the setting of ERG aberrant expression. Indeed, we find that in the setting of ERG overexpression where IRS2 levels are suppressed Igf1r show reduced phosphorylation and total protein levels, and overexpression of IRS2 in this model system, increases the phosphorylation and total levels of Igf1r (Fig. 3F; Supplementary Fig. S3B).

To further validate that ERG is a transcriptional repressor of IRS2, we performed an in silico analysis of publicly available ChIP-seq datasets using the ChIP-Atlas (chip-atlas.org). Indeed, we found that across various transcription factor ChIP experiments in the VCaP cell line, ERG demonstrated significant enrichment of peak reads at the IRS2 promoter region, similar to our GEM model prostate organoid experiments (Table 1; Fig. 4A; Supplementary Fig. S3C). In addition, normal human prostate organoids were established, and ERG expression was performed in a doxycycline-inducible fashion. The expression of ERG resulted in repression of IRS2 protein and mRNA expression, reduced total RTK levels (EGFR, IGF1R), and suppressed PI3K signaling across various nodes of the pathway (Fig. 4B–D).

Our studies of mouse and human prostate cancer models establish that ERG impairs PI3K activation by direct repression of IRS2. We therefore postulated that restoration of IRS2 expression might promote ERG tumorigenesis in a similar manner as loss of Pten. Although in vitro cell proliferation was not augmented by IRS2 expression, IRS2 significantly enhanced cell migration (Fig. 5A and B). Using p110a (B4L719, 1 μm) and p110b (AZD8186, 250 nm) isoform selective inhibitors, we found that the increase in cell migration occurred in a PI3K-dependent fashion (Supplementary Figs. S4A–S4C). Similarly, loss of PTEN promoted cell migration in a PI3K-dependent fashion (Supplementary Figs. S4D and S4E). Despite this enhanced migration, expression of IRS2 did not promote in vivo tumor growth in the setting of ERG expression as we observe with loss of Pten (Supplementary Figs. S1A and S5). Although this may be secondary to non-PI3K–related functions of PTEN, we find that PI3K signaling is significantly higher in the setting of Pten loss compared with IRS2 expression (Pten wild-type) and we believe this explains these results as previous studies have demonstrated that robust AKT activation through expression of myristylated AKT cooperates with ERG to promote tumorigenesis (Fig. 5C; ref. 21). Collectively, our data provide a conceptual framework where an early oncogenic event (ERG aberrant expression in prostate) inhibits a mitogenic cellular signaling network (PI3K pathway) and may select for subsequent genetic events to activate signaling (loss of PTEN), resulting in transformation and progression (Fig. 5D). To address this selection of concomitant genetic events, we analyzed the TCGA data to identify gene alterations that were significantly enriched in prostate cancers harboring ERG genomic rearrangements. The most significantly associated copy-number alterations in ERG-positive prostate cancers involved deletion of chromosome 21q22, which is the site of the TMPRSS2:ERG genomic rearrangement. Supporting our model, loss of PTEN (10q23) was the next most significantly enriched copy number alteration in ERG-positive prostate cancers (P value = 1.4 × 10⁻⁷; q value = 2.4 × 10⁻⁵; Fig. 5E). Surprisingly, analysis of the protein expression data in TCGA revealed that the most significantly underexpressed protein in ERG rearranged prostate cancers was INPP4B, which is the PIP2 phosphatase (Fig. 5F). Thus, in prostate cancer, ERG genomic rearrangements significantly co-occur with molecular alterations that promote active PI3K signaling, although a subset of ERG-positive prostate cancers will evolve with alterations of other oncogenic pathways.

Tumorigenesis is a multistep process of selection for pathway alterations that promote cell proliferation, survival, migration, and invasion. Here we show that ERG, an established oncogene, represses PI3K signaling through direct transcriptional suppression of IRS2. This repression of the PI3K pathway in turn may select for concomitant alterations, such as PTEN loss, that activate PI3K signaling to promote tumorigenesis during the evolution of prostate cancer. Given that ERG is an attractive therapeutic target in prostate cancer and there are inhibitors in preclinical development, our model demonstrates that inhibition of ERG may result in hyperactive PI3K signaling potentially impacting response to therapy and necessitating combined inhibition of PI3K. This finding is similar to the interaction we have discovered between PI3K and AR, and trials of combined PI3K and AR inhibitors are advancing in the clinic (17, 22). This work has broad implications with regards to furthering our understanding of the evolutionary biology of cancer and potential impact of cancer therapeutics.

IRS2 is a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors (18, 20). IRS2 interacts with RTKs and upon tyrosine phosphorylation, binds the p85 regulatory subunit of the PI3K complex promoting activation and downstream signaling. Previous studies have demonstrated that IRS2 overexpression can promote active PI3K signaling and knock-out mice demonstrate a diabetic phenotype associate with resistance to insulin signaling (23). We have shown that the transcription of IRS2 is directly suppressed by ERG through promoter binding. Although IRS2 expression can restore PI3K signaling levels in ERG-positive Pten wild-type cells, this is still not sufficient for tumorigenesis, which explains why PTEN loss, and not IRS2 amplification or overexpression is more commonly selected for in the evolution of prostate cancer.

In accordance with these findings concomitant loss of PTEN resulting in hyperactive PI3K signaling promotes the development and progression of an invasive prostate cancer. These findings are well established in preclinical models and corroborated by the genomic profiling studies in prostate cancer revealing a significant enrichment for loss of PTEN in ERG-positive tumors. In addition, reduced protein levels of the PIP2 phosphatase INPP4B was also significantly enriched in human ERG-positive prostate cancers. Prior studies have shown that the loss of INPP4B activates downstream PI3K signaling and cooperate with loss of PTEN to promote tumorigenesis but no studies have evaluated the cooperative impact of INPP4B loss and ERG overexpression in prostate cancer (24). Although alterations in the major regulators of PI3K signaling are enriched in ERG-positive prostate cancers, there still remains a subset of ERG-positive cancers that evolve in a PI3K-independent manner.

Genomic rearrangements leading to the aberrant expression of ERG represses PI3K signaling in an IRS2-dependent manner. This finding explains in part, the enrichment for secondary alterations, such as loss of PTEN, that activate PI3K signaling and promote the progression of ERG-positive prostate cancers. Our work provides insight on how initiating oncogenic events may directly influence the selection of secondary concomitant alterations to promote oncogenic signaling during tumor evolution.

N. Rosen is a SAB member at Astra-Zeneca. C.L. Sawyers is a board member at Novartis, SAB member at Agios, Nextech, Foghorn, Blueprint Beigene, ORIC, PMV, KSQ, Housey, Petra, and Column Group, and has ownership interest (including patents) in Enzalutamide Royalty and Apalutamide Royalty. No potential conflicts of interest were disclosed by the other authors.

Conception and design: N. Mao, D. Gao, N. Rosen, Y. Chen, B.S. Carver

Development of methodology: N. Mao, D. Gao, N. Rosen, Y. Chen, B.S. Carver

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): D. Gao, S. Gadal, S. Wang, Y.S. Lee, P. Sullivan, Z. Zhang, D. Choi, N. Rosen, B.S. Carver

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): N. Mao, W. Hu, H. Hieronymus, S. Wang, Y.S. Lee, P. Sullivan, N. Rosen, A. Gopalan, Y. Chen, B.S. Carver

Writing, review, and/or revision of the manuscript: N. Mao, C.L. Sawyers, A. Gopalan, B.S. Carver

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): N. Mao, Y.S. Lee, B.S. Carver

Study supervision: N. Mao, B.S. Carver

This work was funded in part through NIH/NCI Prostate SPORE P50-CA092629-14, NIH/NCI R01-CA182503-01A1 (to B.S. Carver), PCF Challenge Award (to B.S. Carver), and the MSKCC NIH/NCI Cancer Center Support Grant P30 CA008748. C.L. Sawyers is a Howard Hughes Medical Institute Investigator. Funding through the STARR Cancer Consortium (to Y. Chen, B.S. Carver) allowed for establishment of a prostate organoid core to assist in our experiments. A special thanks to members of the Chen, Sawyers, and Rosen labs for providing informative discussion.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.