NAMPT Inhibition Suppresses Cancer Stem-like Cells Associated with Therapy-Induced Senescence in Ovarian Cancer Free

More than 85% of ovarian cancers are of epithelial origin (1). Epithelial ovarian cancer (EOC) is broadly divided into two types (1). Type I EOC includes endometrioid, mucinous, low-grade serous, and clear cell carcinomas, while type II EOC includes high-grade serous carcinomas (HGSC; ref. 1). Platinum-based chemoresistance is a major obstacle in the clinical management of EOC. EOC, in particular type II HGSC, initially responds well to platinum-based chemotherapy such as cisplatin, but the majority of these cases relapse with fatal chemoresistant EOC (2). For example, up to 80% of women with advanced stage type II HGSC experience recurrence after first-line chemotherapy (1). Accumulating evidence indicates that a key contributor of EOC chemoresistance is cancer stem-like cells (CSC), which are a subpopulation of chemoresistant cancer cells with stem-like properties (3). EOC CSCs are chiefly characterized by the stem cell surface marker CD133 and elevated aldehyde dehydrogenase 1 (ALDH1) activity mainly through the upregulation of ALDH1A1. Positivity for CD133 and ALDH1 CSC markers in EOC patient tumor samples predict a worse outcome (4–6). Indeed, inhibition of aldehyde dehydrogenase (ALDH) activity is sufficient to sensitize EOC cells to chemotherapy (7). Consistently, ALDH activity is also increased in a population of cancer-prone normal ovarian stem cells (8). However, clinically applicable approaches to eliminate EOC CSCs remain to be developed.

Platinum-based chemotherapies, such as cisplatin and carboplatin, are known to induce cellular senescence (2, 9). Cellular senescence is an essential tumor-suppressive mechanism that limits the propagation of cells subjected to insults such as chemotherapeutics (10). In this case, cells undergo therapy-induced senescence. Interestingly, therapy-induced senescent cells can spontaneously escape from the arrested condition and cells released from senescence reentered the cell cycle with a much higher tumor initiation potential (11). Senescent cells maintain viability and undergo a stable proliferative arrest associated with a series of phenotypic changes. A key phenotypic change is the acquisition of a secretory phenotype known as the senescence-associated secretory phenotype (SASP). The SASP consists of a plethora of secreted factors including cytokines and chemokines, such as IL6, IL8, and IL1B. Ironically, the SASP has paracrine effects that are protumorigenic, and emerging evidence supports the role of the SASP in the induction of cancer stemness and relapse (12–14). In addition, evidence shows that selectively eliminating senescent cells suppresses cancer stemness following chemotherapy treatment (15). However, directly eliminating senescent cells as a cancer therapy approach may be associated with unintended side-effects (11, 15). Thus, an ideal therapeutic strategy is to eliminate the induction of senescence-induced CSCs through targeting the SASP, while not affecting the tumor-suppressive proliferative arrest of senescent cells.

Nicotinamide phosphoribosyltransferase (NAMPT) is the rate-limiting enzyme for the NAD⁺ biosynthetic salvage pathway (16). NAD⁺ plays a critical pathophysiologic role in tissue aging and cancer development (17). For instance, the NAMPT pathway becomes deficient during tissue aging and supplementation with NAD⁺ precursors, such as nicotinamide mononucleotide (NMN), has been employed as a preventative antiaging strategy (18). However, the NAMPT pathway is overexpressed and has been explored as a therapeutic target in multiple types of cancer, where clinically applicable inhibitors such as FK866 and GMX1778 have been developed (19, 20). Notably, NAMPT drives activation of the SASP through the NF-κB–dependent pathway and promotes tumorigenesis (21). Indeed, pharmacologic inhibition of NAMPT suppressed the SASP while enhancing the tumor-suppressive senescence-associated proliferative arrest (21). Thus, NAMPT represents an ideal target to selectively eliminate the tumor-promoting SASP, while enhancing the tumor-suppressive senescence-associated growth arrest. However, its role in senescence-associated CSCs induced by chemotherapy has not previously been investigated.

Here, we show that the NAMPT-regulated NAD⁺ biosynthetic pathway mediates senescence-associated CSCs in EOC following platinum-based chemotherapy in a paracrine manner through promoting the SASP. The combination of cisplatin treatment with pharmacologic inhibition of NAMPT suppresses the EOC CSC signature. This correlates with a suppression of the outgrowth of cisplatin-treated EOC cells both in vitro and in vivo and an improvement of the survival of EOC-bearing mice in a xenograft model.

The EOC cell lines OVCAR3 and OVCAR5 were cultured in RPMI1640 (Corning) supplemented with 10% FBS (Sigma-Aldrich) and 1% penicillin/streptomycin. All cell lines were obtained from ATCC and reauthenticated by The Wistar Institute Genomics Facility using short-tandem repeat profiling using AmpFLSTR Identifiler PCR Ampliciation Kit (Life Technologies). We performed Mycoplasma testing using LookOut Mycoplasma PCR Detection (Sigma) every month.

The following antibodies were purchased from the indicated suppliers and used for immunoblotting: Rabbit monoclonal anti-HMGA1 (Sigma, catalog no. 129153), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, catalog no. A300-372A), mouse monoclonal anti-β-actin (Sigma, catalog no. 2532), mouse monoclonal anti-ALDH1 (BD Laboratories, catalog no. 611195), rabbit polyclonal anti-Lamin B1 (Abcam, catalog no. ab65986), rabbit polyclonal anti-cleaved PARP1 (Promega, catalog no. G7341), rabbit polyclonal anti-cleaved caspase-3 (Cell Signaling Technology, catalog no. 9662). The following compounds were purchased from the indicated suppliers and used at the indicated concentrations for in vitro studies: cisplatin (Selleck, catalog no. S1166), 250 nmol/L; carboplatin (Selleck, catalog no. S1215), 500 nmol/L; FK866 (Millipore, catalog no. 48-190-82), 1 nmol/L; GMX1778 (Selleck, catalog no. S8117), 0.5 nmol/L; NMN (Sigma, catalog no. N3501), 500 μmol/L; and doxycycline (Selleck, catalog no. S4163), 1 μg/mL.

We performed qRT-PCR following RNA extraction using TRIzol (Thermo Fisher Scientific) and DNase treatment (RNeasy columns by Qiagen). RNA expression was measured using an iTaq Universal SYBR Green One-step Kit (Bio-Rad Laboratories) on a QuantStudio 3 Real-Time PCR Machine (Thermo Fisher Scientific). β2-microglobulin (B2M) was used as an internal control. The fold change was calculated using the 2^−ΔC_t method for all analyses. Primer sequences for the indicated genes are as follows: IL1B forward, AGCTCGCCAGTGAAATGATGG and reverse, GTCCTGGAAGGAGCACTTCAT; IL6 forward, ACATCCTCGACGGCA TCTCA and reverse, TCACCAGGCAAGTCTCCTCA; IL8 forward, GCTCTGTGTGAAG GTGCAGT and reverse, TGCACCCAGTTTTCCTTGGG; ALDH1A1 forward, AGCAGGAGTGTTTACCAAAGA and reverse, CCCAGTT CTCTTCCATTTCCAG; SOX2 forward, GGAGGGGTGCAAAAGAGGAGAG and reverse, TCCCCCAAAAAGAAGTCCAGG; NESTIN1 forward, GGGAGTTCTCAGCCTCCAG and reverse, GGAGAAACAGGGCCTACAGA; LRIG1 forward, GGTGAGCCTGGCC TTATGTGAATA and reverse, CACCACCATCCTGCACCTCC; LGR5 forward, GACTTTAACTGGAGCACAGA and reverse, AGCT TTATTAGGGATGGCAA; CD133 forward, GGGTGTATCCAAA ACCCGGA and reverse, ACACTGAAAGTTACATCCACAGAA; CD44 forward, GCAGGTATGGGTTCATAGAAGG and reverse, GGTGTTGGATGTGAGGATGT.

Chromatin immunoprecipitation (ChIP) analysis was performed as described previously (21). Specifically, cells were fixed for 5 minutes at room temperature using 1% formaldehyde (Thermo Fisher Scientific) and then incubated for an additional 5 minutes at room temperature with 2.5 mol/L glycine. Then, cells were washed twice using cold PBS and then lysed using ChIP lysis buffer [50 mmol/L HEPES-KOH (pH 7.5), 1 mmol/L EDTA (pH 8.0), 140 mmol/L NaCl, 1% Triton X-100, and 0.1% deoxycholate with 0.1 mmol/L PMSF and EDTA-free Protease Inhibitor Cocktail]. After incubation on ice for 10 minutes, the lysed samples were centrifuged at 3,000 rpm. for 3 minutes at 4°C. The resulting pellet was resuspended in a second lysis buffer [10 mmol/L Tris (pH 8.0), 1 mmol/L EDTA, 200 mmol/L NaCl, and 0.5 mmol/L EGTA with 0.1 mmol/L PMSF and EDTA-free Protease Inhibitor Cocktail] and incubated at room temperature for 10 minutes before centrifugation at 3,000 rpm for 5 minutes at 4°C. Next, the pellet was resuspended in a third lysis buffer [100 mmol/L NaCl, 10 mmol/L Tris (pH 8.0), 1 mmol/L EDTA, 0.1% doxycycline, 0.5 mmol/L EGTA, and 0.5% N-lauroylsarcosine with 0.1 mmol/L PMSF and EDTA-free Protease Inhibitor Cocktail] and sonicated using a Biorupter (Diagenode) for 15 minutes (30 seconds on and 1 minutes off). Each ChIP sample received 10% Triton X-100 and was centrifuged at maximum speed for 15 minutes at 4°C. The supernatant of each ChIP sample was collected for quantification of DNA and precleared using 15 μL of protein G Dynabeads (Thermo Fisher Scientific) for 1 hour at 4°C. The samples were centrifuged at maximum speed for 15 minutes at 4°C and then the supernatant of each sample was incubated with 50 μL of antibody-bead conjugate solution for immunoprecipitation overnight on a rotator at 4°C. The following day, each sample was washed on a rotator for 15 minutes at 4°C using ChIP lysis buffer containing 0.65 mol/L NaCl, wash buffer [250 mmol/L LiCl, 10 mmol/L Tris-HCl (pH 8.0), 0.5% DOC, 0.5% NP-30, and 1 mmol/L EDTA (pH 8.0)] and TE buffer [(1 mmol/L EDTA (pH 8.0) and 10 mmol/L Tris-HCl (pH 8.0)]. Then, DNA was eluted by incubation of the beads with TE buffer + 1% SDS for 15 minutes at 65°C. Subsequently, the samples were then incubated overnight at 65°C to reverse cross-linking. The next day, the samples were incubated in proteinase K (1 mg/mL) for 5 hours at 37°C. Then, the DNA was purified from each sample using a Wizard SV Gel and PCR Clean Up Kit (Promega). We performed qPCR on the immunoprecipitated DNA using iTaq Universal SYBR Green (Bio-Rad Laboratories) using primers for the NAMPT enhancer site (forward, GAGTGAGGCCTGCACAAGTA and reverse, TCTCAGGCAAATGGTGATTG). Isotype-matched IgG served as a negative control.

Cells were cultured in 24-well plates (1,000 cells per well) for 1 to 2 weeks based on the experiment. Colonies were washed twice with PBS and fixed with 10% acetic acid and 10% methanol in distilled water. Plates were stained using 0.05% crystal violet for visualization. Analysis was performed on the basis of integrated density using NIH ImageJ Software.

The NAD⁺/NADH ratio was measured using the NAD/NADH-Glo Assay (Promega, G9071) based on the manufacturer's instructions. Luminescence signals were measured using a Victor X3 2030 Multilabel Reader (Perkin Elmer).

Cells were lysed using 1X sample buffer [10% glycerol, 2% SDS, 0.01% bromophenol blue, 0.1 mol/L dithiothreitol (DTT), and 62.5 mmol/L Tris buffer (pH 6.8)] to isolate protein. The cell lysate was heated at 95°C for 10 minutes, and the protein extract concentration was determined using the Bradford assay. An equal protein concentration was used for SDS–PAGE and transferred to a nitrocellulose membrane at 100 V for 2 hours at 4°C. Then, the membrane was blocked using 5% nonfat milk in TBS/0.1% Tween 20 (TBST) for 1 hour at room temperature. The membrane was incubated with primary antibodies of interest overnight at 4°C in 4% BSA/TBS + 0.025% sodium azide. The next day, the membrane was washed with TBST for 5 minutes at room temperature three times and then incubated with horseradish peroxidase–conjugated secondary antibodies (Cell Signaling Technology) made up in 5% nonfat milk for 1 hour at room temperature. Then, the membrane was washed with TBST for 5 minutes at room temperature 3 times and incubated with SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) for visualization by film.

ALDH activity was measured using the Aldefluor Assay Kit (Stem Cell Technologies, catalog no. 1700) based on the manufacturer's instructions. Cells were resuspended in Aldefluor assay buffer with the ALDH substrate for 30 minutes at 37°C. Then, cells were washed in PBS and incubated with an anti-CD133-PE/Cy7 antibody (BioLegend, catalog no. 372810) in Aldefluor assay buffer for 20 minutes on ice. Then, cells were washed and resuspended in PBS and submitted for analysis. Samples were run on an LSR-II Flow Cytometer (Becton Dickinson). For the detection of ALDH and senescence-associated beta-galactosidase (SA-β-Gal) activity, unfixed cells were stained with AldeRed (Millipore Sigma, catalog no. SCR150) for 30 minutes at 37°C in Aldefluor assay buffer, washed in PBS, and then stained with SPiDER-β-Gal (Dojindo Technologies, catalog no. SG02-10) in Aldefluor assay buffer at the pH of 7.2 for 20 minutes at 37°C. Cells were run and sorted using an Aria-II Flow Cytometer (Becton Dickinson). Flow cytometric Annexin V and propidium iodide staining (Thermo Fisher Scientific, catalog no. V13242) was used to detect apoptosis following the manufacturer's instructions. Briefly, cells were trypsinized, washed with cold PBS, and stained with Annexin V and propidium iodide at room temperature followed by analysis. All data was analyzed using FlowJo version 7 software.

Cells were stained for ALDH and SA-β-Gal activity using the aforementioned method and sorted on the basis of double-positive or negative staining. The sorted cells were cultured in ultra-low attachment plates (Corning, catalog no. CLS3473) in a serum-free mammary epithelial growth medium (Lonza, catalog no. CC3150) supplemented with B27 (Life Technologies, catalog no. 17504044), 20 ng/mL EGF (Invitrogen, catalog no. PHG0311), and 20 ng/mL FGF (Peprotech, catalog no. AF-100-26). The sorted cells were cultured in medium with or without 1 nmol/L FK866, 0.5 nmol/L GM1778, or 500 μmol/L NMN. Spheres larger than 50 μm were quantified 7 days later.

The procurement of human ovarian tumor tissues was approved by the Institutional Review Board of Christina Care Health System (Newark, DE). Deidentified patient tumor samples were obtained from Helen F. Graham Cancer Center at Christiana Care Health System. The tumor sample was processed into single cells by mincing using a scalpel, incubation with Type II Collagenase (Life Technologies, catalog no. 17101015) at 37°C for 10 minutes, and then incubation with trypsin-EDTA (Corning, catalog no. 25-053CI) + 50 U/mL DNase (Qiagen, catalog no. 79454) at 37°C for 10 minutes. The tumor sample was centrifuged at 3,000 rpm for 3 minutes and the supernatant was collected and filtered through a 40 μm strainer to isolate single cells. This step was repeated to ensure the isolation of single cells. The sample was centrifuged at 3,000 rpm for 3 minutes and resuspended in Basal culture media for enumeration by hemocytometry. Next, 5,000 cells were mixed with 100 μL of growth factor–reduced Matrigel (Corning, catalog no. CB-40230C) and seeded as a 100 μL droplet in a 24-well plate. After the matrices in the wells solidified, 500 μL of organoid media was added. Media was refreshed every other day and organoids were passaged every 2 weeks. Basal culture media consisted of Advanced DMEM/F12 (Thermo Fisher Scientific, catalog no. 10-092CM), 1X Glutamax (Thermo Fisher Scientific, catalog no. 35050061), and 1% HEPES (Life Technologies, catalog no. 15630080). Organoid media consisted of basal culture media supplemented with 1X N2 (Invitrogen, catalog no. 17502048), 1X B27 (Invitrogen, catalog no. 17504044), 0.5 mol/L N-acetylcysteine (Sigma, catalog no. A7250), 5 mmol/L CHIR-99021 (Selleck, catalog no. S2924), 500 μg/mL EGF (Peprotech, catalog no. 100-15), 500 nmol/L A83-01 (Sigma, catalog no. SML0788), 1 μmol/L SB202190 (Sigma, catalog no. S7067), 100 nmol/L Gastrin (Sigma, catalog no. G9020), 4 mmol/L Nicotinamide (Sigma, catalog no. 47865), 10 μmol/L Y27632 (Selleck, S1049), 1X anti-anti (Sigma, catalog no. A5955-20), 100 ng/mL FGF10 (Peprotech, catalog no. AF-100-26), and WNR conditioned media (containing Noggin/R-Spondin/Wnt3a). The organoid-like culture was imaged using phase-contrast microscopy and on a Celígo Imaging Cytometer (Nexcelom Bioscience) following staining using Aldefluor at 37°C for 30 minutes. This system was not compatible with staining for CD133. For analysis, we quantified organoids larger than 40 μm. For hematoxylin and eosin (H&E) histologic staining, the organoids were fixed using 4% paraformaldehyde (Sigma, catalog no. 158127) and washed with PBS before resuspension in embedding matrix consisting of 2% Bacto-agar (BD Biosciences, catalog no. DF0140-15-4) + 2% Gelatin (Sigma, 9000-70-8). After solidification, the organoids were placed in a histo-cassette for histologic processing.

To generate the doxycycline-inducible knockdown NAMPT construct, we cloned the shRNA sequence against NAMPT into a tet-pLKO-puro Plasmid (Addgene, catalog no. 21915). The shRNA against NAMPT was obtained from the Molecular Screening Facility at the Wistar Institute (Philadelphia, PA): TRCN0000116177, sense sequence: CCACCTTATCTTAGAGTTATT. For inducing knockdown of NAMPT, the cells were treated with 1 μg/mL of doxycycline for at least 72 hours. Lentivrius was produced using the ViraPower Kit (Invitrogen, catalog no. K4975-00) based on the manufacturer's instructions using the 293FT human embryonic kidney cell line. EOC cells infected with viruses encoding the puromycin resistance gene were selected using 3 μg/mL of puromycin.

Cells were fixed using 2% formaldehyde/0.2% glutaraldehyde in PBS and washed twice with PBS. Cells were then incubated in an X-Gal solution (150 mmol/L NaCl, 2 mmol/L MgCl₂, 5 mmol/L K₃Fe(CN)₆, 5 mmol/L K₄Fe(CN)₆, 40 mmol/L Na₂HPO₄ (pH 6.0), and 1 mg ml^–1 X-gal) overnight at 37°C in a nonCO₂ incubator. SA-β-Gal staining was performed at the pH of 5.7 to enhance sensitivity of detection. Cells were enumerated on the basis of the percentage of SA-β-Gal–positive cells.

NF-κB activity was measured using the NF-κB Reporter Plasmid (Addgene, plasmid no. 49343), and readout data was normalized on the basis of the transfection efficiency of the pRL-SV40 Plasmid Renilla Luciferase (Addgene, plasmid no. E223A). Lipofectamine 3000 Reagent (Invitrogen) was used for plasmid cotransfection, and cells were assayed for luminescence using a Dual-Luciferase Reporter Assay System (Promega, catalog no. E1910). Luminescence was measured using a Victor X3 2030 Multilabel Reader (Perkin Elmer).

All animal protocols described in this study were approved by the Wistar Institutional Animal Care and Use Committee (IACUC). The subcutaneous tumor xenograft models and the measurement of tumor size were performed as described previously (22). Briefly, 9 × 10⁶ OVCAR3 cells were suspended in 100 μL solution (PBS: Matrigel = 1:1) and injected subcutaneously into the right dorsal flank of 6- to 8-week-old female immunocompromised NOD/SCID mice. Notably, 9 × 10⁶ OVCAR3 cells produced the most reproducible result of developing palpable tumors within 4 weeks. Tumors were allowed to establish until the tumor size was palpable, and then the mice were randomly assigned to be treated for 3 weeks with vehicle controls, FK866 (10 mg/kg i.p. once a day), cisplatin (750 μg/kg i.p. biweekly for a total of two treatment during three weeks on week 1 and 3), or a combination of the two compounds. The doses of compounds were determined on the basis of previous studies (23–25). FK866 was suspended in 45% propylene glycol + 5% Tween 80 +ddH²O, and cisplatin was suspended in PBS. Tumor size was measured twice a week by two investigators as follows: tumor size (mm³) = [d² × D]/2, d is the shortest diameter and D is the largest diameter. After 3 weeks of treatment, tumor samples were surgically dissected from half number of mice of each group, and the tumor weights were measured as a surrogate for tumor burden. The other half of the mice cohort of each group were followed for the survival experiment. The Wistar IACUC guideline was followed in evaluating the survival of tumor-bearing mice.

IHC staining was performed on the consecutive sections from xenografted tumors dissected from NSG mice treated with vehicle controls, FK866 (10 mg/kg i.p. once a day), cisplatin (750 μg/kg i.p. biweekly for a total of two treatments during three weeks on week 1 and 3), or a combination of the two compounds. The tumor samples were fixed in 10% buffered formalin and embedded in paraffin. The sections cut from paraffin-embedded blocks were deparaffinized with xylene and ethanol, and then immersed for 40 minutes in 10 mmol/L citric acid buffer, pH 6.0. The activity of endogenous peroxides was quenched for 20 minutes in 3% H₂O₂ in methanol. After rinsing in PBS, the sections were incubated at 4°C with anti-ALDH1 antibody overnight. Then, Dako EnVision+ system was conducted following the manufacturer's instructions. Finally, the sections were counterstained with Mayer's Hematoxylin (Sigma). Expression of ALDH1 stains of each group was scored using a histologic score (H-score) by two investigators.

Database mining of the Cancer Genome Atlas (TCGA) ovarian cancer transcriptome dataset was performed using the publicly available Gene Expression Profiling Interactive Analysis software (26). Database mining was also conducted on a clinically annotated microarray dataset that is publicly available in the Gene Expression Omnibus (GSE9891; ref. 27). Analysis was conducted by sorting 267 EOC tumors based on low and high NAMPT expression and analyzed for the expression of IL6, IL1B, and IL8. The mean of NAMPT expression was determined and samples below the mean were considered low-NAMPT–expressing and samples above the mean were considered high-NAMPT–expressing.

Results are representative of a minimum of three independent experiments unless otherwise stated. All quantitative data are expressed as mean ± SEM. Statistical analyses were conducted using GraphPad Prism 6 (GraphPad). A Student t test was performed to determine P values where P < 0.05 was considered statistically significant.

HMGA1 is a key regulator of NAMPT expression during cellular senescence (21). NAMPT is the rate-limiting enzyme for the NAD⁺ salvage pathway and plays a key role in activation of the SASP (21). Thus, we sought to examine whether HMGA1-mediated upregulation of NAMPT promotes the SASP following platinum-induced senescence in EOC cells. Indeed, HMGA1 was upregulated and bound to the NAMPT gene enhancer by ChIP analysis in cisplatin-induced senescent OVCAR3 cells (Fig. 1A and B). Consistently, NAMPT expression and the NAD⁺/NADH ratio were significantly elevated in the senescent cells (Fig. 1B and C). Inhibition of NAMPT activity using the small-molecule inhibitors FK866 or GMX1778 significantly reduced the NAD⁺/NADH ratio and had no effect on the senescence-associated growth arrest as evidenced by no changes in decreased colony formation and markers of senescence such as Lamin B1 expression and SA-β-Gal activity (Fig. 1B–F). Notably, NAMPT regulates the SASP in a NF-κB–dependent manner (21). Indeed, NF-κB activity and SASP gene expression were significantly inhibited by treatment with the NAMPT inhibitors (Fig. 1G and H). Similar observations were also made in additional EOC cell lines and in response to carboplatin (Supplementary Fig. S1A–S1F; Supplementary Fig. S2A–S2D), indicating that the observed effects are not cell-line–specific. To limit the potential off-target effects of the NAMPT inhibitors, we generated a doxycycline-inducible NAMPT knockdown system that significantly reduced the NAD⁺/NADH ratio (Fig. 2A and B). Consistently, doxycycline-inducible knockdown of NAMPT significantly reduced the SASP gene expression and did not affect senescence-associated growth arrest (Fig. 2C–F). Conversely, we promoted the NAMPT pathway by supplementing with the NAD⁺ precursor NMN that significantly raised the NAD⁺/NADH ratio (Fig. 2G). Indeed, we found that NMN treatment significantly elevated SASP gene expression and did not affect senescence-associated growth arrest (Fig. 2H–K). Thus, these data show that NAMPT has a role in promoting the SASP and functions independently of the senescence-associated growth arrest during platinum-induced senescence of EOC cells.

Recent studies have shown that cellular senescence is a major contributor toward the increase of CSCs (11). We next sought to determine whether NAMPT is required for the increase of CSCs following platinum-induced senescence. Following cisplatin treatment, we assessed outgrowth of EOC cells and markers of stemness. The NAMPT inhibitors significantly suppressed the outgrowth of EOC cells following cisplatin treatment using colony formation assays (Fig. 3A and B). This correlated with suppression of upregulated ALDH1 protein level and ALDH1A1 mRNA along with other stemness-related genes induced by cisplatin (Fig. 3C–E; Supplementary Fig. S3A). Indeed, the NAMPT inhibitors decreased the percentage of CD133 and ALDH-positive CSCs (Fig. 3F and G). Notably, NAMPT inhibitors alone did not affect the growth of EOC cells at the doses used in the study (Fig. 3A and B), indicating that they did not target the bulk nonstem cells. We also observed an increase in apoptotic markers, such as cleaved PARP and cleaved caspase-3, in the cells treated with the NAMPT inhibitors and cisplatin in combination compared with either treatment alone (Fig. 3C and D). This is consistent with previous finding that suppressing ALDH activity induces apoptosis of EOC CSCs (28). Similar findings were also made in additional EOC cell lines (Supplementary Fig. S3B–S3E).

We also examined whether cisplatin treatment promotes CSCs in primary EOC specimens by developing an organoid-like three-dimensional system. Primary EOC specimens were processed and cultured in Matrigel to form organoid-like structures as depicted using phase-contrast and H&E histologic staining (Fig. 3H). NAMPT inhibitor and cisplatin combination significantly reduced the diameter of organoid-like culture in comparison with the cisplatin alone–treated group (Fig. 3I). More importantly, NAMPT inhibition significantly suppressed elevated ALDH activity induced by cisplatin treatment (Fig. 3J). Finally, to limit the potential off-target effects, we examined the effects of doxycycline-inducible knockdown of NAMPT on the cisplatin-induced EOC CSCs. Doxycycline-inducible knockdown of NAMPT significantly prevented the outgrowth of EOC cells following cisplatin treatment using colony formation assays (Supplementary Fig. S4A and S4B). These results correlated with the suppression of ALDH1 protein level and ALDH1A1 mRNA expression, stemness-related gene expression, and the increase of CD133 and ALDH-positive CSCs induced by cisplatin during senescence (Supplementary Fig. S4C–S4F). Conversely, augmentation of the NAMPT pathway using NMN supplementation significantly promoted outgrowth, ALDH1 protein level and ALDH1A mRNA expression, and the increase of CD133 and ALDH-positive CSCs following cisplatin treatment (Supplementary Fig. S5A–S5E). Together, these findings support the notion that NAMPT-regulated NAD⁺ biogenesis pathway is both necessary and sufficient for therapy-induced senescence-associated CSCs.

We next sought to determine whether senescent cells exhibit stemness following cisplatin treatment. To so do, we assessed cells for positivity for SA-β-Gal and ALDH activity using FACS analysis. We found cisplatin treatment significantly elevated senescent cells expressing high ALDH activity that was absent in the combinatorial cisplatin and NAMPT inhibitor–treated cells (Fig. 4A and B). Given the fact that NAMPT inhibition does not affect senescence and the associated growth arrest, these findings suggest that the observed increase in senescent cells with ALDH activity is due to the NAMPT-dependent SASP. Using fluorescence-based FACS sorting, we isolated the senescent CSC population and examined the effect of the NAMPT inhibitors on anchorage-independent sphere formation, a characteristic of putative ovarian CSCs (29). Notably, the NAMPT inhibitors suppressed sphere formation to a degree that is comparable with the ALDH-negatively sorted cells (Fig. 4C and D). Conversely, promoting NAMPT pathway using NMN supplementation further promoted sphere formation (Fig. 4C and D).

Because NAMPT plays a key role in the SASP, we next determined whether the observed changes in CSCs during therapy-induced senescence is SASP-dependent. Toward this goal, we determined whether treatment of naïve EOC cells with conditioned media from cisplatin-induced senescent EOC cells in the presence or absence of the NAMPT inhibitors would affect the enrichment of CSCs (Fig. 5A). We found that conditioned media from the cisplatin-induced senescent EOC cells significantly elevated the increase of CD133 and ALDH-positive CSCs and the expression of stemness-related genes. However, conditioned media collected from cisplatin-induced senescent EOC cells in the presence of the NAMPT inhibitors prevented the enrichment of the stemness signature (Fig. 5B–D). Notably, the conditioned media did not induce senescence in these naïve EOC cells (Supplementary Fig. S6A and S6B), indicating that the observed increase in CSCs by conditional medium was not a secondary effect due to senescence induction by conditional medium in these cells. These results suggest that the NAMPT-regulated SASP plays a key role in senescence-associated CSCs induced by cisplatin in EOC cells.

NAMPT is highly expressed in several cancer types including EOC (30, 31). We found through datamining of The Cancer Genome Atlas (TCGA) and gene expression datasets that high NAMPT is significantly correlated with poorer overall survival of patients with EOC and the expression of SASP factors (Supplementary Fig. S7A and S7B; ref. 27). Clinically applicable NAMPT inhibitors have been developed (30, 32, 33). Thus, we sought to determine the effects of NAMPT inhibitor on tumor relapse after cisplatin treatment. Toward this goal, we subcutaneously transplanted OVCAR3 cells into female immunocompromised NOD/NSIG mice. The injected cells were allowed to grow for 4 weeks to establish tumors. Then, we randomly assigned the mice into four groups and treated mice with vehicle control, cisplatin (750 μg/kg biweekly for a total of two treatments), FK866 (10 mg/kg daily), or a combination of cisplatin and FK866 by intraperitoneal injection for an additional 3 weeks (Fig. 6; Supplementary Fig. S8A).

After 3 weeks of treatment, we harvested the tumors and found that the tumor growth or weight was not significantly reduced by FK866 alone treatment but was significantly lower in the cisplatin-treated groups (Fig. 6A and B; Supplementary Fig. S8B). Notably, the combination did not significantly further reduce the tumor weight compared with cisplatin treatment group at the time of stopping the treatment (Fig. 6B). We examined ALDH activity and found ALDH activity was elevated in the cisplatin-treated group, while significantly decreased in the combination cisplatin and FK866 group (Fig. 6C; Supplementary Fig. S8C). Consistent with this result, we found that the combination cisplatin and FK866 group had significantly lower ALDH1 protein and ALDH1A1 mRNA expression compared with the cisplatin-treated group (Fig. 6D–F). Consistent with in vitro findings, we showed that markers of senescence, such as SA-β-Gal activity induced by cisplatin, were not significantly affected by FK866 in vivo in the harvested tumors (Supplementary Fig. S8C and S8D). Notably, combination of cisplatin and FK866 significantly reduced the expression of SASP factors such as IL6 (Supplementary Fig. S8E). We next followed the tumor outgrowth in mice treated with cisplatin with or without FK866 combination after terminating drug treatment. We found the outgrowth of the tumors in the combination treatment group was significantly slower compared with the cisplatin only treatment group (Fig. 6G). Indeed, the survival of the combination-treated mice was also significantly extended compared with mice treated with cisplatin alone (Fig. 6H). Notably, the combination of cisplatin and FK866 did not exhibit toxicity in the treated mice. For example, the body weight of the treated mice was not significantly affected by the combination treatment (Supplementary Fig. S8F). Taken together, we conclude that a combination of FK866 and cisplatin improves the survival of EOC-bearing mice, which correlated with the suppression of senescence-associated CSCs.

Our results suggest that HMGA1 drives NAMPT expression to promote CSCs following platinum-based chemotherapy. Consistently, it has been demonstrated that HMGA1 is often upregulated in a range of human cancers and associated with a poorer patient prognosis (34). Interestingly, HMGA1 is enriched in intestinal stem cells and enhances self-renewal and expands the intestinal stem cells compartment (35). In addition, HMGA1 is required for progression and stem cell properties in multiple cancer types including colorectal cancer (36). However, it is difficult to target chromatin architecture proteins such as HMGA1. Thus, our current study suggests that NAMPT inhibitors may be used in HMGA1-high cancers to suppress cancer stem-like cells.

We found that elevated NAD⁺ level was associated with activation of NF-κB signaling and the SASP during therapy-induced senescence. Consistently, it has previously been shown that IL6, a component of the SASP, is a key regulator of stemness in response to platinum-based chemotherapy in EOC (37). Notably, supplementation with the NAD⁺ precursor NMN to enhance the NAMPT pathway promotes CSCs following platinum-based chemotherapy. Thus, NAD⁺-augmenting dietary supplements, which have been clinically tested to alleviate age-related pathophysiologic conditions, may have unintended side-effects of promoting CSCs (38, 39). Therefore, further studies are warranted in this area of research.

Our studies demonstrate that targeting NAMPT activity through the use of clinically applicable NAMPT inhibitors represents a novel strategy for targeting senescence-associated CSCs in EOC. Similar results were obtained by using two different NAMPT inhibitors FK866 and GMX1778. The potential off-target effects of the NAMPT inhibitors were further limited by phenocopying with genetically knocking down NAMPT expression. Together, these findings support that the observed effects by FK866 are on-target through inhibiting NAMPT activity. Addition of NAMPT inhibitor significantly delayed tumor relapse and improved survival of EOC-bearing mice in vivo compared with cisplatin treatment alone. Notably, the dose of NAMPT inhibitor used in this study did not significantly affect the tumor growth when used as a single agent. This is consistent with the idea that NAMPT inhibition suppresses the CSCs induced by platinum-based chemotherapy instead of targeting bulk tumor cells in this context. Together, our study indicates that NAMPT inhibitors may be repurposed to suppress therapy-induced senescence-associated CSCs for improving platinum-based standard of care, a major obstacle in the clinical management of EOC.

No potential conflicts of interest were disclosed.

Conception and design: T. Nacarelli, T. Fukumoto, R. Zhang

Development of methodology: T. Nacarelli, T. Fukumoto, N. Fatkhutdinov

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): T. Nacarelli, T. Fukumoto, J.A. Zundell, N. Fatkhutdinov, S. Jean, M.G. Cadungog, M.E. Borowsky

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): T. Nacarelli, T. Fukumoto, J.A. Zundell, N. Fatkhutdinov

Writing, review, and/or revision of the manuscript: T. Nacarelli, T. Fukumoto, R. Zhang

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): T. Fukumoto, J.A. Zundell

Study supervision: R. Zhang

This work was supported by US NIH grants (R01CA160331, R01CA163377, R01CA202919, R01CA239128, P01AG031862 and P50CA228991 to R. Zhang, and T32CA009191 to T. Nacarelli) and US Department of Defense (OC150446 and OC180109 to R. Zhang), The Honorable Tina Brozman Foundation for Ovarian Cancer Research (to R. Zhang), and Ovarian Cancer Research Alliance (Collaborative Research Development Grant to R. Zhang). Support of Core Facilities was provided by Cancer Centre Support Grant (CCSG) CA010815 to The Wistar Institute (Philadelphia, PA).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.