Switch/Sucrose Non-Fermentable (SWI/SNF) chromatin-remodeling complexes have a mutation rate of approximately 20% in human cancer, and ARID1A is the most frequently mutated component. However, some components of SWI/SNF complexes, including ARID1A, exhibit a very low mutation rate in squamous cell carcinoma (SCC), and their role in SCC remains unknown. Here, we demonstrate that the low expression of ARID1A in SCC is the result of promoter hypermethylation. Low levels of ARID1A were associated with a poor prognosis. ARID1A maintained transcriptional homeostasis through both direct and indirect chromatin-remodeling mechanisms. Depletion of ARID1A activated an oncogenic transcriptome that drove SCC progression. The anti-inflammatory natural product parthenolide was synthetically lethal to ARID1A-depleted SCC cells due to its inhibition of both HDAC1 and oncogenic signaling. These findings support the clinical application of parthenolide to treat patients with SCC with low ARID1A expression.

Significance:

This study reveals novel inactivation mechanisms and tumor-suppressive roles of ARID1A in SCC and proposes parthenolide as an effective treatment for patients with SCC with low ARID1A expression.

Squamous cell carcinoma (SCC) is one of the most prevalent types of human cancer and comprises a wide range of cancers originating from various locations that share common genetic mutations and the expression of squamous differentiation markers. SCCs are classified according to their location of origin. The common locations of SCC include the skin, head and neck, esophagus, lung, and cervix (1). Patients with SCCs usually show poor prognoses, and chemoresistance is a major obstacle to successful treatment. A significant proportion of patients with relapsed SCC ultimately experience metastatic events (2). In recent years, large-scale next-generation sequencing approaches have identified several essential driver oncogenes and tumor suppressors in SCC. However, mutations, which are only partially responsible for the generation and progression of malignancies, are usually difficult to overcome. In contrast, nonmutation events such as epigenetic regulation and posttranslational modification play substantial roles in the pathogenesis of cancer. More importantly, the reversibility of nonmutation events reflects their potential as promising therapeutic targets in the clinical treatment of cancer.

Switch/Sucrose Non-Fermentable (SWI/SNF) chromatin-remodeling complexes are multisubunit, ATP-dependent chromatin-remodeling complexes reported to slide nucleosomes along the DNA template (3) and to comprise one ATPase subunit (BRM or BRG1), several core subunits (BAF47, BAF155, and BAF170) that contribute to their catalytic activity, and variable subunits that endow target specificity (4). On the basis of their varying compositions, SWI/SNF complexes are mainly divided into two variants, BRG1-associated factor (BAF) complexes, and polybromo BRG1-associated factor (PBAF) complexes; the SWI/SNF complex variants that contain ARID1A are BAF complexes (5). BAF complexes have a mutation rate of approximately 20% across human cancer types and are the most frequently mutated family of complexes (6). Despite the high mutation rates and multiple tumor-suppressive functions of SWI/SNF complex components, including ARID1A, in various cancer types, the mutation rate of ARID1A in several SCC types is significantly lower than that in adenocarcinoma. For example, the mutation rate of ARID1A in esophageal squamous cell carcinoma (ESCC) is only 1% (7) but is 10% in esophageal adenocarcinoma (8, 9). Moreover, the functions of ARID1A and certain other components in the SWI/SNF complex in SCC remain poorly defined.

In this study, for the first time, we revealed that promoter hypermethylation contributes to low ARID1A expression in SCC. Both in vitro and in vivo experiments showed that ARID1A depletion drives the proliferation and metastasis of SCC cells. We further showed that ARID1A depletion causes the dissociation of the SWI/SNF complex, HDAC1 and the PRC2 complex from DNA, which then triggers a switch in the transcriptome from tumor-suppressive to oncogenic. Most importantly, we identified parthenolide as a synthetic lethal compound in ARID1A-depleted SCC cells that exerts its effects via a second hit, indicating that parthenolide is a promising treatment strategy for patients with SCC with low ARID1A expression.

Cell lines and cell culture

The human ESCC cell lines (10) were kindly provided by Dr. Yutaka Shimada (Kyoto University, Kyoto, Japan). NE-2 and NE-3 cells (11) were granted by Dr. Enmin Li (Medical College of Shantou University, Guangdong, China). The Het-1A and 293T cell lines were purchased from the ATCC. A431, NCI-H1703, and NCI-H2170 cells were purchased from the National Infrastructure of Cell Line Resource (Beijing, China). 293T and A431 cells were cultured in DMEM supplemented with 10% FBS. Other SCC cells were cultured in RPMI1640 medium supplemented with 10% FBS. Het-1A cells were cultured in a BEBM Kit (CC-3170, Lonza), and plates were pretreated with an Enhanced Cell Adhesion Kit-3 (C028, Beijing Xigong Biological Technology Co., Ltd.) for 1 hour to promote cell adherence. NE-2 and NE-3 cells were cultured in a 1:1 mixture of defined K-SFM (10744-019, Gibco) and EpiLife medium (MEP1500CA, Gibco). All cells were maintained in a humidified cell incubator with 5% CO2 at 37°C. All cell lines were routinely authenticated using short tandem repeat DNA fingerprinting and were tested by a MycoBlue Mycoplasma Detector (Vazyme Biotech) to exclude Mycoplasma contamination before use in any experiments.

qRT-PCR and chromatin immunoprecipitation-qPCR

Total RNA was isolated from cells using TRIzol reagent (Thermo Fisher Scientific). qPCR analysis was performed using standard procedures on a StepOnePlus Real-Time PCR system (Applied Biosystems). Chromatin immunoprecipitation (ChIP) analysis was performed using a ChIP kit (Cell Signaling Technology) as described previously (12). The primer sequences are shown in Supplementary Table S1.

Xenograft transplantation experiments

All animal protocols were approved by the Animal Care and Use Committee of the Chinese Academy of Medical Sciences Cancer Hospital (Beijing, China). For subcutaneous xenografting, 1–4 × 106 ESCC cells were injected subcutaneously into 6-week-old male BALB/c nude mice (VitalRiver Laboratory Animal Technology, Beijing, China). The tumor size was calculated as 0.52 × length × width2. For the lung metastasis studies, 1 × 106 ESCC cells were injected into 6-week-old male NOD/SCID mice (VitalRiver Laboratory Animal Technology) via the tail vein. Mice were sacrificed 5 months later, and the metastatic nodules were counted. Patient-derived xenograft (PDX) models were established using NCG mice (GemPharmatech Co., Ltd.) as described previously (13). One week after transplantation, mice were randomly divided into two groups and treated with DMSO or parthenolide (10 mg/kg) for another three weeks. Parthenolide was administered three times weekly via intraperitoneal injection.

Virus production and cell infection

Lentivirus was produced using 293T cells with the second-generation packaging system psPAX2 (#12260, Addgene) and the pMD2.G plasmid (#12259, Addgene). Cells were infected with lentivirus in medium supplemented with 8 μg/mL polybrene (Sigma-Aldrich) several times within 48 hours and were then selected with 1 μg/mL puromycin (Sangon Biotech) or 200 μg/mL G418 (Sigma-Aldrich) for 10 days. Full-length cDNAs were constructed by PCR amplification with specific primers and subsequently cloned into the pLVX-IRES-neo vector (Clontech). Empty pLVX-IRES-neo vector was used as the negative control. Short hairpin RNA (shRNA) sequences were cloned in to the pSIH1-puro vector (Addgene). The shRNA sequences targeting ARID1A were as follows: sh1, GCCTGATCTATCTGGTTCAAT and sh2, GCATCCTTCCATGAACCAATC. The shRNA sequences targeting HDAC1 were as follows: sh1, CGGTTAGGTTGCTTCAATCTA and sh2, GCTGCTCAACTATGGTCTCTA. The shRNA sequences targeting HDAC2 were as follows: sh1, CAGACTGATATGGCTGTTAAT and sh2, GACGGTATCATTCCATAAATA. The following nontargeting shRNA sequence was used as the negative control: AGTCTTAATCGCGTATAAGGC.

Migration and invasion assays

For the migration assay, a total of 6–10 × 104 SCC cells per well were seeded in the inserts of 24-well Transwell plates (8-μm pore size, Corning). To screen effective inhibitors, different inhibitors were added to culture medium containing 20% FBS in the bottom chambers of Transwell plates, while 1 × 105 ARID1A-depleted KYSE410 cells were seeded in the top chambers. After incubation for 24 hours, the inserts were fixed and stained for 30 minutes with 0.4% crystal violet dissolved in methyl alcohol, and the cell numbers were calculated by averaging the counts in three random fields. The invasion assay followed the same procedures as the migration assay, except that 4 μL of Matrigel (Corning) was applied to each insert.

Wound-healing assays

Wound healing assays were performed using Culture-Insert 2 Well inserts (Ibidi) according to the manufacturer's protocol. Briefly, the inserts were placed into 6-well plates, and cells were seeded and allowed to form a confluent layer before the inserts were removed. After the inserts were removed, the remaining medium was replaced with fresh serum-free medium and images were acquired at the indicated time points.

CCK-8 cell proliferation assays

CCK-8 reagent (Dojindo) was added to the cell culture medium at a ratio of 1:10, and the absorbance was measured at 450 nm after incubation for 1 hour at 37°C.

Plate colony formation assays

Cells were plated in 6-well plates at a single-cell density (1,500 cells per well) and incubated for 2 weeks. The cell colonies were then fixed and stained with 0.4% crystal violet dissolved in methyl alcohol.

Ethynyluridine and 5-ethynyl-2′-deoxyuridine staining

The RNA transcription level was assessed using a Click-iT RNA Alexa Fluor 488 Imaging Kit (C10330, Life Technologies). EU was added 30 minutes before fixation, permeabilization, and performance of the Click-iT reaction. EdU staining was performed using an iClick EdU Andy Fluor 594 Imaging Kit (GeneCopoeia) according to the manufacturer's protocol.

Methylation-specific PCR and bisulfite genomic sequencing

Genomic DNA was extracted using a Quick-DNA Universal Kit (Zymo Research) according to the manufacturer's protocol. Genomic DNA (1 μg) was bisulfite-modified using an EpiTect Bisulfite Kit (Qiagen) following the manufacturer's instructions. The methylation-specific PCR (MSP) primers were designed according to genomic sequences near the transcription start sites. The following primers were used for MSP: ARID1A M: forward, 5′-TTAGGTTTTGGGGAGC-3′ and reverse, 5′-ACTCAACTACTCCCG-3′; ARID1A U: forward, 5′-TTAGGTTTTGGGGAGT-3′ and reverse, 5′-ACTCAACTACTCCCA-3′. Bisulfite-treated genomic DNA was subjected to PCR using primers flanking the targeted MSP regions. The following sequencing primers were used: forward, 5′-GGGGTTAGGTTTTG GGGAG-3′; and reverse, 5′-CTCRCTCCTCTCCCCCC-3′. Ten colonies were picked and sequenced to calculate the methylation percentage.

Patient samples and IHC

Paired normal esophageal epithelial and ESCC tissue samples from 23 patients were collected from the Affiliated Hospital of Qingdao University (Shandong, China). The ESCC#1 sample was collected from Beijing Friendship Hospital, and the HNSCC#1 and HNSCC#2 samples were collected from the Cancer Hospital, Chinese Academy of Medical Sciences (Beijing, China) and Peking Union Medical College (Beijing, China). Paraffin-embedded, paired normal esophageal epithelial and ESCC tissue samples from 79 patients were collected from Nanjing First Hospital (Jiangsu, China). Paraffin-embedded in situ tumor tissue blocks were collected from 93 patients with ESCC during their initial treatment in Zhejiang Cancer Hospital. Written informed consent was obtained from all patients, and tissue samples were deidentified before use. This study was performed in accordance with the principles of the Declaration of Helsinki and approved by the Institutional Research Ethics Committee. IHC was performed as described previously (12). The IHC staining results were converted to an H-Score, as follows: H-Score = ∑pi × i, where pi represents the percentage of positive cells (0–100%) and i represents the staining intensity (0, negative; 1, weak; 2, medium; and 3, strong). IHC staining was scored by three independent observers.

Gene expression profiling microarray analysis

Three pairs of samples were generated from three biologically independent experiments. An Agilent SurePrint G3 Human Gene Expression v3 Microarray (8*60K, Design ID: 072363) was used in this experiment. Sample labeling, microarray hybridization, and washing were performed on the basis of the manufacturer's standard protocols. Feature Extraction Software (version 10.7.1.1, Agilent Technologies) was used for array image analysis to obtain the raw data. GeneSpring (version 13.1, Agilent Technologies) was employed to complete the basic analysis of the raw data. The threshold established to define the up- and downregulated genes was a fold change of either ≥2 or ≤0.5 and a P ≤ 0.05. The gene expression microarray data can be accessed in the Gene Expression Omnibus (GEO) database under accession number GSE116211.

Statistical analysis

For all statistical analyses, differences with P ≤ 0.05 were considered statistically significant, and data from at least three biologically independent experiments with similar results are reported. Data analysis was performed using GraphPad Prism version 8.0 (GraphPad Software).

Promoter hypermethylation inhibits ARID1A expression in SCC cells

To investigate whether the SWI/SNF complex components are epigenetically silenced in SCC, we first treated the SCC cell line KYSE450 with the DNA methyltransferase inhibitor 5-azacytidine (5-Aza) and detected changes in the mRNA expression level of several components. Among the 12 components we investigated, ARID1A showed the most significantly increased mRNA expression level compared with that in nontreated control cells (Fig. 1A). Although the mRNA expression of some other components was also increased after 5-Aza treatment, these increases were less than 50% (Supplementary Fig. S1A). In addition, the MSP results confirmed a higher level of methylation in the ARID1A promoter region in SCC cell lines with low ARID1A expression than in SCC cell lines with high ARID1A expression as well as in three immortalized human esophageal epithelial cell lines, Het-1A, NE-2, and NE-3 (Supplementary Fig. S1B and S1C). To further evaluate the methylation status of the ARID1A promoter region, we performed bisulfite genomic sequencing in two SCC cell lines as well as in NE-2 and NE-3 cells. SCC cell lines with low ARID1A expression displayed a much higher CG methylation frequency than NE-2 and NE-3 cell lines, which exhibit high ARID1A expression (Fig. 1B). In addition, 5-Aza treatment significantly decreased the methylation level of the ARID1A promoter region in KYSE450 cells (Fig. 1C). In further support of these results, MSP analysis of 23 paired ESCC and normal tissue samples showed ubiquitous (23/23) ARID1A promoter hypermethylation in ESCC tissues but in only 8.7% (2/23) of normal tissues (Supplementary Fig. S1D). Further analysis of the data from the cBioPortal for Cancer Genomics (14, 15) showed a significant negative correlation between ARID1A promoter methylation and mRNA expression in several types of SCC but no obvious correlation in adenocarcinoma (Supplementary Fig. S1E).

Figure 1.

Epigenetic silencing of ARID1A is correlated with poor prognosis in patients with SCC. A, qRT-PCR analysis of ARID1A expression in KYSE450 cells after 5-Aza (10 μmol/L) treatment for 1, 2, or 3 days. The data are the means ± SD; n = 3 independent experiments, two-tailed t tests. B, Bisulfite sequencing to detect the DNA methylation level in the ARID1A promoter region in various cell lines. C, Bisulfite sequencing to detect the DNA methylation level in the ARID1A promoter region in KYSE450 cells after 5-Aza (10 μmol/L) treatment for 3 days. D, Representative images and H-score analysis of ARID1A IHC staining in normal esophageal epithelial and ESCC tissues (n = 79). Box plot representation: from top to bottom—maximum, 75th percentile; median, 25th percentile; and minimum values. Two-tailed t tests. Scale bars, 200 μm. E, Kaplan–Meier analysis of patients with ESCC with low or high ARID1A expression.

Figure 1.

Epigenetic silencing of ARID1A is correlated with poor prognosis in patients with SCC. A, qRT-PCR analysis of ARID1A expression in KYSE450 cells after 5-Aza (10 μmol/L) treatment for 1, 2, or 3 days. The data are the means ± SD; n = 3 independent experiments, two-tailed t tests. B, Bisulfite sequencing to detect the DNA methylation level in the ARID1A promoter region in various cell lines. C, Bisulfite sequencing to detect the DNA methylation level in the ARID1A promoter region in KYSE450 cells after 5-Aza (10 μmol/L) treatment for 3 days. D, Representative images and H-score analysis of ARID1A IHC staining in normal esophageal epithelial and ESCC tissues (n = 79). Box plot representation: from top to bottom—maximum, 75th percentile; median, 25th percentile; and minimum values. Two-tailed t tests. Scale bars, 200 μm. E, Kaplan–Meier analysis of patients with ESCC with low or high ARID1A expression.

Close modal

Consistent with the high methylation level of ARID1A in SCC, the ARID1A mRNA level was substantially lower in SCC tissues than in normal tissues in three cohorts from the GEO database (Supplementary Fig. S2A and S2B). In addition, IHC analysis of 79 pairs of ESCC and normal esophageal epithelial tissues showed that ARID1A protein expression was significantly lower in ESCC tissues than in normal tissues (Fig. 1D). Further analysis of ARID1A expression in another cohort of 93 ESCC cases showed that the ARID1A expression level is correlated with vessel infiltration, pathologic stage, tumor depth, and lymph node metastasis (Supplementary Fig. S2C and S2D). Moreover, Kaplan–Meier analysis showed that low ARID1A expression is associated with poor prognosis in patients with ESCC (Fig. 1E).

ARID1A depletion promotes SCC progression

To confirm the functions of ARID1A in SCC, we first knocked down ARID1A in KYSE410 cells (Supplementary Fig. S3A and S3B), which express a relatively high level of ARID1A but have weak migration and invasion abilities. ARID1A depletion caused a significant increase in the migration and invasion abilities of KYSE410 cells in a Transwell assay (Fig. 2A and B). Another SCC cell line, KYSE450, was also evaluated, with the same results of increased migration and invasion abilities upon ARID1A depletion (Fig. 2C and D; Supplementary Fig. S3A and S3B). Consistently, ectopic expression of ARID1A in the highly metastatic cell line KYSE30 significantly inhibited the migration and invasion abilities of these cells (Fig. 2E and F; Supplementary Fig. S3A and S3B). A wound-healing assay showed increased migration of both KYSE410 and KYSE450 cells after ARID1A loss and decreased migration of KYSE30 cells following ARID1A overexpression (Supplementary Fig. S3C–S3E). To confirm the effects of ARID1A on SCC cell metastasis in vivo, we injected ARID1A-depleted and control SCC cells into NOD/SCID mice through the tail vein and counted the number of lung metastatic nodules after 5 months. Both KYSE410 and KYSE450 cells showed a very low lung metastasis ability in vivo, consistent with the in vitro data, while a significant increase in the number of metastatic nodules was observed in mice injected with ARID1A-depleted SCC cells (Fig. 2G and H; Supplementary Fig. S3F). Strikingly, one of the mice injected with ARID1A-depleted KYSE410 cells and three of the mice injected with ARID1A-depleted KYSE450 cells also showed distant metastasis (Supplementary Fig. S3G).

Figure 2.

ARID1A depletion promotes SCC progression. Representative images and quantitative analysis of migrated and invaded KYSE410 (A and B) and KYSE450 (C and D) cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs in Transwell assays. Scale bars, 100 μm. E and F, Representative images and quantitative analysis of migrated and invaded KYSE30 cells expressing empty vector (Vehicle) or ARID1A in a Transwell assay. Scale bars, 100 μm. G, Number of lung metastatic nodules from KYSE410 and KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA (n = 9 for KYSE410 xenografts and n = 11 for KYSE450 xenografts). H, Representative images of lung metastatic nodules and hematoxylin and eosin–stained slides of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA. Scale bars, 3 mm. I,In vitro growth of KYSE410 and KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs. J,In vitro growth of KYSE30 cells expressing empty vector (Vehicle) or ARID1A. K,In vivo growth curves for xenografts of KYSE410 and KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA (n = 9 for KYSE410 xenografts and n = 10 for KYSE450 xenografts). L, Representative images of hematoxylin and eosin (H&E), ARID1A, and PCNA staining in xenografted tumors of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA. Scale bars, 100 μm. M, Quantitative analysis of ARID1A and PCNA staining of xenografted tumors of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA (n = 9). In B, D, F, I, and J, the data are the means ± SD; n = 3 independent experiments. In G, K, and M, the data are the means ± SEM; two-tailed t tests.

Figure 2.

ARID1A depletion promotes SCC progression. Representative images and quantitative analysis of migrated and invaded KYSE410 (A and B) and KYSE450 (C and D) cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs in Transwell assays. Scale bars, 100 μm. E and F, Representative images and quantitative analysis of migrated and invaded KYSE30 cells expressing empty vector (Vehicle) or ARID1A in a Transwell assay. Scale bars, 100 μm. G, Number of lung metastatic nodules from KYSE410 and KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA (n = 9 for KYSE410 xenografts and n = 11 for KYSE450 xenografts). H, Representative images of lung metastatic nodules and hematoxylin and eosin–stained slides of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA. Scale bars, 3 mm. I,In vitro growth of KYSE410 and KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs. J,In vitro growth of KYSE30 cells expressing empty vector (Vehicle) or ARID1A. K,In vivo growth curves for xenografts of KYSE410 and KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA (n = 9 for KYSE410 xenografts and n = 10 for KYSE450 xenografts). L, Representative images of hematoxylin and eosin (H&E), ARID1A, and PCNA staining in xenografted tumors of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA. Scale bars, 100 μm. M, Quantitative analysis of ARID1A and PCNA staining of xenografted tumors of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA (n = 9). In B, D, F, I, and J, the data are the means ± SD; n = 3 independent experiments. In G, K, and M, the data are the means ± SEM; two-tailed t tests.

Close modal

We next investigated whether ARID1A could affect the proliferation of SCC cells. A CCK-8 assay showed that ARID1A depletion can promote the proliferation of both KYSE410 and KYSE450 cells (Fig. 2I). This effect was also confirmed by a long-term colony formation assay (Supplementary Fig. S4A and S4B). In contrast, overexpression of ARID1A in KYSE30 cells significantly inhibited their proliferation rate (Fig. 2J; Supplementary Fig. S4C). EdU staining assays showed that ARID1A overexpression significantly inhibits SCC cell proliferation, and vice versa (Supplementary Fig. S4D and S4E). Through subcutaneous xenograft experiments, we confirmed that ARID1A depletion can also increase the growth rate of SCC tumors in vivo (Fig. 2K; Supplementary Fig. S4F–S4I). IHC analysis of these xenografts revealed strong PCNA staining in ARID1A-depleted SCC cells (Fig. 2L and M), consistent with the increased proliferation rate.

Depletion of ARID1A activates the oncogenic program

ARID1A has been reported to mediate gene transcription mostly through the chromatin-remodeling function of the SWI/SNF complex (16, 17). To investigate the detailed mechanism by which ARID1A functions in SCC, we first performed an EU assay to detect whether ARID1A depletion affects the global transcription status of SCC cells. After ARID1A depletion in KYSE410 cells, the EU signal was much stronger than that of control cells (Fig. 3A), demonstrating that ARID1A depletion can activate gene transcription in SCC cells. On the basis of this result, we next analyzed the gene expression profile of ARID1A-depleted and control cells. ARID1A depletion induced changes in the expression of thousands of genes, including several powerful oncogenes, and KEGG enrichment analyses indicated that some cancer-related signaling pathways were activated (Supplementary Fig. S5A). Upregulation of 16 significantly upregulated genes identified in the gene expression microarray analysis was confirmed by qRT-PCR (Fig. 3B). Consistent with this result, ARID1A overexpression downregulated the expression levels of these 16 genes (Fig. 3C). We then performed immunoblotting to detect changes in oncogenic signaling pathways. Upon ARID1A depletion, the PI3K/Akt, MAPK/Erk, and JAK/STAT signaling pathways were obviously activated, while ectopic expression of ARID1A suppressed these signaling pathways (Fig. 3D). Collectively, these results showed that ARID1A depletion can activate several oncogenes as well as oncogenic signaling pathways to drive the progression of SCC.

Figure 3.

ARID1A depletion activates the oncogenic program. A, Representative images and relative intensity of EU staining (red) in KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs. Hoechst 33342 (blue) was used to stain nuclei. Scale bars, 60 μm. B, qRT-PCR analysis of gene expression in KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs. C, qRT-PCR analysis of gene expression in KYSE30 cells expressing empty vector (vehicle) or ARID1A. D, Immunoblotting results for the indicated proteins in KYSE410 or KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs, or in KYSE30 cells expressing empty vector (Vehicle) or ARID1A. The data are the means ± SD except for those in A, which are the means ± SEM; n = 3 independent experiments, two-tailed t tests. *, P < 0.001.

Figure 3.

ARID1A depletion activates the oncogenic program. A, Representative images and relative intensity of EU staining (red) in KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs. Hoechst 33342 (blue) was used to stain nuclei. Scale bars, 60 μm. B, qRT-PCR analysis of gene expression in KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs. C, qRT-PCR analysis of gene expression in KYSE30 cells expressing empty vector (vehicle) or ARID1A. D, Immunoblotting results for the indicated proteins in KYSE410 or KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs, or in KYSE30 cells expressing empty vector (Vehicle) or ARID1A. The data are the means ± SD except for those in A, which are the means ± SEM; n = 3 independent experiments, two-tailed t tests. *, P < 0.001.

Close modal

ARID1A depletion disrupts transcriptional homeostasis

To further explore the mechanism by which ARID1A depletion modulates the activation of the oncogenic transcriptome, we used antibodies against ARID1A and a core subunit of the SWI/SNF complex, Brg1, to perform a ChIP-qPCR assay in ARID1A-depleted and control KYSE410 cells (Fig. 4A and B; Supplementary Fig. S5B). The associations between ARID1A and the promoter regions of the 7 genes that we selected from the set of differentially expressed genes were significantly decreased after ARID1A depletion (Fig. 4A). More importantly, Brg1 was also dissociated from these promoter regions (Fig. 4B), indicating that ARID1A loss triggered the reassembly of the SWI/SNF complex and, subsequently, chromatin remodeling to affect gene expression. Chromatin remodeling also accompanies histone modifications, such as histone acetylation and methylation. To investigate whether histone modifications are also involved in the regulatory mechanism of ARID1A in gene transcription in SCC cells, we performed a ChIP-qPCR assay using two antibodies against either HDAC1 or Suz12 (a core component of the PRC2 complex). Interestingly, we found that ARID1A depletion can lead to the dissociation of both HDAC1 and the PRC2 complex from the activated gene promoter regions in SCC cells (Fig. 4C and D).

Figure 4.

Depletion of ARID1A activates the oncogenic transcriptome via both direct and indirect chromatin remodeling. ChIP analysis of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs using antibodies against ARID1A (A), Brg1 (B), HDAC1 (C), or Suz12 (D) for the indicated gene promoters. E, Immunoblotting results for the indicated proteins in KYSE410 or KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs or in KYSE30 cells expressing empty vector (Vehicle) or ARID1A. The data are the means ± SD; n = 3 independent experiments, two-tailed t tests. *, P < 0.001; #, P < 0.01.

Figure 4.

Depletion of ARID1A activates the oncogenic transcriptome via both direct and indirect chromatin remodeling. ChIP analysis of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs using antibodies against ARID1A (A), Brg1 (B), HDAC1 (C), or Suz12 (D) for the indicated gene promoters. E, Immunoblotting results for the indicated proteins in KYSE410 or KYSE450 cells expressing control (shCtrl) or ARID1A (shARI#1, shARI#2) shRNAs or in KYSE30 cells expressing empty vector (Vehicle) or ARID1A. The data are the means ± SD; n = 3 independent experiments, two-tailed t tests. *, P < 0.001; #, P < 0.01.

Close modal

The PRC2 complex has histone methyltransferase activity and primarily trimethylates histone H3 on lysine 27 (18), while HDAC1- and HDAC2-containing complexes mainly contribute to the removal of acetyl groups from histone tails (19). We performed immunoblot analysis to verify the changes in these histone modification marks. As shown in Fig. 4E, ARID1A depletion significantly reduced the level of the transcriptionally repressive mark H3K27me3 in both KYSE410 and KYSE450 cells, while the levels of the transcriptionally activating histone marks H3K9ac and H3K27ac were clearly increased. Consistent with this finding, after ectopic expression of ARID1A, we detected an increase in H3K27me3 and decreases in both H3K9ac and H3K27ac (Fig. 4E). Collectively, these results showed that ARID1A depletion triggers the disruption of transcriptional homeostasis in SCC cells by affecting both chromatin remodeling and histone modifications.

Parthenolide synthetically targets ARID1A depletion in SCC cells

Targeting synthetic lethal genes has emerged as a promising strategy for the clinical treatment of malignancies triggered by the loss of essential tumor suppressors (20). In the past few years, the discovery of high mutation rates in epigenetic regulatory genes has led to the development of therapeutic strategies using specific chemical inhibitors to target cancers with mutations (21). Therefore, we sought to determine whether we could selectively target the oncogenic transcriptome induced by ARID1A depletion. We designed a screening model in which a Transwell plate was used to mimic the mechanism of action of drug treatments in the human body (Supplementary Fig. S6A). We screened an SMI library containing 107 inhibitors targeting different epigenetic regulatory elements to evaluate their effects on inhibiting the migration of ARID1A-depleted KYSE410 cells (Supplementary Table S2). A few inhibitors, most of which were histone deacetylase (HDAC) inhibitors, effectively inhibited cell migration (Fig. 5A; Supplementary Fig. S6B). We selected the top five most effective inhibitors and investigated whether their effects were specific to cells with ARID1A loss. The viability of these cells as measured by a CCK-8 assay showed that only parthenolide, a specific HDAC1 inhibitor, had noticeable synthetic lethality toward cells with ARID1A depletion, while the other four SMIs exhibited the same effects on both ARID1A-depleted and control KYSE410 cells (Supplementary Fig. S6C). This synthetic lethal effect was further confirmed by treatment of KYSE410 cells with graded doses of parthenolide (Fig. 5B and C; Supplementary Fig. S6D). In contrast, another pan-HDAC inhibitor, CI-994, did not produce appreciable synthetic lethal effects (Supplementary Fig. S6E–S6G), indicating that the synthetic lethal effect of parthenolide may be due to its specific inhibition of HDAC1. We further evaluated the synthetic lethality of parthenolide to low ARID1A expression in several SCC cell lines and found that parthenolide was more toxic to cell lines with low ARID1A expression than to SCC or epithelial cell lines with high ARID1A expression (Fig. 5D). To study the synthetic effect of parthenolide in vivo, we subcutaneously xenografted ARID1A-depleted and control KYSE410 cells into nude mice and treated the mice with either parthenolide or DMSO 7 days later (Supplementary Fig. S7A). Parthenolide also exhibited noticeable synthetic lethality towards ARID1A-depleted cells in vivo, supporting our previous results (Fig. 5E; Supplementary Fig. S7B). Consistent with these findings, parthenolide demonstrated obvious toxicity in two SCC PDX models with low ARID1A expression, but this effect was decreased in another PDX model with relatively high ARID1A expression (Fig. 5F–H; Supplementary Fig. S7C and S7D).

Figure 5.

Parthenolide synthetically targets ARID1A depletion in SCC cells. A, Quantitative analysis of migrated KYSE410 cells expressing ARID1A shRNA and treated with SMIs in Transwell assays. B, Quantitative analysis of migrated KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with parthenolide in Transwell assays. C,In vitro growth of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with parthenolide. D, Relative viability of the indicated cells treated with parthenolide or DMSO for 24 hours. E,In vivo growth curve of xenografts derived from KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with parthenolide or DMSO (n = 8). F–H,In vivo growth curve of SCC PDX model mice treated with parthenolide or DMSO (n = 5). The data are the means ± SD except for those in EH, which are the means ± SEM; n = 3 independent experiments, two-tailed t tests. PTL, parthenolide.

Figure 5.

Parthenolide synthetically targets ARID1A depletion in SCC cells. A, Quantitative analysis of migrated KYSE410 cells expressing ARID1A shRNA and treated with SMIs in Transwell assays. B, Quantitative analysis of migrated KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with parthenolide in Transwell assays. C,In vitro growth of KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with parthenolide. D, Relative viability of the indicated cells treated with parthenolide or DMSO for 24 hours. E,In vivo growth curve of xenografts derived from KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with parthenolide or DMSO (n = 8). F–H,In vivo growth curve of SCC PDX model mice treated with parthenolide or DMSO (n = 5). The data are the means ± SD except for those in EH, which are the means ± SEM; n = 3 independent experiments, two-tailed t tests. PTL, parthenolide.

Close modal

Parthenolide targets SCC cells with low ARID1A expression through a second hit

To illustrate the underlying mechanism of the synthetic lethality of parthenolide to ARID1A-depleted SCC cells, we first used shRNAs to knockdown the expression of either HDAC1 or HDAC2 in control and ARID1A-depleted KYSE410 cells (Supplementary Fig. S8A). Knockdown of HDAC1 expression in ARID1A-depleted KYSE410 cells resulted in stronger inhibition of proliferation, migration, and invasion than observed in control cells, while HDAC2 depletion led to similar effects in both control and ARID1A-depleted cells (Fig. 6A–F). These results showed that targeting HDAC1 also leads to synthetic lethality in ARID1A-depleted SCC cells. Then, we sought to reveal the mechanism of synthetic lethality by HDAC1 depletion. Targeting HDAC1 has been shown to induce cell apoptosis via upregulation of p21 expression (22). Interestingly, p21 is also a well-known downstream target of ARID1A (23, 24). Therefore, we hypothesized that targeting HDAC1 may result in synthetic lethality with ARID1A loss by upregulating p21 expression. Consistent with our hypothesis, we found an obvious decrease in p21 expression after ARID1A depletion and an increase in p21 expression after ARID1A overexpression (Supplementary Fig. S8B and S8C). Moreover, when we treated ARID1A-depleted KYSE410 cells with parthenolide, the p21 expression level was significantly rescued (Fig. 6G).

Figure 6.

Parthenolide targets SCC cells with low ARID1A expression through a second hit. A,In vitro growth of KYSE410 cells expressing ARID1A shRNA (shARI#1) alone or in combination with control (shCtrl), HDAC1 (shHD1#1, shHD1#2), or HDAC2 (shHD2#1, shHD2#2) shRNAs. B,In vitro growth of KYSE410 cells expressing control shRNA (shCtrl) alone or in combination with HDAC1 (shHD1#1, shHD1#2) or HDAC2 (shHD2#1, shHD2#2) shRNAs. C–F, Representative images and quantitative analysis of migrated (C and E) and invaded (D and F) KYSE410 cells expressing control (shCtrl), ARID1A (shARI#1), HDAC1 (shHD1#1, shHD1#2), or HDAC2 (shHD2#1, shHD2#2) shRNAs in a Transwell assay. Scale bars, 100 μm. G, Immunoblotting for the indicated proteins in KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with DMSO or parthenolide. H,In vitro growth of KYSE410 cells expressing control shRNA (shCtrl) or ARID1A (shARI#1) shRNA and treated with PD98059 (50 μmol/L) or LY294002 (50 μmol/L). I, H-score analysis of the indicated proteins by IHC. The data are the means ± SD except for those in I, which are the means ± SEM; n = 3 independent experiments, two-tailed t tests. PTL, parthenolide.

Figure 6.

Parthenolide targets SCC cells with low ARID1A expression through a second hit. A,In vitro growth of KYSE410 cells expressing ARID1A shRNA (shARI#1) alone or in combination with control (shCtrl), HDAC1 (shHD1#1, shHD1#2), or HDAC2 (shHD2#1, shHD2#2) shRNAs. B,In vitro growth of KYSE410 cells expressing control shRNA (shCtrl) alone or in combination with HDAC1 (shHD1#1, shHD1#2) or HDAC2 (shHD2#1, shHD2#2) shRNAs. C–F, Representative images and quantitative analysis of migrated (C and E) and invaded (D and F) KYSE410 cells expressing control (shCtrl), ARID1A (shARI#1), HDAC1 (shHD1#1, shHD1#2), or HDAC2 (shHD2#1, shHD2#2) shRNAs in a Transwell assay. Scale bars, 100 μm. G, Immunoblotting for the indicated proteins in KYSE410 cells expressing control (shCtrl) or ARID1A (shARI#1) shRNA and treated with DMSO or parthenolide. H,In vitro growth of KYSE410 cells expressing control shRNA (shCtrl) or ARID1A (shARI#1) shRNA and treated with PD98059 (50 μmol/L) or LY294002 (50 μmol/L). I, H-score analysis of the indicated proteins by IHC. The data are the means ± SD except for those in I, which are the means ± SEM; n = 3 independent experiments, two-tailed t tests. PTL, parthenolide.

Close modal

Inhibition of HDAC1 by parthenolide is mediated by HDAC1 ubiquitination and degradation (25). However, even though we nearly abolished the expression of HDAC1 using shRNAs, the synthetic lethality of HDAC1 depletion was still weaker than that with parthenolide treatment, for which the HDAC1 protein level was only partially decreased. These results led us to speculate on the existence of other mechanisms that may underlie the synthetic lethality of parthenolide. Since parthenolide has also been reported to suppress several oncogenic signaling pathways independent of HDAC1 inhibition (26, 27), we speculated that the synthetic lethality of parthenolide is partially due to its effect on the inhibition of signaling pathways. Consistent with our hypothesis, Western blot analysis showed that parthenolide treatment can indeed inhibit the activated oncogenic signaling pathways following ARID1A depletion (Fig. 6G). Furthermore, inhibition of either the PI3K/Akt pathway using LY294002 or the MAPK/Erk signaling pathway using PD98059 suppressed the malignant phenotype caused by ARID1A loss (Fig. 6H; Supplementary Fig. S9A and S9B). IHC analysis of the xenografts also showed an increase in p21 expression and suppression of the oncogenic signaling pathways after parthenolide administration compared with DMSO treatment (Fig. 6I; Supplementary Fig. S9C). On the basis of these results, we concluded that parthenolide exhibits synthetic lethality towards ARID1A-depleted ESCC cells not only by targeting HDAC1 to increase p21 expression but also by inhibiting oncogenic signaling pathways.

In the past several years, researchers have primarily focused on ARID1A in adenocarcinomas such as ovarian cancer (28, 29), pancreatic cancer (30), and colorectal cancer (31) due to its very high mutation rate. However, in the cancer types associated with a low mutation rate of ARID1A, its role remains unclear. For the first time, our study revealed that promoter hypermethylation is a unique mechanism of ARID1A inactivation in SCC. We showed that low ARID1A expression is correlated with advanced pathologic stage and poor prognosis in patients with SCC. Consistent with this finding, the results of functional studies confirmed that ARID1A depletion significantly promoted the progression of SCC, while ectopic expression of ARID1A prevented SCC development. Our results showed that ARID1A plays an essential tumor-suppressive role in SCC and that its epigenetic silencing is the main mechanism underlying its loss that drives SCC progression.

As a variant subunit of the SWI/SNF complex, ARID1A has been reported to specifically reorganize the DNA sequence in yeast (32). Subsequent studies found that although ARID1A–DNA interactions are required for promoter occupancy by the SWI/SNF complex in mammalian cells (33), the recognition of DNA by ARID1A is nonspecific (34, 35). A previous study showed that ARID1A participates in the priming of embryonic stem cell differentiation by affecting the activities of the Polycomb repressive complex (36). In addition, in ovarian cancer, ARID1A loss has been demonstrated to impair the recruitment of the Sin3A–HDAC complex, which is necessary to activate gene transcription (37). However, we previously found that ARID1A depletion activates MRP2 expression independent of HDAC1 (12). These lines of evidence indicate that the functional mechanism of ARID1A varies in different contexts. Previous studies revealed several downstream targets that contribute to the tumor-suppressive function of ARID1A, such as cytokine genes (37), ANXA1 (38), and UCA1 (39). However, the existence of multiple targets in different contexts obscures the relationship among downstream mediators of ARID1A. In addition, a recent study showed that ARID1A exerts context-dependent oncogenic and tumor-suppressive functions in liver cancer (17), further supporting the diversity of functional mechanisms of ARID1A in different cancer types. To clarify the specific mechanism of the tumor-suppressive role of ARID1A in SCC, we first showed that ARID1A depletion leads to the activation of an oncogenic transcriptome. Then, we further showed that the activation of the oncogenic transcriptome is due to both direct and indirect chromatin-remodeling mechanisms. First, ARID1A depletion led to the dissociation of the SWI/SNF complex from DNA, resulting in the activation of oncogenes following direct chromatin remodeling. In addition, the loss of ARID1A led to a change in histone modifications by the dissociation of HDAC1 and PRC2 from chromatin, which triggered indirect chromatin remodeling to affect gene transcription.

Targeting synthetic lethal genes is an effective method for the treatment of malignancies caused by the loss of essential tumor suppressors. Even though some synthetic lethal targets of ARID1A loss have been reported—for example, ATR (40), HDAC6 (41), ARID1B (42), and EZH2 (43)—all were functioning in the context of ARID1A mutation. Because of the various functional mechanisms of ARID1A in different cancer types, determining a synthetic lethal target of ARID1A epigenetic silencing in SCC remains important although challenging. By screening an SMI library, we revealed that parthenolide can effectively inhibit the malignant transformation of ARID1A-depleted SCC cells. We further showed that the synthetic lethality of parthenolide toward SCC cells with low ARID1A expression arises due to a second-hit mechanism. On one hand, parthenolide promotes the ubiquitination and degradation of HDAC1 and thus reactivates the expression of p21 to induce SCC cell apoptosis. On the other hand, parthenolide inhibits oncogenic signaling pathways, such as the PI3K/Akt and MAPK/Erk pathways, to further inhibit the oncogenic status triggered by ARID1A depletion. Considering that parthenolide is a widely used drug for the treatment of various diseases but without detailed protocols for specific cancer subtypes, our study presents a promising therapeutic strategy for parthenolide administration to patients with SCC exhibiting low ARID1A expression; in addition, the development of parthenolide analogues with improved water solubility will strongly promote its clinical applications (44, 45).

No potential conflicts of interest were disclosed.

Conception and design: Q. Luo, X. Wu, Z. Liu

Development of methodology: Q. Luo, X. Wu, W. Chang, P. Zhao

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): X. Zhu, H. Chen, Y. Nan, A. Luo, X. Zhou, D. Su, W. Jiao

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): Q. Luo, X. Wu, W. Chang, P. Zhao, X. Zhu, Y. Nan

Writing, review, and/or revision of the manuscript: Q. Luo, X. Wu, Z. Liu

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): Q. Luo, X. Wu, W. Chang

Study supervision: Q. Luo, X. Wu, Z. Liu

We are grateful to Dr. Yutaka Shimada (Kyoto University, Kyoto, Japan) for the ESCC cell lines and to Dr. Enmin Li (Medical College of Shantou University, Guangdong, China) for the NE-2 and NE-3 cells. We thank Professor Xiufeng Cao (Nanjing First Hospital, China) for providing the ESCC samples. We thank Dr. Dong Chang (Beijing Friendship Hospital, Capital Medical University, Fengtai, China) and Dr. Dezhi Li (National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, China) for the collection of SCC samples in the PDX model establishment. This work was supported by the National Key R&D Program of China (2016YFC1302100), the CAMS Innovation Fund for Medical Sciences (2016-I2M-1-001, 2019-I2M-1-003), and the National Science Foundation of China (81972570).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Sanchez-Danes
A
,
Blanpain
C
. 
Deciphering the cells of origin of squamous cell carcinomas
.
Nat Rev Cancer
2018
;
18
:
549
61
.
2.
Colevas
AD
. 
Chemotherapy options for patients with metastatic or recurrent squamous cell carcinoma of the head and neck
.
J Clin Oncol
2006
;
24
:
2644
52
.
3.
Martens
JA
,
Winston
F
. 
Recent advances in understanding chromatin remodeling by SWI/SNF complexes
.
Curr Opin Genet Dev
2003
;
13
:
136
42
.
4.
Wilson
BG
,
Roberts
CW
. 
SWI/SNF nucleosome remodellers and cancer
.
Nat Rev Cancer
2011
;
11
:
481
92
.
5.
Wang
W
. 
The SWI/SNF family of ATP-dependent chromatin remodelers: similar mechanisms for diverse functions
.
Curr Top Microbiol Immunol
2003
;
274
:
143
69
.
6.
Kadoch
C
,
Hargreaves
DC
,
Hodges
C
,
Elias
L
,
Ho
L
,
Ranish
J
, et al
Proteomic and bioinformatic analysis of mammalian SWI/SNF complexes identifies extensive roles in human malignancy
.
Nat Genet
2013
;
45
:
592
601
.
7.
Lin
DC
,
Hao
JJ
,
Nagata
Y
,
Xu
L
,
Shang
L
,
Meng
X
, et al
Genomic and molecular characterization of esophageal squamous cell carcinoma
.
Nat Genet
2014
;
46
:
467
73
.
8.
Dulak
AM
,
Stojanov
P
,
Peng
S
,
Lawrence
MS
,
Fox
C
,
Stewart
C
, et al
Exome and whole-genome sequencing of esophageal adenocarcinoma identifies recurrent driver events and mutational complexity
.
Nat Genet
2013
;
45
:
478
86
.
9.
Streppel
MM
,
Lata
S
,
DelaBastide
M
,
Montgomery
EA
,
Wang
JS
,
Canto
MI
, et al
Next-generation sequencing of endoscopic biopsies identifies ARID1A as a tumor-suppressor gene in Barrett's esophagus
.
Oncogene
2014
;
33
:
347
57
.
10.
Shimada
Y
,
Imamura
M
,
Wagata
T
,
Yamaguchi
N
,
Tobe
T
. 
Characterization of 21 newly established esophageal cancer cell lines
.
Cancer
1992
;
69
:
277
84
.
11.
Zhang
H
,
Jin
Y
,
Chen
X
,
Jin
C
,
Law
S
,
Tsao
SW
, et al
Cytogenetic aberrations in immortalization of esophageal epithelial cells
.
Cancer Genet Cytogenet
2006
;
165
:
25
35
.
12.
Luo
Q
,
Wu
X
,
Zhang
Y
,
Shu
T
,
Ding
F
,
Chen
H
, et al
ARID1A ablation leads to multiple drug resistance in ovarian cancer via transcriptional activation of MRP2
.
Cancer Lett
2018
;
427
:
9
17
.
13.
Wu
X
,
Luo
Q
,
Zhao
P
,
Chang
W
,
Wang
Y
,
Shu
T
, et al
JOSD1 inhibits mitochondrial apoptotic signalling to drive acquired chemoresistance in gynaecological cancer by stabilizing MCL1
.
Cell Death Differ
2020
;
27
:
55
70
.
14.
Gao
J
,
Aksoy
BA
,
Dogrusoz
U
,
Dresdner
G
,
Gross
B
,
Sumer
SO
, et al
Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal
.
Sci Signal
2013
;
6
:
pl1
.
15.
Cerami
E
,
Gao
J
,
Dogrusoz
U
,
Gross
BE
,
Sumer
SO
,
Aksoy
BA
, et al
The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data
.
Cancer Discov
2012
;
2
:
401
4
.
16.
Shahid
M
,
Gull
N
,
Yeon
A
,
Cho
E
,
Bae
J
,
Yoon
HS
, et al
Alpha-oxoglutarate inhibits the proliferation of immortalized normal bladder epithelial cells via an epigenetic switch involving ARID1A
.
Sci Rep
2018
;
8
:
4505
.
17.
Sun
X
,
Wang
SC
,
Wei
Y
,
Luo
X
,
Jia
Y
,
Li
L
, et al
Arid1a has context-dependent oncogenic and tumor suppressor functions in liver cancer
.
Cancer Cell
2017
;
32
:
574
589
.
18.
Margueron
R
,
Li
G
,
Sarma
K
,
Blais
A
,
Zavadil
J
,
Woodcock
CL
, et al
Ezh1 and Ezh2 maintain repressive chromatin through different mechanisms
.
Mol Cell
2008
;
32
:
503
18
.
19.
Fu
X
,
Wang
X
,
Duan
Z
,
Zhang
C
,
Fu
X
,
Yang
J
, et al
Histone H3k9 and H3k27 acetylation regulates IL-4/STAT6-mediated igepsilon transcription in B lymphocytes
.
Anat Rec
2015
;
298
:
1431
9
.
20.
Mullard
A
. 
Synthetic lethality screens point the way to new cancer drug targets
.
Nat Rev Drug Discov
2017
;
16
:
736
.
21.
Pfister
SX
,
Ashworth
A
. 
Marked for death: targeting epigenetic changes in cancer
.
Nat Rev Drug Discov
2017
;
16
:
241
63
.
22.
Zhou
H
,
Cai
Y
,
Liu
D
,
Li
M
,
Sha
Y
,
Zhang
W
, et al
Pharmacological or transcriptional inhibition of both HDAC1 and 2 leads to cell cycle blockage and apoptosis via p21(Waf1/Cip1) and p19(INK4d) upregulation in hepatocellular carcinoma
.
Cell Prolif
2018
;
51
:
e12447
.
23.
Li
ZY
,
Zhu
SS
,
Chen
XJ
,
Zhu
J
,
Chen
Q
,
Zhang
YQ
, et al
ARID1A suppresses malignant transformation of human pancreatic cells via mediating senescence-associated miR-503/CDKN2A regulatory axis
.
Biochem Biophys Res Commun
2017
;
493
:
1018
25
.
24.
Miller
RE
,
Brough
R
,
Bajrami
I
,
Williamson
CT
,
McDade
S
,
Campbell
J
, et al
Synthetic lethal targeting of ARID1A-mutant ovarian clear cell tumors with dasatinib
.
Mol Cancer Ther
2016
;
15
:
1472
84
.
25.
Gopal
YN
,
Arora
TS
,
Van Dyke
MW
. 
Parthenolide specifically depletes histone deacetylase 1 protein and induces cell death through ataxia telangiectasia mutated
.
Chem Biol
2007
;
14
:
813
23
.
26.
Jeyamohan
S
,
Moorthy
RK
,
Kannan
MK
,
Arockiam
AJ
. 
Parthenolide induces apoptosis and autophagy through the suppression of PI3K/Akt signaling pathway in cervical cancer
.
Biotechnol Lett
2016
;
38
:
1251
60
.
27.
Lin
M
,
Bi
H
,
Yan
Y
,
Huang
W
,
Zhang
G
,
Zhang
G
, et al
Parthenolide suppresses non-small cell lung cancer GLC-82 cells growth via B-Raf/MAPK/Erk pathway
.
Oncotarget
2017
;
8
:
23436
47
.
28.
Shen
J
,
Ju
Z
,
Zhao
W
,
Wang
L
,
Peng
Y
,
Ge
Z
, et al
ARID1A deficiency promotes mutability and potentiates therapeutic antitumor immunity unleashed by immune checkpoint blockade
.
Nat Med
2018
;
24
:
556
62
.
29.
Altucci
L
. 
A key HDAC6 dependency of ARID1A-mutated ovarian cancer
.
Nat Cell Biol
2017
;
19
:
889
90
.
30.
Kimura
Y
,
Fukuda
A
,
Ogawa
S
,
Maruno
T
,
Takada
Y
,
Tsuda
M
, et al
ARID1A maintains differentiation of pancreatic ductal cells and inhibits development of pancreatic ductal adenocarcinoma in mice
.
Gastroenterology
2018
;
155
:
194
209
.
31.
Mathur
R
,
Alver
BH
,
San Roman
AK
,
Wilson
BG
,
Wang
X
,
Agoston
AT
, et al
ARID1A loss impairs enhancer-mediated gene regulation and drives colon cancer in mice
.
Nat Genet
2017
;
49
:
296
302
.
32.
Nie
Z
,
Xue
Y
,
Yang
D
,
Zhou
S
,
Deroo
BJ
,
Archer
TK
, et al
A specificity and targeting subunit of a human SWI/SNF family-related chromatin-remodeling complex
.
Mol Cell Biol
2000
;
20
:
8879
88
.
33.
Chandler
RL
,
Brennan
J
,
Schisler
JC
,
Serber
D
,
Patterson
C
,
Magnuson
T
. 
ARID1a-DNA interactions are required for promoter occupancy by SWI/SNF
.
Mol Cell Biol
2013
;
33
:
265
80
.
34.
Dallas
PB
,
Pacchione
S
,
Wilsker
D
,
Bowrin
V
,
Kobayashi
R
,
Moran
E
. 
The human SWI-SNF complex protein p270 is an ARID family member with non-sequence-specific DNA binding activity
.
Mol Cell Biol
2000
;
20
:
3137
46
.
35.
Wilsker
D
,
Patsialou
A
,
Zumbrun
SD
,
Kim
S
,
Chen
Y
,
Dallas
PB
, et al
The DNA-binding properties of the ARID-containing subunits of yeast and mammalian SWI/SNF complexes
.
Nucleic Acids Res
2004
;
32
:
1345
53
.
36.
Lei
I
,
West
J
,
Yan
Z
,
Gao
X
,
Fang
P
,
Dennis
JH
, et al
BAF250a protein regulates nucleosome occupancy and histone modifications in priming embryonic stem cell differentiation
.
J Biol Chem
2015
;
290
:
19343
52
.
37.
Kim
M
,
Lu
F
,
Zhang
Y
. 
Loss of HDAC-mediated repression and gain of NF-kappaB activation underlie cytokine induction in ARID1A- and PIK3CA-mutation-driven ovarian cancer
.
Cell Rep
2016
;
17
:
275
88
.
38.
Berns
K
,
Sonnenblick
A
,
Gennissen
A
,
Brohée
S
,
Hijmans
EM
,
Evers
B
, et al
Loss of ARID1A activates ANXA1, which serves as a predictive biomarker for trastuzumab resistance
.
Clin Cancer Res
2016
;
22
:
5238
48
.
39.
Guo
X
,
Zhang
Y
,
Mayakonda
A
,
Madan
V
,
Ding
LW
,
Lin
LH
, et al
ARID1A and CEBPalpha cooperatively inhibit UCA1 transcription in breast cancer
.
Oncogene
2018
;
37
:
5939
51
.
40.
Williamson
CT
,
Miller
R
,
Pemberton
HN
,
Jones
SE
,
Campbell
J
,
Konde
A
, et al
ATR inhibitors as a synthetic lethal therapy for tumours deficient in ARID1A
.
Nat Commun
2016
;
7
:
13837
.
41.
Bitler
BG
,
Wu
S
,
Park
PH
,
Hai
Y
,
Aird
KM
,
Wang
Y
, et al
ARID1A-mutated ovarian cancers depend on HDAC6 activity
.
Nat Cell Biol
2017
;
19
:
962
73
.
42.
Helming
KC
,
Wang
X
,
Wilson
BG
,
Vazquez
F
,
Haswell
JR
,
Manchester
HE
, et al
ARID1B is a specific vulnerability in ARID1A-mutant cancers
.
Nat Med
2014
;
20
:
251
4
.
43.
Bitler
BG
,
Aird
KM
,
Garipov
A
,
Li
H
,
Amatangelo
M
,
Kossenkov
AV
, et al
Synthetic lethality by targeting EZH2 methyltransferase activity in ARID1A-mutated cancers
.
Nat Med
2015
;
21
:
231
8
.
44.
Shanmugam
R
,
Kusumanchi
P
,
Cheng
L
,
Crooks
P
,
Neelakantan
S
,
Matthews
W
, et al
A water-soluble parthenolide analogue suppresses in vivo prostate cancer growth by targeting NFkappaB and generating reactive oxygen species
.
Prostate
2010
;
70
:
1074
86
.
45.
D'Anneo
A
,
Carlisi
D
,
Lauricella
M
,
Puleio
R
,
Martinez
R
,
Di Bella
S
, et al
Parthenolide generates reactive oxygen species and autophagy in MDA-MB231 cells. A soluble parthenolide analogue inhibits tumour growth and metastasis in a xenograft model of breast cancer
.
Cell Death Dis
2013
;
4
:
e891
.