Aberrant activation of histone methyltransferase EZH2 and ribosome synthesis strongly associate with cancer development and progression. We previously found that EZH2 regulates RNA polymerase III–transcribed 5S ribosomal RNA gene transcription. However, whether EZH2 regulates ribosome synthesis is still unknown. Here, we report that EZH2 promotes ribosome synthesis by targeting and silencing a long noncoding RNA PHACTR2-AS1. PHACTR2-AS1 directly bound ribosome DNA genes and recruited histone methyltransferase SUV39H1, which in turn triggered H3K9 methylation of these genes. Depletion of PHACTR2-AS1 resulted in hyperactivation of ribosome synthesis and instability of ribosomal DNA, which promoted cancer cell proliferation and metastasis. Administration of PHACTR2-AS1-30nt-RNA, which binds to SUV39H1, effectively inhibited breast cancer growth and lung metastasis in mice. PHACTR2-AS1 was downregulated in breast cancer patients, where lower PHACTR2-AS1 expression promoted breast cancer development and correlated with poor patient outcome. Taken together, we demonstrate that PHACTR2-AS1 maintains a H3K9 methylation-marked silent state of ribosomal DNA genes, comprising a regulatory axis that controls breast cancer growth and metastasis.

Significance:

These findings reveal that EZH2 mediates ribosomal DNA stability via silencing of PHACTR2-AS1, representing a potential therapeutic target to control breast cancer growth and metastasis.

Ribosomal biogenesis is a highly ordered multistage process involving ribosomal DNA (rDNA) transcription, ribosomal protein synthesis, and ribosomal assembly (1). In humans, rDNA genes are tandemly repeated (300–400 copies) in nucleolar organizer regions, and approximately half of the copies are transcriptionally silent (2). Moderate silencing of rDNA transcription is critical for genome stability. Disrupting rDNA silencing induces abnormal stimulation of rRNA synthesis, leading to uncontrolled cell proliferation or malignant cell transformation, and eventual tumorigenesis (3–5). In cancer cells, some oncogenic and tumor-suppressive pathways modulate rDNA transcription (6–9).

Long noncoding RNAs (lncRNA) comprise a large class of regulatory RNAs without protein-coding potential that are >200 nucleotides long (10, 11). LncRNAs regulate cancer development and progression by influencing cell proliferation, metastasis, metabolism, and self-renewal (12–15). Histone methylation is an important means of lncRNA-mediating gene expression (16). The histone methyltransferase SUV39H1 catalyzes H3K9 methylation at repetitive DNA sequences and regulates heterochromatin formation. RNA plays a critical role in targeting SUV39H1 to DNA sequences. Chromatin-associated RNA mediates the association of SUV39H1 with pericentric DNA (17). The telomeric lncRNA TERRA targets SUV39H1 to telomeres, promoting H3K9me3 accumulation at damaged telomeres, and modulating telomere structures (18). Heterochromatin is formed at pericentromeres, telomeres, and rDNA loci. However, whether lncRNAs participate in targeting SUV39H1 to rDNA repeats is unknown.

Here, we report that EZH2-regulated lncRNA PHACTR2-AS1 mediates SUV39H1 localization to rDNA repeats and induces H3K9 methylation of rDNA, helping to suppress rRNA transcription. Moreover, PHACTR2-AS1 displays efficacy against tumor growth and metastasis in vivo. Our findings provide insight into the potential of PHACTR2-AS1 as a therapeutic target in breast cancer.

Cell culture and transfection

MCF7, MDA-MB-231, Hs578T, and HEK-293A cell lines were obtained from the Cell Resource Center, Peking Union Medical College (the Headquarter of National Infrastructure of Cell Line Resource, NSTI). The species origin of the cell lines was confirmed with PCR. The identity of the cell lines was authenticated with short tandem repeat profiling. The cell lines were checked free of Mycoplasma contamination by PCR. Cell stocks were created within five passages, and all experiments were completed within ten passages. The same batch of cells was thawed every 1 to 2 months. The cells were grown in DMEM (Gibco; Thermo Fisher Scientific) supplemented with 10% FBS at 37°C under 5% CO2 in a humidified incubator.

Plasmids were transfected using Lipofectamine 2000 (#11668019, Invitrogen; Thermo Fisher Scientific). ASOs and siRNAs were transfected using RNAiMAX Transfection Reagent (#13778150, Invitrogen; Thermo Fisher Scientific). Sequences of shRNA and siRNA were listed:

PHACTR2-AS1-shRNA-1: GCAGTAATAACCCAGCTCT; PHACTR2-AS1-shRNA-2: CCAC TACTTCTGTGGGAA T; Negative Control: AACACGTCTATACGC; PHACTR2-AS1-ASO-1: GCGTTGCAAGGTTAAT; PHACTR2-AS1-ASO-2: AACTAGCCAATTGATG; PHACTR2-AS1-ASO-3: CTTGAATGAAAGAGT; SUV39H1 siRNA-1: UCUUGUGGCAAAGAAAGCGAUGC GG; SUV39H1 siRNA-2: UUCUUGCGAAUCUUCUC CAGGGUGC; siRNA-pools of EZH2, c-myc, Twist, YY1, and E2F6 includes 4 DharmaFECT siRNAs (Thermo Fisher Dharmacon).

Tumor specimens and in situ hybridization

The tissue microarrays of patients with breast cancer were purchased from National Human Genetic Resources Sharing Service Platform 2005DKA21300 (Shanghai Outdo Biotechnology Company Ltd.). Tissue sections were deparaffinized and rehydrated gradually. After being digested with pepsin, tissue samples were hybridized with 5′ biotin-labeled LNATM-modified PHACTR2-AS1 probe (Exiqon) at 54°C overnight, and subsequently streptavidin conjugated to Poly-Horseradish Peroxidase (Poly-HRP) detecting kit was applied (SP-9002, Zhong Shan Jin Qiao, Beijing, China). The scoring of staining was performed by three investigators including a pathologist. Criteria for assessing staining intensities of PHACTR2-AS1 were classified into four levels: 0 = no staining, 1 = low staining, 2 = media staining, and 3 = strong staining.

Tumor xenografts and IVIS Lumina Imaging

MDA-MB-231-Luc-D3H2LN cells were infected with lentiviruses carrying empty LV5 vector (GenePharma) or PHACTR2-AS1-LV5. Cells were inoculated orthotopically onto the abdominal mammary fat pad (1.5 × 106 cells) or injected into the lateral tail vein (5 × 105 cells) of 6-week-old female NOD-SCID mice. After 4 weeks, bioluminescence imaging was performed. Mice were injected with d-luciferin abdominally (200 mg/kg, 10 minutes before imaging), anesthetized, and imaged with Xenogen IVIS Lumina system (Caliper Life Sciences). Images were analyzed with Living Image software ver. 3.0. (Caliper Life Sciences).

RNA isolation and quantitative real-time PCR

Total RNA was isolated with TRIzol reagent (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using a HiScript II Q RT SuperMix Kit (+gDNA wiper, Vazyme). Real-time PCR was performed using a ChamQ SYBR qPCR Master Mix (Vazyme) by LightCycler 96 detection system (Roche). Primer sequences: PHACTR2-AS1-F-GTCAGGCTCCTGGATCTTCTAG;R-AAGGGCTAAGGAACTCGATTG; Pre-rRNA F-TGTCAGGCGTTCTCGTCTC; R-AGCACGACGTCACCACATC; GAPDH F-CTGAGAACGGGAAGCTTGT; R-GGGTGCTAAGCAGTTGGT; EZH2 F-TCGGTAAATCCAAACTGCTATGC; R-CTTGGCAAAAATACCTATCCTGTGA; PHACTR2 F-AACCTCGGCAGTATTAGAAAGGA; R-CCTCTCCGATGGGTATCATGTG; SUV39H1 F-GATATGACCTCTGCATCTTCCGC; R-GTACACGTCCTCCACGTAGTCCAG.

RNA in situ hybridization and immunofluorescence microscopy

Cells were briefly rinsed with PBS and fixed with 4% formaldehyde for 15 minutes at room temperature followed by permeabilization with 0.1% pepsin for 1 minute at 37°C. After shortly washing, cells were dehydrated gradually and air dried. 5′ Biotin-labeled LNATM-modified PHACTR2-AS1 probe (Exiqon) was diluted in hybridization buffer, denatured at 80°C for 2 minutes, and hybridized at 54°C for 30 minutes. After hybridization, cells were washed by 0.1× SSC at 65°C for 3 × 10 minutes, and streptavidin Alexa Fluor 488 conjugate (Invitrogen) was then added and incubated for 4 hours at 37°C. For colocalization, immunofluorescence was followed using anti-fibrillarin (Abcam), anti-UBF1 (Santa Cruz Biotechnology), anti-SUV39H1 (Abcam), and anti-γ-H2AX (Merck Millipore). Images were captured with a confocal laser-scanning microscope (Carl Zeiss).

Ribosome fractionation

Cells were exposed to cycloheximide (100 μg/mL) for 15 minutes, then 2 × 106 cells were lysed in 500 μL lysis buffer (9). After 30-minute incubation on ice, the samples were centrifuged at 13,000 rpm at 4°C for 10 minutes. For fractionation, the lysates were loaded on 15%–45% sucrose gradients and separated by ultracentrifugation with a SW40 rotor (Beckman) at 39,000 rpm at 4°C for 3 hours. Linear sucrose gradients were prepared with a Gradient Master (Biocomp). The distribution of ribosomes on the gradients was recorded using BIOCOMP Piston Gradient Fractinator equipped with BIO-RAD ECONO UV Monitor (set at 260 nm).

RNA pull-down assay

Linearized plasmids of pcDNA3.1-PHACTR2-AS1/truncation mutants/antisense were used as DNA templates for transcription in vitro. MEGAscript T7 Kit (Ambion) with biotin-16-UTP (Ambion) was used to produce biotin-labeled RNA and MEGAclear Kit (Ambion) was then applied to purify those RNA transcripts. Biotinylated RNA in RNA structure buffer (19) was heated to 95°C for 2 minutes, put on ice for 3 minutes, and then left at room temperature or 30 minutes to allow proper secondary structure formation. Folded RNA was then mixed with precleared cell lysates in binding buffer and then incubated at room temperature for 1 hour. Streptavidin Dynabeads (Invitrogen) were added to each binding reaction and further incubated at room temperature for 1 hour. Beads were washed briefly with binding buffer for five times and boiled in SDS buffer. Then, the retrieved proteins were detected by Western blot analysis.

Western blot analysis

Western blot assay was performed as described previously (20). We used anti-EZH2 (Cell Signaling Technology), anti-GAPDH (ZSGB-BIO), anti-H3K9me2 (Cell Signaling Technology), anti-H3K9me3 (Cell Signaling Technology), anti-SUV39H1 (Cell Signaling Technology), anti-GST (ZSGB-BIO), anti-fibrillarin (Abcam), anti-YY1 (Santa Cruz Biotechnology), and anti-PHACTR2 (Abcam) antibodies.

Native RNA immunoprecipitation assay

RNA immunoprecipitation (RIP) was performed using EZ-Magna RIP RNA-Binding Protein Immunoprecipitation Kit (#17-700, Merck Millipore) according to manufacturer's instructions using anti-Flag (Sigma-Aldrich), anti-HA (Abcam), anti-SUV39H1 (Active Motif), anti-mouse IgG, or anti-rabbit IgG antibodies.

Chromatin isolation by RNA purification assay

Chromatin isolation by RNA purification (ChIRP) assay was performed using EZ-Magna ChIRP RNA Interactome Kit (#17-10495, Merck) according to manufacturer's instructions. RPLP0 and TGFβ1 served as negative controls for rDNA. LacZ-antisense DNA probes were used as a negative control for PHACTR2-AS1 probes. The sequences of probes were listed: 1-TTGAATGATAGCCTTCGGTT-biotin; 2-GTAGTGGTGAGAGGAGTCAA-biotin; 3-AATACGGGCTGGTATACAGG-biotin; 4-GTTGGAGAAGAACGTTCAGG-biotin; 5-ATGTGGTGACCTGTCGGGAA-biotin; 6-CATTCTGCCCTTTCAGAAGG-biotin; 7-CTTCTTCCTTGTCACCTAAG-biotin; 8-TGCTTTGTCTGCACATTTAC-biotin.

Dual luciferase reporter assay

Plasmids of pGL3-rDNA-IRES and pRL-TK were cotransfected using Lipofectamine 3000 Reagent (Invitrogen; Thermo Fisher Scientific). Firefly and Renilla luciferase activity was measured by the Dual-Luciferase Reporter Assay (#E1910, Promega), and Renilla activity was used to normalize firefly activity.

Chromatin immunoprecipitation

A chromatin immunoprecipitation (ChIP) assay was performed using SimpleChIP Enzymatic Chromatin IP Kit (#9003, Cell Signaling Technology) according to the manufacturer's instructions. Anti-EZH2 (Merck Millipore), anti-H3K27me3 (Cell Signaling Technology), anti-RPA135 (Santa Cruz Biotechnology), anti-H3K9me2 (Cell Signaling Technology), and anti-H3K9me3 (Cell Signaling Technology). Primers are listed: PHACTR2-AS1 CHIP1 F-CAGTAAGTAAGGCAGTGAGC; R-CTGCGTCAGATGAAGAAGA; PHACTR2-AS1 CHIP2 F-TGGCATCTGCTTGGC; R-GAGGTGTTTGCGTCAT; rDNA-D0 F-TGGGTTGACCAGAGGGACC; R-GACACGGACACGGACACC; rDNA-D8 F-AGTCGGGTTGCTTGGGAATGC; R-CCCTTACGGTACTTGTTGACT; rDNA-D18 F-GTTGACGTACAGGGTGGACTG; R-GGAAGTTGTCTTCACGCCTGA.

RNA reagents

PHACTR2-AS1-30nt-RNA and negative control were chemically synthesized with modifications from Ribobio Co. All the 30 nucleotides were modified by 2′-O-methylation and 5′-Cholesterol for in vivo RNA delivery, which is long-lasting in mice. The negative controls were purchased from Ribobio Co. For delivery of methylation and cholesterol-conjugated RNA, 5 nmol RNA in 0.1 mL saline buffer was injected into tail vein of NOD/SCID mice once every 3 days for 2–4 weeks.

Cell proliferation and colony formation

Cells were plated into 96-well plates at 3,000 cells/well. Ten microliters of WST-1 (Roche) was added to the cells per well and incubated for 2 hours at 37°C. Then the reaction mixture was measured in a microplate reader at 490 nm. For colony formation, 2 × 103 cells were plated into 6-well plates. Two weeks later, cells were fixed, stained with crystal violet, and photographed.

LncRNA microarray analysis

Total RNA was isolated using TRIzol (Life Technologies). RNA quality and quantity was measured by using Agilent 2200 Bioanalyzer. The antisense RNA was generated using Amino Allyl messageAmp II kit (Life Technologies) and labeled with Cy5. Hybridization was carried out using RiboBio RiboArrayTM lncDETECTTM Human Array 1 × 40K (Ribobio Co.). The slides were scanned using the Axon GenePix 4000B microarray scanner (Axon Instruments). Scanned images were then imported into GenePix Pro Microarray Image Analysis Software for analysis. The raw data have been deposited in GEO under the accession code GSE147441.

Ethics

The Ethics Committee of Peking University Health Science Center has approved the mouse experiments (permit number: LA2014122) for this study. The handling of mice was conducted in accordance with the ethical standards of the Helsinki Declaration of 1975 and the revised version in 1983. We also referred to the procedures by Workman and colleagues.

Statistical analysis

All data are presented as means ± SD of results from three independent experiments. Statistical significance was determined by the two-tailed Student t test. P < 0.05 was considered statistically significant.

LncRNA PHACTR2-AS1 is a target gene of EZH2

Similar to protein-coding genes, lncRNAs are also subject to epigenetic regulation, especially H3K27 methylation mediated by EZH2 (21). To identify EZH2-regulated lncRNAs, we initially profiled the expression of lncRNAs in a pair of breast cancer cells (MCF7-control vs. MCF7-EZH2) and the top 10 downregulated lncRNAs were shown (Supplementary Fig. S1A). By detecting the level of the ten lncRNAs in human breast cancer tissues, PHACTR2-AS1 was markedly downregulated (Supplementary Fig. S1B), and low PHACTR2-AS1 expression was observed in a panel of cell lines with the mesenchymal phenotype (Supplementary Fig. S1C). To verify whether PHACTR2-AS1 was regulated by EZH2, we first estimated the levels of PHACTR2-AS1 with or without EZH2 overexpression. EZH2 overexpression led to inhibited PHACTR2-AS1 expression (Fig. 1A; Supplementary Fig. S1D). In contrast, EZH2 knockdown restored the expression of PHACTR2-AS1 (Fig. 1B and C; Supplementary Fig. S1E). Consistently, when cells were treated with GSK343, an EZH2 inhibitor, PHACTR2-AS1 expression was increased (Supplementary Fig. S1F and S1G). We then cloned the promoter of PHACTR2-AS1 into the upstream of firefly luciferase–coding region and examined the luciferase activity. Knockdown of EZH2 directly activated PHACTR2-AS1 promoter transcription (Supplementary Fig. S1H). Furthermore, to understand how PHACTR2-AS1 was regulated by EZH2, we detected the occupancy of both EZH2 and H3K27 trimethylation at PHACTR2-AS1 promoter and found that EZH2-mediated H3K27 trimethylation indeed occurred at PHACTR2-AS1 promoter (Fig. 1D).

Figure 1.

PHACTR2-AS1 is a target gene of EZH2. A, Empty vector or Flag-EZH2 plasmid was transfected, followed by qRT-PCR and Western blot analysis. B, Control or EZH2 siRNAs-pool was transfected into MDA-MB-231 cells, followed by qRT-PCR and Western blot analysis. C, Control or EZH2 siRNA pools were transfected into Hs578T cells, followed by qRT-PCR and Western blot analysis. D, Lysates were extracted from Hs578T cells for ChIP assays. qPCR assays were performed to quantify ChIP-enriched DNAs. E, siRNA pools were transfected into Hs578T cells, followed by qRT-PCR. F, Lysates were extracted from Hs578T cells for ChIP assay. G, Hs578T cells were treated by control or YY1 siRNA pools for 48 hours and lysates were extracted for ChIP assay. Data represent the mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (two-tailed Student t test). Western blot analysis showed the efficacy of YY1 siRNA pool.

Figure 1.

PHACTR2-AS1 is a target gene of EZH2. A, Empty vector or Flag-EZH2 plasmid was transfected, followed by qRT-PCR and Western blot analysis. B, Control or EZH2 siRNAs-pool was transfected into MDA-MB-231 cells, followed by qRT-PCR and Western blot analysis. C, Control or EZH2 siRNA pools were transfected into Hs578T cells, followed by qRT-PCR and Western blot analysis. D, Lysates were extracted from Hs578T cells for ChIP assays. qPCR assays were performed to quantify ChIP-enriched DNAs. E, siRNA pools were transfected into Hs578T cells, followed by qRT-PCR. F, Lysates were extracted from Hs578T cells for ChIP assay. G, Hs578T cells were treated by control or YY1 siRNA pools for 48 hours and lysates were extracted for ChIP assay. Data represent the mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (two-tailed Student t test). Western blot analysis showed the efficacy of YY1 siRNA pool.

Close modal

To scrutinize how EZH2 was recruited to PHACTR2-AS1 promoter, we detected the regulation of some known EZH2-interacting transcription factors on PHACTR2-AS1 expression, including c-myc, Twist, YY1, and E2F6 (22). Among them, only YY1 knockdown can lead to the increase of PHACTR2-AS1 level (Fig. 1E). Transcription factor Yin Yang 1 (YY1) was reported to interact with EZH2 and recruit it to target genes (23). Our data found that YY1 occupied the promoter of PHACTR2-AS1 (Fig. 1F). YY1 knockdown could decrease the occupancy of EZH2 and H3K27 trimethylation at PHACTR2-AS1 promoter (Fig. 1G), indicating that YY1 is involved in the recruitment of EZH2 to PHACTR2-AS1 promoter. All these results showed that EZH2 suppressed PHACTR2-AS1 expression, identifying PHACTR2-AS1 as a target gene of EZH2 in breast cancer cells.

PHACTR2-AS1 targets ribosome DNA and inhibits ribosome synthesis

To explore the biological functions of PHACTR2-AS1, we first examined its subcellular localization. FISH followed by immunofluorescence showed a strong colocalization between PHACTR2-AS1 and nucleolar marker proteins (fibrillarin and UBF1), indicating that PHACTR2-AS1 was enriched in the nucleolus (Fig. 2A; Supplementary Fig. S2A). The nucleolus contains abundant rDNA repeats, suggesting that PHACTR2-AS1 may be associated with rDNA. We found a marked enrichment of PHACTR2-AS1 at the D0 region, demonstrating that PHACTR2-AS1 directly bound the rDNA promoter (Fig. 2B; Supplementary Fig. S2B). All rDNA promoter sequences in different chromosomes are identical. To discern whether PHACTR2-AS1 binding to rDNA blocked the occupancy of RNA Pol I at rDNA, we generated stable cell lines with PHACTR2-AS1 overexpression or downregulation (Supplementary Fig. S2C) and measured the effect of PHACTR2-AS1 on the occupancy of RPA135, a subunit of the Pol I complex. Indeed, the presence of PHACTR2-AS1 inhibited the occupancy of RNA Pol I at the rDNA promoter (Fig. 2C), whereas PHACTR2-AS1 depletion released the inhibition of RNA Pol I occupancy (Fig. 2D), strongly suggesting that PHACTR2-AS1 suppressed rRNA transcription.

Figure 2.

PHACTR2-AS1 inhibits ribosome synthesis. A, Costaining of PHACTR2-AS1 (RNA FISH, Alexa Fluor 488), fibrillarin, and UBF1 (Alexa Fluor 568) in Hs578T cells. B, Top, a schematic of an rDNA cluster. Bottom, ChIRP assay in PHACTR2-AS1–overexpressing MDA-MB-231 cells. C and D, Lysates were prepared from Hs578T-control/PHACTR2-AS1 or MCF7-control/PHACTR2-AS1-shRNA cells for ChIP assays. E, An empty or a PHACTR2-AS1-overexpressing vector was transfected into Hs578T cells, followed by qRT-PCR. F, LNA-based ASOs were transfected into MCF7 cells, followed by qRT-PCR. The efficacy of ASOs was examined both in the nucleus and cytoplasm. G, ASO-treated MCF7 cells were pretreated with 5-FU for 4 hours and with 4sU for labeling nascent pre-rRNA during the last hour. Nascent pre-rRNA was measured by qRT-PCR and normalized to nascent GAPDH mRNA. H, Luciferase reporter assays were performed in ASO-treated MCF7 cells, and the values were normalized to those of Renilla. The above data represent the means ± SD from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001. I, Absorbances of 40S, 60S, and 80S ribosomes were detected at 254 nm in the stable cells.

Figure 2.

PHACTR2-AS1 inhibits ribosome synthesis. A, Costaining of PHACTR2-AS1 (RNA FISH, Alexa Fluor 488), fibrillarin, and UBF1 (Alexa Fluor 568) in Hs578T cells. B, Top, a schematic of an rDNA cluster. Bottom, ChIRP assay in PHACTR2-AS1–overexpressing MDA-MB-231 cells. C and D, Lysates were prepared from Hs578T-control/PHACTR2-AS1 or MCF7-control/PHACTR2-AS1-shRNA cells for ChIP assays. E, An empty or a PHACTR2-AS1-overexpressing vector was transfected into Hs578T cells, followed by qRT-PCR. F, LNA-based ASOs were transfected into MCF7 cells, followed by qRT-PCR. The efficacy of ASOs was examined both in the nucleus and cytoplasm. G, ASO-treated MCF7 cells were pretreated with 5-FU for 4 hours and with 4sU for labeling nascent pre-rRNA during the last hour. Nascent pre-rRNA was measured by qRT-PCR and normalized to nascent GAPDH mRNA. H, Luciferase reporter assays were performed in ASO-treated MCF7 cells, and the values were normalized to those of Renilla. The above data represent the means ± SD from three independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001. I, Absorbances of 40S, 60S, and 80S ribosomes were detected at 254 nm in the stable cells.

Close modal

Next, we examined the regulation of PHACTR2-AS1 on the 47S precursor rRNA (pre-rRNA), a direct product of rRNA transcription. PHACTR2-AS1 overexpression led to a pronounced reduction of pre-rRNA expression in breast cancer cell lines (Fig. 2E; Supplementary Fig. S2D). Treatment of PHACTR2-AS1 ASOs resulted in the increase of pre-rRNA, indicating the regulatory effect of PHACTR2-AS1 on pre-rRNA (Fig. 2F; Supplementary Fig. S2E). Furthermore, we detected the changes of nascent pre-rRNA and found PHACTR2-AS1 depletion led to increased nascent pre-rRNA transcription, suggesting that PHACTR2-AS1 specifically regulated pre-rRNA production (Fig. 2G). In agreement, luciferase reporter assays showed that PHACTR2-AS1 depletion resulted in significant activation of rDNA promoter, indicating that PHACTR2-AS1 suppressed rRNA transcription (Fig. 2H).

Production of pre-rRNA in the nucleolus is the initiating step of ribosome biogenesis. Mature 80S ribosome, composed of a 40S and a 60S subunit, is ultimately formed. We found that PHACTR2-AS1 overexpression resulted in an obvious decrease in the levels of 40S, 60S, and 80S ribosomes, whereas PHACTR2-AS1 knockdown led to a marked increase in the 3 ribosomes (Fig. 2I). Collectively, these results demonstrated that PHACTR2-AS1 prevented the rDNA transcription and ultimately inhibited ribosome synthesis.

Because PHACTR2-AS1 is a target gene of EZH2, we examined the effect of EZH2 on pre-rRNA, and found that overexpression of EZH2 enhanced the level of pre-rRNA (Supplementary Fig. S2F). We also observed the silencing of pre-rRNA upon to EZH2 knockdown, and the silencing can be erased by PHACTR2-AS1 ASOs (Supplementary Fig. S2G). Furthermore, EZH2 knockdown sharply decreased the levels of 40S, 60S, and 80S ribosomes (Supplementary Fig. S2H). These results suggested that EZH2 may promote ribosome synthesis through suppressing PHACTR2-AS1.

PHACTR2-AS1 promotes H3K9 methylation of rDNA by recruiting SUV39H1

Given that various epigenetic modifications occur within rDNAloci, we first analyzed the presence of histone modifications at rDNA in breast cancer cells. Among those modifications, H3K9me2 and H3K9me3 were markedly enriched throughout the rDNA-repeat region (Supplementary Fig. S3A). Regions rich in H3K9 me2/3 display heterochromatin-mediated gene silencing (24). We therefore reasoned that H3K9 methylation may mediate the PHACTR2-AS1–dependent silencing of rRNA genes. We observed that PHACTR2-AS1 overexpression enhanced the abundance of H3K9me2/3 at rDNA promoter (Fig. 3A; Supplementary Fig. S3B). Conversely, PHACTR2-AS1 knockdown in the nucleus led to reduced occupancy of both H3K9me2/3 at rDNA promoter (Fig. 3B; Supplementary Fig. S3C). These results indicated that PHACTR2-AS1 suppressed rRNA transcription by enhancing the occupancy of methylated H3K9 at rDNA loci.

Figure 3.

PHACTR2-AS1 promotes H3K9 methylation of ribosome DNA by recruiting SUV39H1. A and B, Lysates were extracted from stable Hs578T-control/PHACTR2-AS1 or MCF7-control/PHACTR2-AS1-shRNA cells for ChIP assays. C, Endogenous SUV39H1 from MCF7 cells was immunoprecipitated with an anti-SUV39H1 antibody for RIP assay. RIP enrichment was determined as the amount of RNA recovered in association with SUV39H1, relative to that recovered with an IgG. The above data represent the mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001, Student t test; ns, nonsignificant. D, Costaining of PHACTR2-AS1 (RNA FISH, Alexa Fluor 488), SUV39H1 (immunofluorescence, Alexa Fluor 568) in Hs578T cells. E, Purified GST-SUV39H1 protein was incubated with biotin-labeled PHACTR2-AS1 RNA for RNA pull-down assays. Biotin-labeled antisense RNAs against PHACTR2-AS1 and GAPDH mRNA were used as negative controls. F, Top, different regions of GST-SUV39H1. Different fusion proteins were incubated with biotin-PHACTR2-AS1 for RNA pull-down assays. G, Top, different PHACTR2-AS1 fragments. RNA pull-down assays were performed by incubating GST-SUV39H1 protein with biotin-PHACTR2-AS1 fragments. H, An empty or PHACTR2-AS1–overexpressing plasmid was transfected into Hs578T cells in the presence of control or SUV39H1 siRNA, followed by qRT-PCR and Western blot analysis. I, PHACTR2-AS1–overexpressing cells were treated with different doses of chaetocin for 48 hours, followed qRT-PCR and Western blot analysis.

Figure 3.

PHACTR2-AS1 promotes H3K9 methylation of ribosome DNA by recruiting SUV39H1. A and B, Lysates were extracted from stable Hs578T-control/PHACTR2-AS1 or MCF7-control/PHACTR2-AS1-shRNA cells for ChIP assays. C, Endogenous SUV39H1 from MCF7 cells was immunoprecipitated with an anti-SUV39H1 antibody for RIP assay. RIP enrichment was determined as the amount of RNA recovered in association with SUV39H1, relative to that recovered with an IgG. The above data represent the mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001, Student t test; ns, nonsignificant. D, Costaining of PHACTR2-AS1 (RNA FISH, Alexa Fluor 488), SUV39H1 (immunofluorescence, Alexa Fluor 568) in Hs578T cells. E, Purified GST-SUV39H1 protein was incubated with biotin-labeled PHACTR2-AS1 RNA for RNA pull-down assays. Biotin-labeled antisense RNAs against PHACTR2-AS1 and GAPDH mRNA were used as negative controls. F, Top, different regions of GST-SUV39H1. Different fusion proteins were incubated with biotin-PHACTR2-AS1 for RNA pull-down assays. G, Top, different PHACTR2-AS1 fragments. RNA pull-down assays were performed by incubating GST-SUV39H1 protein with biotin-PHACTR2-AS1 fragments. H, An empty or PHACTR2-AS1–overexpressing plasmid was transfected into Hs578T cells in the presence of control or SUV39H1 siRNA, followed by qRT-PCR and Western blot analysis. I, PHACTR2-AS1–overexpressing cells were treated with different doses of chaetocin for 48 hours, followed qRT-PCR and Western blot analysis.

Close modal

SUV39H1 was reported to catalyze the methylation of H3K9 (25). To determine how PHACTR2-AS1 promotes H3K9me, the association of PHACTR2-AS1 and SUV39H1 was detected. First, RIP assays confirmed the interaction between PHACTR2-AS1 and SUV39H1 (Fig. 3C), and their colocalization was found in the nucleolus (Fig. 3D). Next, RNA pull-down assays showed that SUV39H1 directly interacted with PHACTR2-AS1 (Fig. 3E). Analysis of truncation mutants revealed that the middle region of SUV39H1 was responsible for binding with PHACTR2-AS1 (Fig. 3F), and PHACTR2-AS1 nucleotides 1766–1795 were sufficient for SUV39H1 binding (Fig. 3G), which form a stable stem–loop structure, as determined by RNA-folding analyses (Supplementary Fig. S3D; ref. 26). However, SUV39H1 knockdown did not affect PHACTR2-AS1 expression (Supplementary Fig. S3E). PHACTR2-AS1 also did not regulate the level of SUV39H1 (Supplementary Fig. S3F), suggesting a critical role for PHACTR2-AS1 in recruiting SUV39H1 to rRNA genes.

Furthermore, we found that SUV39H1 siRNA prevented PHACTR2-AS1–induced suppression of pre-rRNA (Fig. 3H). The SUV39H1 inhibitor chaetocin partly reversed the silencing of pre-rRNA resulting from PHACTR2-AS1 overexpression (Fig. 3I). Consistently, a methyltransferase activity–deficient mutant (R235H) of SUV39H1 did not obviously decrease pre-rRNA (Supplementary Fig. S3G), indicating that the methyltransferase activity of SUV39H1 was required for SUV39H1-dependent suppression of pre-rRNA. Furthermore, SUV39H1 depletion partly overcame the inhibition of RNA Pol I occupancy at rDNA resulting from PHACTR2-AS1 overexpression (Supplementary Fig. S3H). These data suggested that PHACTR2-AS1 recruited SUV39H1 and blocked RNA Pol I occupancy. Upon depletion of PHACTR2-AS1, rRNA transcription is reactivated, leading to increased pre-rRNA and ribosomes.

PHACTR2-AS1 depletion induced genome instability

Cells lacking H3K9 methylation display disorganization of the nucleolar structure (3). Because PHACTR2-AS1 deletion might help disrupt the nucleolar integrity, we analyzed the cellular localization of nucleolar protein fibrillarin to visualize alteration of nucleolar structure. Interestingly, the nucleoli in control cells presented large spherical masses, whereas cells lacking PHACTR2-AS1 were characterized by fragmented nucleoli with irregular masses of reduced size. Statistical analyses confirmed that the number of fragmented nucleoli increased significantly in PHACTR2-AS1–deficient cells versus control cells (Fig. 4AC; Supplementary Fig. S4A and S4B), indicating that PHACTR2-AS1 depletion resulted in fragmentation of nucleolar structure. Next, we examined the effect of PHACTR2-AS1 on the formation of phosphorylated histone H2AX (γH2A.X) foci, which is critical for DNA damage responses and genome stability (27). PHACTR2-AS1 depletion resulted in a global increase of γH2A.X foci in the nucleus (Fig. 4D and E; Supplementary Fig. S4C and S4D). In contrast, overexpression of PHACTR2-AS1 led to the decrease both of fragmented nucleoli and γH2A.X foci (Supplementary Fig. S4E–S4H). Furthermore, ChIP analysis indicated that PHACTR2-AS1 knockdown led to a significant increase in γH2A.X levels at rDNA repeats (Fig. 4F), suggesting that PHACTR2-AS1 depletion potentially resulted in increased DNA damage. Furthermore, the number of rDNA copies decreased significantly in PHACTR2-AS1-shRNA cells compared with control cells (Fig. 4G), indicating that PHACTR2-AS1 depletion may disrupt rDNA stability. We also found that PHACTR2-AS1–depleted cells showed marked genomic abnormalities, including micronuclei and abnormal mitoses (Fig. 4H and I). These findings suggested that PHACTR2-AS1 depletion disrupted the rDNA integrity, resulting in genome instability.

Figure 4.

PHACTR2-AS1 depletion induced genome instability. A, Immunofluorescence of fibrillarin in stable MCF7-control/PHACTR2-AS1-shRNAs cells. The images represent a confocal Z stack. Arrows, cells with fragmented nucleoli. B, Cells with fragmented nucleoli were counted for statistical analysis (n = 100). C, Fibrillarin expression was measured by Western blot. D and E, Immunofluorescence of γH2A.X was measured to assess the formation of γH2A.X foci. Representative images and statistical analysis are shown. F, ChIP assays were performed using an anti-γH2A.X antibody. G, Genome DNA was extracted, and qPCR was performed to quantitate the amounts of rDNA repeats, with normalization to GAPDH. H and I, Stable MCF7-control/PHACTR2-AS1-shRNA cells were stained with DAPI. Micronuclei or abnormal chromosomes (including anaphase bridges and lagging chromatin) were measured from interval or anaphase cells (n = 100), respectively. Arrows, individual abnormalities. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 4.

PHACTR2-AS1 depletion induced genome instability. A, Immunofluorescence of fibrillarin in stable MCF7-control/PHACTR2-AS1-shRNAs cells. The images represent a confocal Z stack. Arrows, cells with fragmented nucleoli. B, Cells with fragmented nucleoli were counted for statistical analysis (n = 100). C, Fibrillarin expression was measured by Western blot. D and E, Immunofluorescence of γH2A.X was measured to assess the formation of γH2A.X foci. Representative images and statistical analysis are shown. F, ChIP assays were performed using an anti-γH2A.X antibody. G, Genome DNA was extracted, and qPCR was performed to quantitate the amounts of rDNA repeats, with normalization to GAPDH. H and I, Stable MCF7-control/PHACTR2-AS1-shRNA cells were stained with DAPI. Micronuclei or abnormal chromosomes (including anaphase bridges and lagging chromatin) were measured from interval or anaphase cells (n = 100), respectively. Arrows, individual abnormalities. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

PHACTR2-AS1 suppresses breast cancer cell growth and metastasis

Hyperactivation of ribosome biogenesis is associated with uncontrolled cancer cell proliferation and genome instability induces cellular malignant transformation (6, 28). PHACTR2-AS1 depletion markedly promoted proliferation, migration, and invasion of breast cancer cells (Fig. 5A–D). In contrast, PHACTR2-AS1 overexpression significantly inhibited cell proliferation, migration, and invasion (Fig. 5EH). Furthermore, a transcriptional factor of rDNA UBF1 was overexpressed to activate ribosome synthesis (Supplementary Fig. S5A). PHACTR2-AS1 overexpression overcame the increase of cell proliferation and migration resulting from UBF1 overexpression (Supplementary Fig. S5B and S5C). And the increase of cell migration induced by PHACTR2-AS1 depletion can be rescued by actinomycin D, an inhibitor of rDNA transcription (Supplementary Fig. S5D), suggesting that dysregulation of rDNA synthesis mediates the role of PHACTR2-AS1 in cancer cells. Enhancement of genome instability induced by SUV39H deficiency promotes tumorigenesis. PHACTR2-AS1 overexpression could rescue the effect of SUV39H1 knockdown (Supplementary Fig. S5E and S5F), indicating that SUV39H1 is involved in the role of PHACTR2-AS1 in cancer cells.

Figure 5.

PHACTR2-AS1 inhibits cancer cell growth and metastasis. MCF7-control/PHACTR2-AS1-shRNAs and Hs578T-control/PHACTR2-AS1 cells were assayed for proliferation (A and E), colony formation (B and F), migration (C and G), and invasion (D and H). Relative values are presented as fold of change over control. Data represent the mean ± SD. I, MDA-MB-231-Luc-D3H2LN cells with or without PHACTR2-AS1 were inoculated onto mammary fat pad of mice (n = 5/group). Representative bioluminescent images of tumor specimens both in vivo and in vitro. Bioluminescence-based quantitation of primary tumor sizes. Tumor volumes were measured every week and tumor weights were determined after dissection. J, Both cell transfectants were injected into tail vein of mice (n = 5/group). Lung metastasis was monitored at 6 weeks postinjection. Representative bioluminescent images of lung specimens both in vivo and in vitro. Bioluminescent quantitation of lung metastasis. Representative lung metastasis specimens were sectioned and stained with hematoxylin and eosin (H&E). K, PHACTR2-AS1 levels in both cell transfectants were verified by qRT-PCR. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 5.

PHACTR2-AS1 inhibits cancer cell growth and metastasis. MCF7-control/PHACTR2-AS1-shRNAs and Hs578T-control/PHACTR2-AS1 cells were assayed for proliferation (A and E), colony formation (B and F), migration (C and G), and invasion (D and H). Relative values are presented as fold of change over control. Data represent the mean ± SD. I, MDA-MB-231-Luc-D3H2LN cells with or without PHACTR2-AS1 were inoculated onto mammary fat pad of mice (n = 5/group). Representative bioluminescent images of tumor specimens both in vivo and in vitro. Bioluminescence-based quantitation of primary tumor sizes. Tumor volumes were measured every week and tumor weights were determined after dissection. J, Both cell transfectants were injected into tail vein of mice (n = 5/group). Lung metastasis was monitored at 6 weeks postinjection. Representative bioluminescent images of lung specimens both in vivo and in vitro. Bioluminescent quantitation of lung metastasis. Representative lung metastasis specimens were sectioned and stained with hematoxylin and eosin (H&E). K, PHACTR2-AS1 levels in both cell transfectants were verified by qRT-PCR. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

To examine the role of PHACTR2-AS1 in vivo, control cells and PHACTR2-AS1–overexpressing cells were orthotopically implanted into mammary fat pad of mice (Fig. 5I). After 4 weeks, tumor sizes were measured. Tumors induced by PHACTR2-AS1–overexpressing cells were significantly smaller than those developed from control cells. Tumor volumes and weights were monitored weekly, revealing that PHACTR2-AS1 significantly inhibited tumor growth. Next, control cells and PHACTR2-AS1–overexpressing cells were injected intravenously into mice, and lung metastasis was determined at 6 weeks post-injection (Fig. 5J). PHACTR2-AS1 overexpression led to decreased lung metastasis of cancer cells. The efficacy of PHACTR2-AS1 overexpression was measured (Fig. 5K). Taken together, all these results indicated that PHACTR2-AS1 suppressed breast cancer growth and metastasis in vitro and in vivo.

A synthesized PHACTR2-AS1 fragment efficiently inhibited tumor growth and lung metastasis

Given that the region of PHACTR2-AS1 from nucleotides 1766–1795 was responsible for recruiting SUV39H1, we investigated whether this short region can function similar to the full-length PHACTR2-AS1. Our results showed that PHACTR2-AS11766–1795 contributed to decreases in pre-rRNA and ribosome levels and inhibited cell proliferation, migration, and invasion (Fig. 6A–E). We also synthesized PHACTR2-AS1-30nt-RNA (nucleotides 1766–1795) labeled with fluorophore Cy3 and observed its location in the nucleolus (Fig. 6F).

Figure 6.

PHACTR2-AS1-30nt-RNA inhibited cancer cell growth and metastasis. A and B, The empty, PHACTR2-AS1full length, or PHACTR2-AS11766–1795 plasmid was transfected into Hs578T cells, followed by qRT-PCR and ribosome detection. C–E, Hs578T cells were transfected with empty or PHACTR2-AS11766–1795 plasmid for cell proliferation, migration, and invasion assays. F, Cy3-labeled PHACTR2-AS1-30nt-RNA was transfected into Hs578T cells. Cells were fixed and stained with an anti-fibrillarin. G, MDA-MB-231-Luc-D3H2LN cells were inoculated onto the mammary fat pad of mice (n = 8/group). After 2 weeks, the mice were divided into two groups and injected with control RNA or PHACTR2-AS1-30nt-RNA through the tail vein once every 3 days. Representative in vivo bioluminescence images. H, Bioluminescence-based quantitation of primary tumor sizes. I, Ribosomes were extracted and fractionated from tumor specimens. J, MDA-MB-231-Luc-D3H2LN cells were injected into mice through the tail vein, followed by tail vein injection of control RNA or PHACTR2-AS1-30nt-RNA once every 3 days (n = 8/group). Representative bioluminescence images are shown. K, Bioluminescent quantitation of lung metastasis. L, Representative lung metastasis specimens were sectioned and stained with hematoxylin and eosin (H&E). *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 6.

PHACTR2-AS1-30nt-RNA inhibited cancer cell growth and metastasis. A and B, The empty, PHACTR2-AS1full length, or PHACTR2-AS11766–1795 plasmid was transfected into Hs578T cells, followed by qRT-PCR and ribosome detection. C–E, Hs578T cells were transfected with empty or PHACTR2-AS11766–1795 plasmid for cell proliferation, migration, and invasion assays. F, Cy3-labeled PHACTR2-AS1-30nt-RNA was transfected into Hs578T cells. Cells were fixed and stained with an anti-fibrillarin. G, MDA-MB-231-Luc-D3H2LN cells were inoculated onto the mammary fat pad of mice (n = 8/group). After 2 weeks, the mice were divided into two groups and injected with control RNA or PHACTR2-AS1-30nt-RNA through the tail vein once every 3 days. Representative in vivo bioluminescence images. H, Bioluminescence-based quantitation of primary tumor sizes. I, Ribosomes were extracted and fractionated from tumor specimens. J, MDA-MB-231-Luc-D3H2LN cells were injected into mice through the tail vein, followed by tail vein injection of control RNA or PHACTR2-AS1-30nt-RNA once every 3 days (n = 8/group). Representative bioluminescence images are shown. K, Bioluminescent quantitation of lung metastasis. L, Representative lung metastasis specimens were sectioned and stained with hematoxylin and eosin (H&E). *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

To evaluate the possible therapeutic potential of PHACTR2-AS1-30nt-RNA, we synthesized a durable PHACTR2-AS1-30nt-RNA (Supplementary Fig. S6A). First, we injected the biotin-labeled PHACTR2-AS1-30nt-RNA into tail vein of mice bearing xenograft tumors. The location of biotin-PHACTR2-AS1-30nt-RNA was showed by avidin staining of freezing section. At about 72 hours, the intensity of biotin-PHACTR2-AS1-30nt-RNA in tumor cells reached a highest point, then began to decline and disappeared at 96 hours (Supplementary Fig. S6B and S6C), indicating that the retention-time of PHACTR2-AS1-30nt-RNA in tumor cells is about 72 hours. In addition, biotin-PHACTR2-AS1-30nt-RNA was clearly observed in tumor cells of lungs at 72 hours after injection (Supplementary Fig. S6D). These data showed that the biotin-PHACTR2-AS1-30nt-RNA can be taken up by the tumor cells of both mice xenograft tumors and lung metastasis.

Furthermore, MDA-MB-231-Luc-D3H2LN cells were orthotopically implanted into mammary fat pad of mice (Fig. 6G). Tumor growth was significantly slower in the PHACTR2-AS1-RNA–treated group compared with that in the control RNA–treated group (Fig. 6H), suggesting that long-lasting RNA fragments can effectively inhibit tumor growth. Importantly, PHACTR2-AS1-30nt-RNA decreased levels of 40S, 60S, and 80S ribosomes extracted from xenografts (Fig. 6I), indicating that ribosome synthesis mediated the inhibitory effect of PHACTR2-AS1 on tumor growth. In addition, 30-nt-RNA treatment enhanced the abundance of H3K9me2/3 at the rDNA loci (Supplementary Fig. S6E and S6F), indicating the specificity and activity of the 30-nt-RNA.

To further examine the role of PHACTR2-AS1-30nt-RNA in lung metastasis, MDA-MB-231-Luc-D3H2LN cells were injected into tail vein of mice, followed by tail vein injection of control RNA or PHACTR2-AS1-30nt-RNA for 4 weeks (Fig. 6J). Bioluminescence imaging showed that PHACTR2-AS1-30nt-RNA decreased breast cancer cell metastasis to the lungs (Fig. 6K and L), suggesting that PHACTR2-AS1-30nt-RNA is of therapeutic value for blocking breast cancer lung metastasis.

PHACTR2-AS1 is downregulated in patients with breast cancer

To assess the role of PHACTR2-AS1 in patients with breast cancer, we stained PHACTR2-AS1 in 90 pairs of breast cancer tissues and normal tissues and found that normal breast tissues exhibited stronger PHACTR2-AS1 staining than cancer tissues (Fig. 7A and B). In addition, PHACTR2-AS1 levels were higher in normal tissues than in some types of cancers, including pancreatic, kidney, lung, and rectal cancers (Supplementary Fig. S7A). We also found that the patients with elevated PHACTR2-AS1 expression showed better overall survival than those with reduced PHACTR2-AS1 expression (Fig. 7C; Supplementary Fig. S7B). Collectively, these findings indicated that PHACTR2-AS1 expression was suppressed in breast cancer and that lower PHACTR2-AS1 expression may predict poor outcomes for patients with breast cancer.

Figure 7.

The PHACTR2-AS1 is downregulated in patients with breast cancer. A and B, Detection of PHACTR2-AS1 expression in human breast cancer compared to the matched adjacent normal breast tissues by chromogenic in situ hybridization (CISH) with paraffin-embedded tissues (n = 90). Representative CISH staining of PHACTR2-AS1. Statistical analysis of differential expression is shown. C, Kaplan–Meier survival analysis of PHACTR2-AS1 expression by CISH in tissue microarrays of patients with breast cancer. D and E, Both PHACTR2-AS1 expression (CISH) and EZH2 expression (IHC) were detected in paraffin-embedded tissues. Representative images are shown. Spearman and Pearson correlation tests were performed. F, Left, analyses of expression level of PHACTR2-AS1 in the two groups of high and low expression of EZH2. Right, analyses of expression level of EZH2 in the two groups of high and low expression of PHACTR2-AS1. G and H, Levels of both PHACTR2-AS1 RNA and EZH2 mRNA were measured in fresh human breast cancer tissues and matched adjacent normal breast tissues (n = 17) by qRT-PCR. Pearson correlation tests were performed. I, Ribosomes were measured in three representative patients. J, A working model of PHACTR2-AS1. *, P < 0.05.

Figure 7.

The PHACTR2-AS1 is downregulated in patients with breast cancer. A and B, Detection of PHACTR2-AS1 expression in human breast cancer compared to the matched adjacent normal breast tissues by chromogenic in situ hybridization (CISH) with paraffin-embedded tissues (n = 90). Representative CISH staining of PHACTR2-AS1. Statistical analysis of differential expression is shown. C, Kaplan–Meier survival analysis of PHACTR2-AS1 expression by CISH in tissue microarrays of patients with breast cancer. D and E, Both PHACTR2-AS1 expression (CISH) and EZH2 expression (IHC) were detected in paraffin-embedded tissues. Representative images are shown. Spearman and Pearson correlation tests were performed. F, Left, analyses of expression level of PHACTR2-AS1 in the two groups of high and low expression of EZH2. Right, analyses of expression level of EZH2 in the two groups of high and low expression of PHACTR2-AS1. G and H, Levels of both PHACTR2-AS1 RNA and EZH2 mRNA were measured in fresh human breast cancer tissues and matched adjacent normal breast tissues (n = 17) by qRT-PCR. Pearson correlation tests were performed. I, Ribosomes were measured in three representative patients. J, A working model of PHACTR2-AS1. *, P < 0.05.

Close modal

Furthermore, we detected the EZH2 protein level by IHC staining and PHACTR2-AS1 RNA level by RNA in situ hybridization in human breast cancer tissue arrays. The expression of EZH2 was negatively correlated with the expression of PHACTR2-AS1 (Fig. 7D and E). The level of PHACTR2-AS1 is higher in the group of low expression of EZH2 than that in the group of high expression of EZH2 (Fig. 7F). Likewise, the level of EZH2 is also higher in the group of low expression of PHACTR2-AS1 than that in the group of high expression of PHACTR2-AS1 (Fig. 7F), suggesting that the protein level of EZH2 is negatively correlated with the RNA level of PHACTR2-AS1 in breast cancer tissues.

Furthermore, we used 17 pairs of fresh breast cancer tissues and normal tissues to assess the RNA level of both PHACTR2-AS1 and EZH2 and the ribosomal level. PHACTR2-AS1 level was downregulated in breast cancer tissues compared with the normal tissues, whereas the RNA level of EZH2 was upregulated in cancer tissues (Fig. 7G), indicating the negative relation between PHACTR2-AS1 and EZH2 again (Fig. 7H). Next, we detected the ribosomal levels of the 17 patients and found that the ribosomes are markedly increased in 13 patients with breast cancer (Fig. 7I; Supplementary Fig. S7C). Collectively, these results suggested that EZH2 may enhance ribosome synthesis through silencing PHACTR2-AS1 expression to promote breast cancer development.

Here, we report that PHACTR2-AS1 binds to rDNA and recruits SUV39H1, triggering H3K9 methylation at rDNA. H3K9 modification blocked the binding of RNA Pol I to rDNA, resulting in the suppression of ribosome synthesis. Upon depletion of PHACTR2-AS1 induced by EZH2-mediated H3K27 methylation, rRNA transcription is reactivated, leading to increased ribosome synthesis and genomic instability, both of which promote cancer proliferation and metastasis (Fig. 7J).

Epigenetic regulation of rRNA genes is involved in dysregulating ribosome biogenesis during the malignant transformation of cells (29, 30). NoRC (nucleolar remodeling complex) is critical for maintaining the constitutively silent state of an rDNA cluster by recruiting DNMT and HDAC (2). eNoSC (energy-dependent nucleolar silencing complex) contains SIRT1, SUV39H1, and NML (31). Under glucose starvation, eNoSC triggers rDNAsilencing, thereby protecting cells from energy deprivation–dependent apoptosis. Thus, eNoSC is mainly responsible for precisely regulating rRNA synthesis under different energy conditions. Although lncRNA PHACTR2-AS1 interacts with SUV39H1, PHACTR2-AS1 is not required for rRNA gene silencing in response to glucose deprivation (Supplementary Fig. S7D), suggesting that PHACTR2-AS1 is not a component of the eNoSC complex. Here, we found EZH2-mediated H3K27me3 inhibited PHACTR2-AS1 expression. EZH2 has been regarded as a biomarker for aggressive breast cancer (32). Blocking EZH2-mediated H3K27me3 disrupts the silent state of rRNA genes associated with PHACTR2-AS1, uncovering the relationship between EZH2 and rRNA synthesis.

Hyperactivation of ribosome biogenesis was reported to play significant roles in cancer initiation and progression (33, 34). Cancer tissues have lower rDNA copy numbers than normal tissues, despite increased rRNA synthesis and proliferation (35). Indeed, depletion of PHACTR2-AS1 led to the decreased rDNA copies, although rRNA synthesis was activated. It is possible that depletion of PHACTR2-AS1 induced the switch of silent rDNA to active rDNA or upregulated the transcription activity of active rDNA copies. PHACTR2-AS1 depletion can reduce SUV39H1 recruitment to rRNA genes, resulting in heterochromatin relaxation at rDNA. Heterochromatin relaxation may cause fragmentation of nucleolar structure, DNA double-strand breaks, and loss of rDNA repeats, all of which lead to genome instability (36). Thus, PHACTR2-AS1 depletion enhances protein synthesis rates and increases genomic instability, both of which contribute to malignant cell transformation. Consistent with PHACTR2-AS1, depletion of TIP5 (a large subunit of NoRC) induced genomic instability and concurrently enhanced rRNA transcription, leading to malignant transformation (37).

Chen and colleagues reported that PHACTR2-AS1 (also known as NR027113) regulated PTEN/PI3K/AKT signaling pathway in hepatocellular carcinoma. Recently, they reported that this lncRNA also regulated ERK and AKT signaling and renamed it as LncIHS according its function in hepatocellular carcinoma (38, 39). Since no obvious nucleolar localization was showed in HCC cells, PHACTR2-AS1 may no effect on ribosome synthesis in HCC, which can explain the dichotomous role of PHACTR2-AS1 in hepatocellular cancer and breast cancer. We have demonstrated that rDNA is the direct target of PHACTR2-AS1 in breast cancer cells. However, due to functional diversity of lncRNAs, we cannot exclude that there are other targets of PHACTR2-AS1 in breast cancer cells, which leaves an opportunity for future study.

Ribosome biogenesis has been confirmed as a potential target for cancer treatment (40–42). Several features of lncRNAs determine their potentials as therapeutic targets (43). One of the most used strategies is to block cancer-upregulated lncRNA function by applying specific ASOs against lncRNA (44, 45). Another strategy of lncRNA targeting is to restore lncRNA levels with synthetic RNA molecules, which is aimed to cancers with downregulated lncRNAs. However, for now this strategy cannot be well applied, due to limitations in the lengths of lncRNAs. In this study, we explored the functional fragment of an lncRNA and synthesized a durable PHACTR2-AS1-30nt-RNA molecule. Synthetic PHACTR2-AS1-30nt-RNA molecules formed a hairpin structure and mimicked the full-length lncRNA by inhibiting tumor growth and lung metastasis, providing insight into the potential of PHACTR2-AS1 as a therapeutic target in breast cancer.

No potential conflicts of interest were disclosed.

Conception and design: W. Chu, Y. Yu, H. Zhang

Development of methodology: W. Chu, X. Zhang, L. Qi, Y. Fu, P. Wang, W. Zhao, J. Zhang, J. Zhan, Y. Wang, Y. Yu

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): W. Chu, X. Zhang, L. Qi, Y. Fu, P. Wang, W. Zhao, J. Du, J. Zhang

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): W. Chu, X. Zhang, Y. Fu, P. Wang, J. Du, J. Zhan, Y. Wang, W.-G. Zhu, Y. Yu

Writing, review, and/or revision of the manuscript: W.-G. Zhu, Y. Yu, H. Zhang

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): W. Chu, L. Qi, W. Zhao, J. Du, J. Zhang, J. Zhan, Y. Wang, W.-G. Zhu, Y. Yu, H. Zhang

Study supervision: Y. Yu, H. Zhang

This work was supported by grants from Ministry of Science and Technology of the People's Republic of China 2016YFC1302103 (to H. Zhang); National Natural Science Foundation of China 81572839 (to Y. Yu), 81621063, 81730071, 81972616 (to H. Zhang); Natural Science Foundation of Beijing Municipality 7192092 (to Y. Yu), 7171005 (to H. Zhang), and BMU 2018JC004 (to H. Zhang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Fatica
A
,
Tollervey
D
. 
Making ribosomes
.
Curr Opin Cell Biol
2002
;
14
:
313
8
.
2.
Santoro
R
,
Li
J
,
Grummt
I
. 
The nucleolar remodeling complex NoRC mediates heterochromatin formation and silencing of ribosomal gene transcription
.
Nat Genet
2002
;
32
:
393
6
.
3.
Peng
JC
,
Karpen
GH
. 
H3K9 methylation and RNA interference regulate nucleolar organization and repeated DNA stability
.
Nat Cell Biol
2007
;
9
:
25
35
.
4.
Grummt
I
,
Langst
G
. 
Epigenetic control of RNA polymerase I transcription in mammalian cells
.
Biochim Biophys Acta
2013
;
1829
:
393
404
.
5.
McStay
B
,
Grummt
I
. 
The epigenetics of rRNA genes: from molecular to chromosome biology
.
Annu Rev Cell Dev Biol
2008
;
24
:
131
57
.
6.
Nguyen le
XT
,
Raval
A
,
Garcia
JS
,
Mitchell
BS
. 
Regulation of ribosomal gene expression in cancer
.
J Cell Physiol
2015
;
230
:
1181
8
.
7.
Dai
MS
,
Lu
H
. 
Crosstalk between c-Myc and ribosome in ribosomal biogenesis and cancer
.
J Cell Biochem
2008
;
105
:
670
7
.
8.
Bywater
MJ
,
Poortinga
G
,
Sanij
E
,
Hein
N
,
Peck
A
,
Cullinane
C
, et al
Inhibition of RNA polymerase I as a therapeutic strategy to promote cancer-specific activation of p53
.
Cancer Cell
2012
;
22
:
51
65
.
9.
Xing
YH
,
Yao
RW
,
Zhang
Y
,
Guo
CJ
,
Jiang
S
,
Xu
G
, et al
SLERT regulates DDX21 rings associated with Pol I transcription
.
Cell
2017
;
169
:
664
78
.
10.
Fatica
A
,
Bozzoni
I
. 
Long non-coding RNAs: new players in cell differentiation and development
.
Nat Rev Genet
2014
;
15
:
7
21
.
11.
Ponting
CP
,
Oliver
PL
,
Reik
W
. 
Evolution and functions of long noncoding RNAs
.
Cell
2009
;
136
:
629
41
.
12.
Yang
L
,
Lin
C
,
Jin
C
,
Yang
JC
,
Tanasa
B
,
Li
W
, et al
lncRNA-dependent mechanisms of androgen-receptor-regulated gene activation programs
.
Nature
2013
;
500
:
598
602
.
13.
Gupta
RA
,
Shah
N
,
Wang
KC
,
Kim
J
,
Horlings
HM
,
Wong
DJ
, et al
Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis
.
Nature
2010
;
464
:
1071
6
.
14.
Zhu
P
,
Wang
Y
,
Wu
J
,
Huang
G
,
Liu
B
,
Ye
B
, et al
LncBRM initiates YAP1 signalling activation to drive self-renewal of liver cancer stem cells
.
Nat Commun
2016
;
7
:
13608
.
15.
Batista
PJ
,
Chang
HY
. 
Long noncoding RNAs: cellular address codes in development and disease
.
Cell
2013
;
152
:
1298
307
.
16.
Davidovich
C
,
Cech
TR
. 
The recruitment of chromatin modifiers by long noncoding RNAs: lessons from PRC2
.
RNA
2015
;
21
:
2007
22
.
17.
Johnson
WL
,
Yewdell
WT
,
Bell
JC
,
McNulty
SM
,
Duda
Z
,
O'Neill
RJ
, et al
RNA-dependent stabilization of SUV39H1 at constitutive heterochromatin
.
eLife
2017
;
6
::
e25299
.
18.
Porro
A
,
Feuerhahn
S
,
Delafontaine
J
,
Riethman
H
,
Rougemont
J
,
Lingner
J
. 
Functional characterization of the TERRA transcriptome at damaged telomeres
.
Nat Commun
2014
;
5
:
5379
.
19.
Liu
X
,
Li
D
,
Zhang
W
,
Guo
M
,
Zhan
Q
. 
Long non-coding RNA gadd7 interacts with TDP-43 and regulates Cdk6 mRNA decay
.
EMBO J
2012
;
31
:
4415
27
.
20.
Yu
Y
,
Wu
J
,
Wang
Y
,
Zhao
T
,
Ma
B
,
Liu
Y
, et al
Kindlin 2 forms a transcriptional complex with beta-catenin and TCF4 to enhance Wnt signalling
.
EMBO Rep
2012
;
13
:
750
8
.
21.
Wu
SC
,
Kallin
EM
,
Zhang
Y
. 
Role of H3K27 methylation in the regulation of lncRNA expression
.
Cell Res
2010
;
20
:
1109
16
.
22.
Yamaguchi
H
,
Hung
MC
. 
Regulation and role of EZH2 in cancer
.
Cancer Res Treat
2014
;
46
:
209
22
.
23.
Yang
Y
,
Zhou
L
,
Lu
L
,
Wang
L
,
Li
X
,
Jiang
P
, et al
A novel miR-193a-5p-YY1-APC regulatory axis in human endometrioid endometrial adenocarcinoma
.
Oncogene
2013
;
32
:
3432
42
.
24.
Jenuwein
T
,
Allis
CD
. 
Translating the histone code
.
Science
2001
;
293
:
1074
80
.
25.
Peters
AH
,
Kubicek
S
,
Mechtler
K
,
O'Sullivan
RJ
,
Derijck
AA
,
Perez-Burgos
L
, et al
Partitioning and plasticity of repressive histone methylation states in mammalian chromatin
.
Mol Cell
2003
;
12
:
1577
89
.
26.
Gruber
AR
,
Lorenz
R
,
Bernhart
SH
,
Neubock
R
,
Hofacker
IL
. 
The Vienna RNA websuite
.
Nucleic Acids Res
2008
;
36
:
W70
4
.
27.
Bonner
WM
,
Redon
CE
,
Dickey
JS
,
Nakamura
AJ
,
Sedelnikova
OA
,
Solier
S
, et al
GammaH2AX and cancer
.
Nat Rev Cancer
2008
;
8
:
957
67
.
28.
Hanahan
D
,
Weinberg
RA
. 
Hallmarks of cancer: the next generation
.
Cell
2011
;
144
:
646
74
.
29.
Srivastava
R
,
Srivastava
R
,
Ahn
SH
. 
The epigenetic pathways to ribosomal DNA silencing
.
Microbiol Mol Biol Rev
2016
;
80
:
545
63
.
30.
Santoro
R
,
Grummt
I
. 
Epigenetic mechanism of rRNA gene silencing: temporal order of NoRC-mediated histone modification, chromatin remodeling, and DNA methylation
.
Mol Cell Biol
2005
;
25
:
2539
46
.
31.
Murayama
A
,
Ohmori
K
,
Fujimura
A
,
Minami
H
,
Yasuzawa-Tanaka
K
,
Kuroda
T
, et al
Epigenetic control of rDNA loci in response to intracellular energy status
.
Cell
2008
;
133
:
627
39
.
32.
Kleer
CG
,
Cao
Q
,
Varambally
S
,
Shen
R
,
Ota
I
,
Tomlins
SA
, et al
EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells
.
PNAS
2003
;
100
:
11606
11
.
33.
Pelletier
J
,
Thomas
G
,
Volarevic
S
. 
Ribosome biogenesis in cancer: new players and therapeutic avenues
.
Nat Rev Cancer
2018
;
18
:
51
63
.
34.
Truitt
ML
,
Ruggero
D
. 
New frontiers in translational control of the cancer genome
.
Nat Rev Cancer
2016
;
16
:
288
304
.
35.
Xu
B
,
Li
H
,
Perry
JM
,
Singh
VP
,
Unruh
J
,
Yu
Z
, et al
Ribosomal DNA copy number loss and sequence variation in cancer
.
PLoS Genet
2017
;
13
:
e1006771
.
36.
Lindstrom
MS
,
Jurada
D
,
Bursac
S
,
Orsolic
I
,
Bartek
J
,
Volarevic
S
. 
Nucleolus as an emerging hub in maintenance of genome stability and cancer pathogenesis
.
Oncogene
2018
;
37
:
2351
66
.
37.
Guetg
C
,
Lienemann
P
,
Sirri
V
,
Grummt
I
,
Hernandez-Verdun
D
,
Hottiger
MO
, et al
The NoRC complex mediates the heterochromatin formation and stability of silent rRNA genes and centromeric repeats
.
EMBO J
2010
;
29
:
2135
46
.
38.
Chen
Z
,
Yu
W
,
Zhou
Q
,
Zhang
J
,
Jiang
H
,
Hao
D
, et al
A novel lncRNA IHS promotes tumor proliferation and metastasis in HCC by regulating the ERK- and AKT/GSK-3beta-signaling pathways
.
Mol Ther Nucleic Acids
2019
;
16
:
707
20
.
39.
Chen
Z
,
Zhou
ZY
,
He
CC
,
Zhang
JL
,
Wang
J
,
Xiao
ZY
. 
Down-regulation of LncRNA NR027113 inhibits cell proliferation and metastasis via PTEN/PI3K/AKT signaling pathway in hepatocellular carcinoma
.
Eur Rev Med Pharmacol Sci
2018
;
22
:
7222
32
.
40.
Bywater
MJ
,
Pearson
RB
,
McArthur
GA
,
Hannan
RD
. 
Dysregulation of the basal RNA polymerase transcription apparatus in cancer
.
Nat Rev Cancer
2013
;
13
:
299
314
.
41.
Drygin
D
,
Lin
A
,
Bliesath
J
,
Ho
CB
,
O'Brien
SE
,
Proffitt
C
, et al
Targeting RNA polymerase I with an oral small molecule CX-5461 inhibits ribosomal RNA synthesis and solid tumor growth
.
Cancer Res
2011
;
71
:
1418
30
.
42.
Prakash
V
,
Carson
BB
,
Feenstra
JM
,
Dass
RA
,
Sekyrova
P
,
Hoshino
A
, et al
Ribosome biogenesis during cell cycle arrest fuels EMT in development and disease
.
Nat Commun
2019
;
10
:
2110
.
43.
Ling
H
,
Fabbri
M
,
Calin
GA
. 
MicroRNAs and other non-coding RNAs as targets for anticancer drug development
.
Nat Rev Drug Discov
2013
;
12
:
847
65
.
44.
Gutschner
T
,
Hammerle
M
,
Eissmann
M
,
Hsu
J
,
Kim
Y
,
Hung
G
, et al
The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells
.
Cancer Res
2013
;
73
:
1180
9
.
45.
Xing
Z
,
Lin
A
,
Li
C
,
Liang
K
,
Wang
S
,
Liu
Y
, et al
lncRNA directs cooperative epigenetic regulation downstream of chemokine signals
.
Cell
2014
;
159
:
1110
25
.