Multiple myeloma is an incurable refractory hematologic malignancy arising from plasma cells in the bone marrow. Here we investigated miR-26a function in multiple myeloma and tested single-wall carbon nanotube delivery of miR-26a in vitro and in vivo. miR-26a was downregulated in patients with multiple myeloma cells compared with plasma cells from healthy donors. miR-26a overexpression inhibited proliferation and migration and induced apoptosis in multiple myeloma cell lines. To identify the targets of miR-26a, RPMI8226-V-miR-26-GFP and RPMI8226-V-GFP cells were cultured using stable isotope labeling by amino acids in cell culture (SILAC) medium, followed by mass spectrometry analysis. In multiple myeloma cells overexpressing miR-26a, CD38 protein was downregulated and subsequently confirmed to be a direct target of miR-26a. Depletion of CD38 in multiple myeloma cells duplicated the multiple myeloma inhibition observed with exogenous expression of miR-26a, whereas restoration of CD38 overcame the inhibition of miR-26a in multiple myeloma cells. In a human multiple myeloma xenograft mouse model, overexpression of miR-26a inhibited CD38 expression, provoked cell apoptosis, and inhibited cell proliferation. Daratumumab is the first CD38 antibody drug for monotherapy and combination therapy for patients with multiple myeloma, but eventually resistance develops. In multiple myeloma cells, CD38 remained at low level during daratumumab treatment, but a high-quality response is sustained. In daratumumab-resistant multiple myeloma cells, CD38 expression was completely restored but failed to correlate with daratumumab-induced cell death. Therefore, a therapeutic strategy to confer selection pressure to maintain low CD38 expression in multiple myeloma cells may have clinical benefit.

Significance:

These results highlight the tumor suppressor function of miR-26a via its targeting of CD38 and suggest the therapeutic potential of miR-26a in patients with multiple myeloma.

Multiple myeloma, a cancer of terminally differentiated postgerminal center B cells or plasma cells, is the second most frequently diagnosed hematologic cancer in the United States (1). Despite recent advances in treatment, including proteasome inhibitors, immunomodulatory drugs, and CD38 mAb therapies, patient survival has increased by only about 1.5 years, from 3.5 to 5.5 years; further, it remains incurable due to frequent relapse and emergence of drug resistance. Fully understanding the mechanisms of multiple myeloma development, progression, and drug resistance are essential to developing new treatments that will improve patient outcome.

The miRNAs are short noncoding RNAs that suppress the expression of protein-coding genes by partial complementary binding, particularly to the 3′-untranslated regions of mRNAs. Disturbance of miRNA expression is involved in the tumorigenesis and metastasis of human cancers (2, 3), including multiple myeloma (4, 5). Studies of the patient with multiple myeloma miRNA signature have consistently shown that several miRNAs are commonly upregulated in multiple myeloma, such as miR-21, miR-221/222, and miR-181a/b, but that others are downregulated, such as miR-30s and miR-15/16 (6–8). Functionally, miR-21 has been reported to promote proliferation by inhibiting PTEN (9), and miR-30s represses multiple myeloma growth via inhibiting Wnt/BCL9 (10). In addition, miRNAs can be therapeutic targets for multiple myeloma—for instance, inhibitors of miR-34a and miR-21 reduced multiple myeloma proliferation in vitro and in vivo (10–12).

The human miR-26 family is composed of three members, miR-26a-1, miR-26a-2, and miR-26b, which are located on chromosomes 3, 12, and 2, respectively. miR-26a-1 and miR-26a-2 have identical sequences, which differ by two nucleotides from miR-26b. miR-26a is usually dysregulated in cancer: it induces cell-cycle arrest through downregulating CCND2 and CCNE2 in hepatocellular cancer (13); functions as a tumor suppressor in breast carcinogenesis by repressing MTDH and EZH2 (14); and in leukemia, inhibits proliferation, migration, invasion, angiogenesis, and metabolism through targeting EZH2, CDK6, and Mcl1 (15, 16). miR-26a delivered via adeno-associated virus suppresses proliferation and promotes apoptosis in xenograft mouse models, suggesting its potential clinical use (13).

In this study, we first investigated the function of miR-26a in cell proliferation and apoptosis in multiple myeloma and identified CD38 as its direct target in vitro and in vivo. Furthermore by knocking down and then restoring CD38 expression, we verified that miR-26a performed its function directly by targeting CD38 and observed a synergistic effect between miR-26a and bortezomib or melphalan treatments, providing proof-of-concept support for systemic delivery of miR-26a as a specific anti-multiple myeloma treatment.

miR-26 expression profiling data analysis

We downloaded the GSE16558 dataset (17), and normalized expression levels of miR-26a and miR-26b to the mean Ct value of RNU44 and RNU48, which are consistently expressed across the dataset. Relative quantification of miR-26 expression was calculated with the 2−ΔΔCt method, where ΔCt = Ct(miR-26)Ct((RNU44+RNU48)/2) and ΔΔCt = ΔCt(MM) − ΔCt(average normal PC) (18).

Patient tissue preparation and cell line culture

Bone marrow, lymph node, and peripheral blood specimens were obtained from healthy donors and from patients with multiple myeloma and chronic lymphocytic leukemia (CLL) in accordance with Cleveland Clinic Foundation Institutional Review Board approval, and written informed consent was obtained in compliance with the Declaration of Helsinki. Normal plasma cells were purified using CD138 magnetic beads (Miltenyi Biotec) as described previously (19). The multiple myeloma cell lines H929, MM.1S, RPMI8226, U266, and the 293T cell line were purchased from ATCC. OPM1, OPM2, and KMS26 were kindly provided by Dr. Teru Hideshima at the Dana-Farber Cancer Institute (Boston, MA). All cell lines were routinely genotyped using the Human Cell Line Genotyping System (Promega) and Mycoplasma tested. Myeloma cells were cultured in RPMI1640 medium, and the 293T cells were cultured in DMEM medium, supplemented with 10% FBS in 5% CO2 in a humidified incubator at 37°C.

Primary human B-cell purification and in vitro differentiation assay

Peripheral blood mononuclear cells were isolated from healthy volunteers, and the naïve B cells were purified by negative selection using magnetic cell separation by using the Naive B Cell Isolation Kit II (Miltenyi Biotec) with anti-CD10 antibodies (Miltenyi Biotec). The purity of the isolated CD19+ CD27 naïve B-cell population was routinely >95%. The cells were labeled with 1 μmol/L CFSE (Invitrogen) in serum-free medium at 37°C for 10 minutes and washed in complete medium so as to monitor cellular division. Purified naive B cells were cultured at 7.5 × 105 cells/mL in 24-well plates and stimulated during 4 days with 2.6 μg/mL F(ab')2 fragment goat anti-human IgA+IgG+IgM (H+L; Jackson ImmunoResearch Laboratories), 100 ng/mL recombinant human soluble CD40L (Millipore), 1.0 mg/mL CpG oligodeoxynucleotide 2006 (Invivogen), and 50 U/mL recombinant IL2 (R&D Systems). Day 4-activated B cells were washed and cultured at 4 × 105 cells/mL for up to 3 days with 50 U/mL IL2, 50 ng/mL IL6, 50 ng/mL IL10, and 2 ng/mL IL12 (R&D Systems). At day 7 of culture, cells were washed and cultured with 50 ng/mL IL6, 10 ng/mL IL15 and 500 U/mL IFNα for 3 days. The cells were subjected to flow cytometry to analyze cell surface CD38, CD138. qRT-PCR was used to examine the expression of BLIMP1 mRNA and miR-26a.

Lentivirus packaging, infection, and transient transfection

Lentivirus packaging and infection of multiple myeloma cells were performed using pPACKH1 HIV Lentivector Packaging Kit according to the manufacturer's protocol (System Biosciences). miR-26a overexpression or control plasmid (System Biosciences) was transfected with packaging plasmids into 293T cells using Lipofectamine 2000 (Thermo Fisher Scientific), which were labeled as V-miR-26a-GFP and V-GFP, respectively. Lentiviral particles were then collected from the culture supernatant at 48 hours intervals and filtered with 0.22 μm filters. To obtain stable cell lines overexpressing miR-26a, multiple myeloma cells were infected with recombinant lentivirus in the presence of polybrene overnight; GFP-positive cells were sorted by flow cytometry 4 days after infection. The expression levels of miR-26a in stable clones and transiently transduced cells were verified with real-time reverse transcriptase quantitative PCR (qRT-PCR). CD38 was knocked down using specific siRNA (Santa Cruz Biotechnology), and protein levels were detected by Western blot analysis.

To obtain CD38 overexpression vector, full length of CD38 ORF was cloned into pCDH-MSCV-MCS-EF1-copGFP-T2A-Puro plasmid (System Biosciences) between XbaI and NotI sites. Primer sequences were:

CD38-Xba-F: TTATCTAGATGGCCAACTGCGAGTTCAGCC

CD38-Not-R: ATAAGAATGCGGCCGCTCAGAGTCTCAGATGTGCAAATGAATCCTC

qRT-PCR

qRT-PCR analysis was used to determine the relative expression levels of miR-26a and its downstream mRNAs. Total RNA was extracted from cultured cells or healthy donor samples using TRIzol (Thermo Fisher Scientific) according to the manufacturer's instructions. For miRNA analysis, cDNA was synthesized using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) and then amplified with TaqMan Universal PCR Master Mix (Thermo Fisher Scientific) together with miR-26a-5p primer (Thermo Fisher Scientific). RNU44 was used as internal control for miR-26a expression. For CD38 and Blimp1 mRNA quantification, cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) and then amplified using SYBR Green PCR Master Mix (Thermo Fisher Scientific) with gene-specific primers. GAPDH was used as the internal control. Gene relative expression was calculated with the 2−ΔΔCt method. Primer sequences were:

CD38-F, CTCAATGGATCCCGCAGTAAA

CD38-R, ATGTATCACCCAGGCCTCTA

Blimp1-F, TGTGGTATTGTCGGGACTTTG

Blimp1-R, TCAGTGCTCGGTTGCTTTAG

GAPDH-F, GGTGTGAACCATGAGAAGTATGA

GAPDH-R, GAGTCCTTCCACGATACCAAAG

In situ hybridization

Slides were deparaffinized and rehydrated through immersion in xylene and an ethanol gradient and then digested with 20 μg/mL proteinase K in prewarmed 50 mmol/L Tris for 20 minutes at 37°C. After fixation in 4% paraformaldehyde for 5 minutes at room temperature, slides were dehydrated by immersion in an ethanol gradient and air drying; slides were prehybridized using DIG Easy Hyb (Roche) at 50°C for 1 hour. The 10 pmol digoxin-labeled miR-26a locked nucleic acid (LNA) probe (5′-AGCCTATCCTGGATTACTTGAA-3′) was denatured in hybridization buffer at 95°C for 2 minutes and then chilled on ice. The probe was diluted in 250 μL prewarmed hybridization buffer. Each sample was covered with 50 to 100 μL diluted probe and incubated in a humidified hybridization chamber at 50°C overnight. Slides were washed twice in 50% formamide in 4 × SSC at 37°C for 30 minutes, and then washed three times in 2 × SSC at 37°C for 15 minutes. After washing twice with maleic acid buffer containing Tween-20 (MABT), slides were blocked using blocking buffer (Roche) at room temperature for 30 minutes, the blocking buffer was drained off, and the samples were incubated with 1:250 diluted anti-digoxigenin-AP fab fragments (Roche) at 37°C for 1 hour. After washing twice in MABT and once in detection solution (0.1M Tris-HCl, 0.1M NaCl, pH 9.5), the slides were stained with freshly diluted NBT/BCIP detection solution (Roche) and incubated at 37°C for 30 minutes. Slides were washed in PBS twice, air dried for 30 minutes, and then mounted with Eukitt quick-hardening mounting medium (Sigma Aldrich). Images were obtained under phase-contrast microscopy (Leica DM2000 LED) and a digital camera (Leica DMC 2900).

IHC

Formalin-fixed paraffin-embedded sections were deparaffinized and then incubated with rabbit anti-CD38 polyclonal antibody (Cell Signaling Technology, #14637S) or rabbit anti-Ki-67 polyclonal antibody (Cell Signaling Technology, #9027S) or rabbit anti-cleaved caspase-3 mAb (Cell Signaling Technology, #9664S) at 4°C overnight. After incubation with horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody, signal was detected using a DAB Substrate Kit (Abcam, ab64238) following the manufacturer's instructions. Images were obtained using phase contrast microscopy (Leica DM2000 LED) and a digital camera (Leica DMC 2900).

Cell viability assay

To determine the effect of miR-26a on multiple myeloma proliferation, 5 × 103 V-miR-26a-GFP/V-GFP-infected RPMI8226, MM.1S, and H929 cells were seeded in 96-well plates and incubated with bortezomib in DMSO (0, 4, or 8 nmol/L for RPMI8226; and 0, 2, or 4 nmol/L for MM.1S and H929), or melphalan in DMSO (0, 10 or 20 μmol/L). Cell viability was evaluated at 24 hours intervals using the CellTiter-GloLuminescent Cell Viability Assay Kit (Promega) according to the manufacturer's protocol. All treatments and measurements were performed in three independent experiments with four replicates of each cell line.

Cell apoptosis analysis

RPMI8226, MM.1S, and H929 cells infected with V-miR-26a-GFP/V-GFP cells were cultured in six-well plates (5 × 105 cells/well); in experiments to test for synergy, cells were also exposed to bortezomib or melphalan for 48 hours. To quantify apoptosis, cells were washed with PBS and stained with Annexin V–APC and propidium iodide (Biolegend). Stained cells were analyzed by flow cytometry (BD FACSCalibur), 10,000 cells were recorded, and the data were statistically evaluated using FlowJo software OSX 10.6 (TreeStar). Some cells were harvested for Western blot analysis to detect expression of cleaved PARP1 and caspase-3 (c-PARP1 and c-caspase-3).

For CD38 knockdown experiments, RPMI8226, MM.1S, and H929 cells were transfected with 50 nmol/L CD38 siRNA or control siRNA (Santa Cruz Biotechnology) for 5 days. Cells were stained with Annexin V–FITC and propidium iodide (Biolegend) and then subjected to flow cytometry (BD FACSCalibur) to analyze cell apoptosis.

Transwell cell migration assay

For migration studies, a transwell assay was conducted in 24-well plates with 8-μm pore inserts (Corning). The bottom chambers were filled with culture medium containing 10% serum. Then 3 × 104 RMPI8226-V-miR-26a-GFP/V-GFP, MM.1S-V-miR-26a-GFP/V-GFP, or H929-V-miR-26a-GFP/V-GFP cells were plated onto the upper chambers with serum-free medium. Monitoring of migration was initiated immediately using an IncuCyte ZOOM system (Essen Bioscience); the bottom transwell chambers were imaged every 2 hours for a total of 9 hours. The scanned images were analyzed using Essenbio software (version 2016B).

Western blot analysis

Total protein samples were isolated with RIPA buffer, separated on 4% to 12% Bis-Tris polyacrylamide gels (Thermo Fisher Scientific), and electroblotted onto nitrocellulose membranes. Membranes were blocked with 5% nonfat milk and incubated overnight with rabbit anti-PARP1 antibody (9532S; Cell Signaling Technology), rabbit anti-caspase-3 antibody (9662; Cell Signaling Technology), rabbit anti-CD38 antibody (14637; Cell Signaling Technology), or actin-HRP (sc-1615; Santa Cruz Biotechnology), as appropriate. Then, membranes were washed and incubated with HRP-linked anti-rabbit IgG secondary antibody (7074; Cell Signaling Technology) or HRP-linked anti-mouse IgG secondary antibody (7076S; Cell Signaling Technology).

Stable isotope labeling with amino acids in cell culture

Stable isotope labeling with amino acids in cell culture (SILAC) experiments were performed using the Pierce SILAC Protein Quantitation Kit (Thermo Fisher Scientific). Briefly, RPMI8226-V-miR-26a-GFP cells were cultured in heavy SILAC medium (100 mg/L 13C6l-lysine-HCl and 100 mg/L l-arginine-HCl), whereas the RPMI8226-V-GFP cells were cultured in light medium (100 mg/L l-lysine-HCl and 100 mg/L l-arginine-HCl). After 6 doublings, cells were lysed with RIPA buffer. After incorporation efficiency was confirmed by mass spectrometry, 20 μg protein from each cell lysate was mixed in a 1:1 (heavy:light) ratio, electrophoresed on 4% to 12% Bis-Tris polyacrylamide gels, and stained with Coomassie Brilliant Blue for band visualization. Protein bands were cut out and digested with trypsin, followed by liquid chromatography–mass spectrometry (LC-MS) analysis performed in the Proteomics and Metabolomics Core at the Cleveland Clinic Lerner Research Institute. Proteins were identified if their detection probability was greater than 99.9% and at least 2 specific peptides for 1 protein could be identified.

3′-UTR luciferase reporter assays

To construct the CD38 reporter vector, a 25-bp segment of the CD38 mRNA 3′UTR that contained the predicted miR-26a binding site was cloned into pmirGLO vector after the firefly luciferase coding sequence. For the dual luciferase assay, the CD38 reporter was transiently transfected into HEK293T cells with miR-26a overexpression (pCDH-CMV-MCS-EF1-copGFP-miR26a) or knockdown vector (pmiRZIP-26a). The cells were lysed, and luciferase activity was detected 48 hours after transfection. Results are presented as mean ± SD of three independent experiments.

Multiple myeloma mouse xenograft model

A total of 5 × 106 RMPI8226-V-26a-GFP/V-GFP or MM.1S-V-26a-GFP/V-GFP cells in 100 μL PBS together with an equal volume of Matrigel basement membrane matrix (BD Biosciences) was subcutaneously injected into the shoulder of Fox Chase SCID beige mice (strain code: 250; Charles River) to establish a human multiple myeloma xenograft model. The two orthogonal diameters (x and y) of tumors were monitored once a week, and xenograft volume was calculated as V = xy2/2. Mice were sacrificed at 28 days postinjection. RNA was isolated from xenograft determine miR-26a level, protein was extracted for CD38 expression, and remaining tissue was paraffin-embedded for IHC analysis (Ki-67 and c-caspase-3).

Functionalization of purified single-wall carbon nanotubes

The 6,5-enriched single-wall carbon nanotubes [(6,5) SWCNT] were purified by a polymer aqueous two-phase separation method using the DNA sequence: T(TA)2T4(AT)2T (20). The (6,5) SWCNTs were mixed with 10 mg PL-PEG2000-NH2 (Avanti Polar Lipids, 880128P) in 5 mL double-distilled water in a glass scintillation vial. The vial was sonicated in a bath sonicator (97043-992, VWR) for 1 hour at room temperature with water changes every 20 minutes to avoid overheating. The SWCNT suspension was centrifuged at 24,000 × g for 6 hours at room temperature, and the supernatant was collected. The SWCNT supernatant, 1 mL, was washed five times, by adding 1 mL SWCNT supernatant to a 4 mL centrifugal filter (Amicon; Millipore Sigma, UFC910008) and 3 mL double-distilled water, and centrifuging for 10 minutes, 4,000 × g, room temperature. After the final wash, the SWCNT concentration was measured using a UV/VIS spectrometer (Thermo Fisher Scientific, accuSkan GO UV/Vis Microplate Spectrophotometer) with an extinction coefficient of 0.0465 L/mg/cm at 808 nm. The SWCNT concentration was adjusted to approximately 50 mg/L by adding the required amount of double distilled water.

Conjugation of miR-26a to SWCNTs through cleavable disulfide bond

Functionalized SWCNTs, 500 μL, were mixed with 0.5 mg of Sulfo-LC-SPDP (c1118; ProteoChem). Fifty microliters of 10× PBS was added and incubated for 2 hours at room temperature. After incubation, the SWCNT solution was washed five to six times using a centrifugal filter (Amicon) by adding 3 to 4 mL DNase/RNase-free water and centrifuging for 6 to 8 minutes at 10,000 × g each time. Fifteen microliters of miR-26a (100 μmol/L) was mixed with 1.5 μL DTT solution (Sigma, #43815), incubated for 1.5 hours at room temperature, and then DTT-treated miR-26a was purified using a NAP-5 column (GE Healthcare, 17-0853-01) following the manufacturer's protocol. Five hundred microliters of miR-26a was eluted and collected from the column with DNase/RNase free 1× PBS. The activated SWCNTs were suspended with the 500 μL purified miR-26a solution, and the conjugation was allowed to proceed for 24 hours at 4°C.

Delivery of SWCNT-miR-26a to disseminated multiple myeloma mouse model

A murine disseminated model of human multiple myeloma cells were established in 8-week-old female NOD.CB17-Prkdcscid/J mice (Charles River). All mice were irradiated and then intravenously injected with 5 × 106 MM.1S-Luc-GFP cells and were randomized to separate to control and treatment groups. Mice were subsequently injected with 100 μL (40 mg/mL) SWCNT-miR-26a or SWCNT-ctrl, or bortezomib (0.5 mg/kg) plus SWCNT-ctrl, or bortezomib (0.5 mg/kg) plus SWCNT-miR-26a once a week through the tail veins in a masked fashion, then observed daily and sacrificed once mice developed hind limb paralysis (endpoint). Images were acquired using an in vivo imaging system (IVIS; PerkinElmer). Hind limb paralysis was used as the end point in this disseminated disease model. All experiments involving animals were preapproved by the Cleveland Clinic Institutional Animal Care and Use Committee.

Statistical analyses

Statistical analysis was performed using SPSS (version 17.0). Comparisons between two independent groups were performed using a two-tailed Student t test. In our mouse model, time to our endpoint of hind limb paralysis was measured using the Kaplan–Meier method, with Cox proportional hazard regression analysis for group comparisons. P ≤ 0.05 was considered as statistically significant. Correlation analysis was performed using the Pearson correlation test; R2 > 0.3 was considered as positive. Isobologram analysis was performed using the CompuSyn software program (ComboSyn, Inc.). A combination index (CI) less than 1.0 indicates synergism, and a CI of 1 indicates additive activity (21, 22).

miR-26a inhibited cell proliferation and migration and induced apoptosis in multiple myeloma

Analysis of the GSE16558 dataset (60 patients with multiple myeloma and five healthy donors; ref. 17) revealed that miR-26a, but not miR-26b, expression was significantly downregulated in patients with multiple myeloma compared with healthy donors (Fig. 1A). We confirmed this result in CD138+ plasma cells from the healthy donors and multiple myeloma cell lines (Fig. 1B). As posttranscriptional regulators, miRNAs may inhibit protein expression without influencing mRNA level (23, 24). Thus, to identify the downstream targets of miR-26a in multiple myeloma, we performed SILAC combined with LC/MS instead of mRNA microarray analysis to uncover all proteins regulated by miR-26a. RPMI8226-V-miR-26a-GFP and RPMI8226-V-GFP cells were cultured in heavy or light medium separately using SILAC, followed by protein separation and MS-LC. A total of 2,724 unique proteins were recognized, of which, 180 were upregulated (68 proteins) or downregulated (112 proteins; Supplementary Table S1). Because miRNAs are negative regulators of gene expression, we further screened the 112 downregulated proteins using web-based query tools (TargetScan Release 7.1 and miRBase), and identified CD38 (H/L = 0.49; P = 0.02) as potential target of miR-26a (Fig. 1C).

Figure 1.

miR-26a was downregulated in multiple myeloma and targeted CD38 in multiple myeloma. A, Analysis of the GSE16558 dataset showed that miR-26a was downregulated in patients with multiple myeloma (n = 60) compared with healthy donors (HD, n = 5; left, P = 0.04), whereas miR-26b was not (right, P = 0.12). B, Expression of miR-26a in seven multiple myeloma cell lines was determined by qRT-PCR; plasma cells from four healthy donors were used as control. C, Histogram analysis of protein expression ratios for all 2,724 proteins identified and quantified after RPMI8226 cells were transduced with V-miR-26a-GFP/V-GFP, cultured using SILAC, and analyzed by LC/MS. Proteins were binned into groups based on ln value (heavy/light ratio).

Figure 1.

miR-26a was downregulated in multiple myeloma and targeted CD38 in multiple myeloma. A, Analysis of the GSE16558 dataset showed that miR-26a was downregulated in patients with multiple myeloma (n = 60) compared with healthy donors (HD, n = 5; left, P = 0.04), whereas miR-26b was not (right, P = 0.12). B, Expression of miR-26a in seven multiple myeloma cell lines was determined by qRT-PCR; plasma cells from four healthy donors were used as control. C, Histogram analysis of protein expression ratios for all 2,724 proteins identified and quantified after RPMI8226 cells were transduced with V-miR-26a-GFP/V-GFP, cultured using SILAC, and analyzed by LC/MS. Proteins were binned into groups based on ln value (heavy/light ratio).

Close modal

To investigate the function of miR-26a in multiple myeloma, we overexpressed miR-26a in RPMI8226 (Fig. 2A), MM.1S (Fig. 2B), and H929 (Fig. 2C) cells by infecting them with V-miR-26a-GFP/V-GFP. The overexpression of miR-26a was confirmed by qRT-PCR. To determine the influence of miR-26a on cell growth, proliferation was assessed in these stable cell lines. Results showed that overexpressed miR-26a slowed proliferation significantly. To assess the effect of miR-26a on migration, a transwell migration assay was performed using the IncuCyte live cell analysis system, which showed that multiple myeloma migration was inhibited by overexpressed miR-26a in both RPMI8226 (Fig. 2A), MM.1S (Fig. 2B), and H929 (Fig. 2C) lines. To uncover the apoptotic status of cells with miR-26a overexpression, we performed Western blots for PARP1/c-PARP1 and caspase-3/c-caspase-3, two proteins that reflect apoptotic status, and found miR-26a induced greater expression of c-PARP1 and c-caspase-3 in RPMI8226, MM.1S, and H929 cells (Fig. 2AC). Furthermore, a reporter assay demonstrated that miR-26a directly regulated expression of CD38 mRNA through binding to its 3′UTR (Fig. 2D). In addition, overexpressed miR-26a inhibited CD38 protein expression in RPMI8226, MM.1S, and H929 cells (Fig. 2D).

Figure 2.

Overexpressed miR-26a suppressed proliferation and migration and induced apoptosis in multiple myeloma cell lines. A–C, The expression of miR-26a in RPMI8226 (A), MM.1S (B), and H929 (C) cells stably transduced with V-miR-26a-GFP or V-GFP was determined by qRT-PCR; RNU44 was the internal control. The effect of miR-26a on multiple myeloma cell proliferation and migration was investigated. Expression of PARP1, c-PARP1, caspase-3, and c-caspase-3 in RPMI8226 and MM.1S cells transduced with V-miR-26a-GFP or V-GFP was determined by Western blot analysis. D, Predicted miR-26a target sequence on the 3′UTR of CD38. To interrupt the binding between the 3′UTR of CD38 and seed sequence of miR-26a, four nucleotides on the predicted region of the CD38 3′UTR were changed to the complementary sequence. A luciferase reporter assay was performed in HEK293T cells transduced with V-miR-26a-GFP or V-GFP. Expression of CD38 in RPMI8226, MM.1S, and H929 cells infected with V-miR-26a-GFP or V-GFP, as determined by Western blot analysis. **, P < 0.01; ***, P < 0.001; N.S, nonsignificant.

Figure 2.

Overexpressed miR-26a suppressed proliferation and migration and induced apoptosis in multiple myeloma cell lines. A–C, The expression of miR-26a in RPMI8226 (A), MM.1S (B), and H929 (C) cells stably transduced with V-miR-26a-GFP or V-GFP was determined by qRT-PCR; RNU44 was the internal control. The effect of miR-26a on multiple myeloma cell proliferation and migration was investigated. Expression of PARP1, c-PARP1, caspase-3, and c-caspase-3 in RPMI8226 and MM.1S cells transduced with V-miR-26a-GFP or V-GFP was determined by Western blot analysis. D, Predicted miR-26a target sequence on the 3′UTR of CD38. To interrupt the binding between the 3′UTR of CD38 and seed sequence of miR-26a, four nucleotides on the predicted region of the CD38 3′UTR were changed to the complementary sequence. A luciferase reporter assay was performed in HEK293T cells transduced with V-miR-26a-GFP or V-GFP. Expression of CD38 in RPMI8226, MM.1S, and H929 cells infected with V-miR-26a-GFP or V-GFP, as determined by Western blot analysis. **, P < 0.01; ***, P < 0.001; N.S, nonsignificant.

Close modal

miR-26a directly inhibited CD38 translation in multiple myeloma cells

We did not find a direct association between levels of miR-26a and CD38 mRNA in our analysis of the GSE16558 dataset (Supplementary Fig. S1A; R2 = 0.126; P = 0.0037). However, our qRT-PCR results revealed that the CD38 mRNA level increased after miR-26a overexpression in RPMI8226, but decreased in MM.1S cells, which indicated that the inhibition of CD38 protein expression caused by miR-26a is independent of its mRNA level (Supplementary Fig. S1B).

To further verify whether miR-26a repressed multiple myeloma cell growth through CD38 inhibition, we knocked down CD38 expression by siRNA in RPMI8226, MM.1S, and H929 cells. Five days after CD38 siRNA transfection, apoptosis was assayed (Fig. 3A) and found to be increased significantly by about 3- to 5-fold in CD38-knockdown cells compared with cells transfected with control siRNA, indicating that CD38 knockdown directly increased apoptosis in multiple myeloma. Protein expression also decreased after CD38 knockdown (Fig. 3A). In addition, we restored CD38 expression by infecting miR-26a mimic-treated MM.1S cells with V-CD38; V-GFP was the control (Fig. 3B). Restoring CD38 expression diminished the apoptosis induced by miR-26a overexpression, indicating the suppression of cell growth and accumulation of apoptosis caused by miR-26a were mediated by CD38 inhibition.

Figure 3.

CD38 knockdown induced apoptosis and reduced cell viability, and replenishing CD38 overrode the inhibition of miR-26a in multiple myeloma cells. A, CD38 siRNA and control siRNA were transfected into RPMI8226, MM.1S, and H929 cells. The expression of CD38 was verified by Western blot analysis, the population of apoptotic cells was determined by flow cytometry, and cell viability was measured by using CellTiter-GloLuminescent Cell Viability Assay Kit. B, MM.1S cells treated with miR-26a mimic were infected with V-CD38-GFP and V-GFP; cell apoptosis and viability were determined. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 3.

CD38 knockdown induced apoptosis and reduced cell viability, and replenishing CD38 overrode the inhibition of miR-26a in multiple myeloma cells. A, CD38 siRNA and control siRNA were transfected into RPMI8226, MM.1S, and H929 cells. The expression of CD38 was verified by Western blot analysis, the population of apoptotic cells was determined by flow cytometry, and cell viability was measured by using CellTiter-GloLuminescent Cell Viability Assay Kit. B, MM.1S cells treated with miR-26a mimic were infected with V-CD38-GFP and V-GFP; cell apoptosis and viability were determined. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

miR-26a synergistically enhanced the effects of bortezomib or melphalan in multiple myeloma

Our results indicate that miR-26a inhibits multiple myeloma growth through directly inhibiting CD38. To investigate whether miR-26a improved the therapeutic effect of bortezomib or melphalan in multiple myeloma cells, RPMI8226, MM.1S, and H929 cells stably transduced with V-miR-26a-GFP and V-GFP were treated with various doses of bortezomib in DMSO or melphalan in DMSO. Cells were collected for apoptosis determination by flow cytometry and Western blot analysis, and viability was evaluated using a CellTiter-Glo Luminescent Kit. Exogenous expression of miR-26a markedly increased bortezomib- or melphalan-induced apoptosis as measured by the percentage of Annexin V-APC–positive cells (Fig. 4A; Supplementary Fig. S2A) and protein levels of c-PARP1 and c-caspase-3 (Fig. 4B; Supplementary Fig. S2B). As shown in Fig. 4C and Supplementary Fig. S2C, enforced expression of miR-26a strongly increased growth inhibition induced by bortezomib or melphalan at 24 hours after treatment, and the inhibition became more pronounced over time. These findings indicate that overexpression of miR-26a in multiple myeloma cells act synergistically improve the curative effect of bortezomib or melphalan (Fig. 4D; Supplementary Fig. S2D).

Figure 4.

miR-26a enhanced the therapeutic effect of bortezomib in MM. RPMI8226, MM.1S, and H929 cells transduced with V-miR-26a-GFP or V-GFP were treated with bortezomib at different doses. A, Apoptosis was analyzed by flow cytometry with Annexin V B, protein levels of PARP1, c-PARP1, caspase-3, and c-caspase-3 were detected by Western blot analysis. B-actin was the internal control. C, Cell viability assay showing the effect of miR-26a enforced expression on RPMI8226, MM.1S, and H929 cells with bortezomib (BTZ) or DMSO treatment. miR-26a enhanced the effect of bortezomib in a dose-dependent fashion. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. D, RPMI8226, MM.1S, and H929 cells were transfected with 500 nmol/L miR-26a or treated with 2 nmol/L bortezomib or combined with miR-26a plus bortezomib and then assessed for viability using cell viability assay. Isobologram analysis was performed using the CompuSyn software program. A CI of less than 1.0 indicates synergism.

Figure 4.

miR-26a enhanced the therapeutic effect of bortezomib in MM. RPMI8226, MM.1S, and H929 cells transduced with V-miR-26a-GFP or V-GFP were treated with bortezomib at different doses. A, Apoptosis was analyzed by flow cytometry with Annexin V B, protein levels of PARP1, c-PARP1, caspase-3, and c-caspase-3 were detected by Western blot analysis. B-actin was the internal control. C, Cell viability assay showing the effect of miR-26a enforced expression on RPMI8226, MM.1S, and H929 cells with bortezomib (BTZ) or DMSO treatment. miR-26a enhanced the effect of bortezomib in a dose-dependent fashion. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. D, RPMI8226, MM.1S, and H929 cells were transfected with 500 nmol/L miR-26a or treated with 2 nmol/L bortezomib or combined with miR-26a plus bortezomib and then assessed for viability using cell viability assay. Isobologram analysis was performed using the CompuSyn software program. A CI of less than 1.0 indicates synergism.

Close modal

MiR-26a decelerated multiple myeloma growth in xenograft murine models

To validate our in vitro findings that a miR-26a mimic can inhibit multiple myeloma, we examined its ability to suppress tumor growth in an in vivo xenograft murine model. RPMI8226 or MM.1S cells infected with V-miR-26a-GFP/V-GFP were injected subcutaneously into SCID mice. Xenograft growth of both cell lines was strikingly inhibited in the V-miR-26a mice compared with V-GFP control mice (Fig. 5A and B). V-miR-26a-transduced xenografts weighed significantly less than controls when they were sacrificed on postinjection day 28. RNA was extracted for miR-26a expression, tissues were fixed, and embedded for IHC for Ki-67 and c-caspase-3, and protein was extracted to determine expression of CD38. miR-26a overexpression not only inhibited CD38 expression and reduced proliferation as indicated by Ki-67 staining, but also induced c-caspase-3 in vivo (Fig. 5A and B), as we had observed in vitro, indicating that miR-26a played a tumor suppressor role in vivo through inhibiting the function of CD38, suppressing proliferation, and provoking cell apoptosis in multiple myeloma.

Figure 5.

miR-26a inhibited multiple myeloma growth in a xenograft mouse model. A and B, RPMI8226 (A) and MM.1S cells (B) transduced with V-miR-26a-GFP or V-GFP were injected subcutaneously in shoulders of SCID mice (5 mice/group). Xenograft growth was monitored for 4 weeks. Tumor diameter was measured once a week, and tumor volume was calculated. Mice were sacrificed on day 28 postinjection; xenografts were isolated and weighed. Expression of miR-26a in xenografts was determined by qRT-PCR; RNU44 was used as an internal control. Expression of Ki-67 and c-caspase-3 was detected by IHC. Protein levels of CD38 in RPMI8226 and MM.1S xenografts were measured by Western blot analysis; β-actin was used as control. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 5.

miR-26a inhibited multiple myeloma growth in a xenograft mouse model. A and B, RPMI8226 (A) and MM.1S cells (B) transduced with V-miR-26a-GFP or V-GFP were injected subcutaneously in shoulders of SCID mice (5 mice/group). Xenograft growth was monitored for 4 weeks. Tumor diameter was measured once a week, and tumor volume was calculated. Mice were sacrificed on day 28 postinjection; xenografts were isolated and weighed. Expression of miR-26a in xenografts was determined by qRT-PCR; RNU44 was used as an internal control. Expression of Ki-67 and c-caspase-3 was detected by IHC. Protein levels of CD38 in RPMI8226 and MM.1S xenografts were measured by Western blot analysis; β-actin was used as control. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

SWCNT-miR-26a delivery prolongs the lifespan in a disseminated human multiple myeloma cell mouse model

Our data indicated that miR-26a was a robust tool to provoke cell apoptosis in multiple myeloma by targeting CD38. In our next step, we delivered miR-26a in vivo to mimic drug delivery in the clinical setting. We had used SWCNT to deliver antisense nucleic-acid drugs effectively and efficiently with good tolerability and minimal toxicity in vitro and in vivo (25). To test SWCNT delivery of miRNA, we conjugated SWCNTs with miR-26a (SWCNT-miR-26a; Fig. 6A; Supplementary Fig. S3; refs. 26, 27), then added the conjugated SWCNT to culture medium of H929, RPMI8226, and MM.1S cells to validate delivery efficiency. As shown in Fig. 6B, SWCNT-miR-26a was delivered into the multiple myeloma cells efficiently and led to substantial overexpression of the endogenous miR-26a in RPMI8226, MM.1S, and H929 cells.

Figure 6.

SWCNT-miR-26a treatment repressed myeloma growth disseminated murine models. A, The schematic diagram of SWCNT functionalization, miR-26a conjugation, mouse model construction, and miR-26a uptake processes. B, RPMI8226, MM.1S, and H929 cells were cultured with SWCNT-ctrl or SWCNT-mir-26a for 48 hours and then were subjected to RNA extraction. The miR-26a level was determined by qRT-PCR, with RUN44 as loading control. C, SCID mice (8 mice each group) were intravenously injected with 1 × 106 MM.1S-Luc-GFP cells, then injected with SWCNT-miR-26a or SWCNT-ctrl or BTZ (0.5 mg/kg) plus SWCNT-ctrl, or SWCNT-miR-26a combined with BTZ (0.5 mg/kg) once a week through the tail vein. Images were acquired using an IVIS (PerkinElmer). Hind limb paralysis was used as the endpoint. D, Time to the endpoint of hind limb paralysis was measured using the Kaplan–Meier method, with Cox proportional hazard regression analysis for group comparison. SWCNT-Ctrl vs. SWCNT-miR-26a, P = 0.02; SWCNT-Ctrl vs. bortezomib, P = 0.0003; SWCNT-Ctrl vs. BTZ + SWCNT-miR-26a, P < 0.0001; BTZ + SWCNT-Ctrl vs. BTZ + SWCNT-miR-26a, P = 0.026; BTZ + SWCNT-Ctrl vs. SWCNT-miR-26a, P = 0.75. **, P < 0.01; ***, P < 0.001.

Figure 6.

SWCNT-miR-26a treatment repressed myeloma growth disseminated murine models. A, The schematic diagram of SWCNT functionalization, miR-26a conjugation, mouse model construction, and miR-26a uptake processes. B, RPMI8226, MM.1S, and H929 cells were cultured with SWCNT-ctrl or SWCNT-mir-26a for 48 hours and then were subjected to RNA extraction. The miR-26a level was determined by qRT-PCR, with RUN44 as loading control. C, SCID mice (8 mice each group) were intravenously injected with 1 × 106 MM.1S-Luc-GFP cells, then injected with SWCNT-miR-26a or SWCNT-ctrl or BTZ (0.5 mg/kg) plus SWCNT-ctrl, or SWCNT-miR-26a combined with BTZ (0.5 mg/kg) once a week through the tail vein. Images were acquired using an IVIS (PerkinElmer). Hind limb paralysis was used as the endpoint. D, Time to the endpoint of hind limb paralysis was measured using the Kaplan–Meier method, with Cox proportional hazard regression analysis for group comparison. SWCNT-Ctrl vs. SWCNT-miR-26a, P = 0.02; SWCNT-Ctrl vs. bortezomib, P = 0.0003; SWCNT-Ctrl vs. BTZ + SWCNT-miR-26a, P < 0.0001; BTZ + SWCNT-Ctrl vs. BTZ + SWCNT-miR-26a, P = 0.026; BTZ + SWCNT-Ctrl vs. SWCNT-miR-26a, P = 0.75. **, P < 0.01; ***, P < 0.001.

Close modal

To further estimate the treatment potential of SWCNT-miR-26a in vivo, we intravenously injected MM.1S-Luc-GFP cells through the tail vein of SCID mice to establish a human multiple myeloma cells dissemination murine model (Fig. 6A). At day 7 after tumor cell injection, SWCNT-miR-26a or SWCNT-ctrl oligos or bortezomib (0.5 mg/kg) plus SWCNT-ctrl, or SWCNT-miR-26a combined with bortezomib (0.5 mg/kg) were intravenously injected once a week. We observed tumor burden with IVIS after luciferin injection, and found the miR-26a level was dramatically high in tumor cells isolated from SWCNT-miR-26a-treated mice compared with the cells isolated from SWCNT-ctrl–treated mice (Fig. 6B). The luciferin signal was significantly lower in SWCNT-miR-26a-treated mice compared with the SWCNT-ctrl-treated group and even further lower when combined with bortezomib treatment (Fig. 6C). We found SWCNT-miR-26a treatment extended time to hind limb paralysis significantly compared with SWCNT-ctrl-treated group. We also found that SWCNT-miR-26a and bortezomib combination therapy, compared with SWCNT-miR-26a or bortezomib single treatment, dramatically prolongs the lifespan of the treated multiple myeloma mice (Fig. 6D).

miR-26a regulates CD38 expression during human B-cell development to plasma cells

To understand whether the control exerted by miR-26a on CD38 expression is involved in normal B-cell differentiation toward plasma cells, naïve B cells were isolated from peripheral blood obtained from healthy donors. The purified naïve B cells were differentiated to plasma cells in vitro, and then subjected to qRT-PCR to examine miR-26a expression. As shown in Fig. 7A and B, naïve B cells were successfully isolated and differentiated to CD38-positive and CD138-positive plasma cells. The miR-26a level was markedly reduced in the differentiated plasma cells (Fig. 7C). We also determined the CD38 and miR-26a levels in serial histological sections of normal human tonsil tissues, finding the miR-26a level was low in germinal center B cells and plasma cells whereas the CD38 signal was extremely high (Fig. 7D).

Figure 7.

miR-26a negatively regulated CD38 during B-cell differentiation to plasma cells and daratumumab-resistant patient with multiple myeloma. A, Human naïve B cells were isolated from normal donor peripheral blood, and the purity was determined by flow cytometry. B, The naïve B cells were labeled by CFSE, cultured in 24-well plates and stimulated for 3 days with 2.6 μg/mL F(ab')2 fragment goat anti-human IgA+IgG+IgM (H+L), 100 ng/mL recombinant human soluble CD40L, 1.0 mg/mL CpG oligodeoxynucleotide 2006, and 50 U/mL recombinant IL2. Day 3 activated B cells were washed and cultured up to 4 days with 50 U/mL IL2, 50ng/mL IL6, 50 ng/mL IL10, and 2 ng/mL IL12 and then followed by a 3 days culture with 50 ng/mL IL6, 10 ng/mL IL15, and 500 U/mL IFNα. Cell surface CD38 and CD138 expression was determined by flow cytometry. C, qRT-PCR was used to determine the expression of miR-26a. D, The CD38 signal in human tonsil tissue samples was detected by immunohistochemistry, and the miR-26a signal was examined by in situ hybridization. Area 1, germinal center B cells. Area 2, plasma cells. Scale bar, 100 μm. E, BLIMP1 mRNA level in naïve B cells and day 10 differentiated B cells was examined by qRT-PCR. Naïve B cells were activated for 3 days and transfected with one of the BLIMP1 siRNAs, with sequence scrambled siRNA as control. F, The cells were differentiated for another 7 days and the cell surface CD38 expression was determined by flow cytometry. G and H, BLIMP1 expression was determined by qRT-PCR and immunoblotting (G) and the miR-26a level was determined by qRT-PCR (H). Naïve B cells were activated for 3 days and then transfected with miR-control or miR-26a mimic. The cells were cultured with IL2, IL6, IL12, and IL10, allowed to differentiate for 4 days and then followed by a 3 days culture with IL6, IL15, and IFNα. I, Cell surface CD38 and CD138 expression was determined by flow cytometry. J, Bone marrow biopsies were obtained from the same patient with multiple myeloma before daratumumab treatment and after became daratumumab resistant. The CD38 expression was examined by IHC and miR-26a level was examined by ISH. Scale bar, 100 μm. **, P < 0.01; ns, nonsignificant.

Figure 7.

miR-26a negatively regulated CD38 during B-cell differentiation to plasma cells and daratumumab-resistant patient with multiple myeloma. A, Human naïve B cells were isolated from normal donor peripheral blood, and the purity was determined by flow cytometry. B, The naïve B cells were labeled by CFSE, cultured in 24-well plates and stimulated for 3 days with 2.6 μg/mL F(ab')2 fragment goat anti-human IgA+IgG+IgM (H+L), 100 ng/mL recombinant human soluble CD40L, 1.0 mg/mL CpG oligodeoxynucleotide 2006, and 50 U/mL recombinant IL2. Day 3 activated B cells were washed and cultured up to 4 days with 50 U/mL IL2, 50ng/mL IL6, 50 ng/mL IL10, and 2 ng/mL IL12 and then followed by a 3 days culture with 50 ng/mL IL6, 10 ng/mL IL15, and 500 U/mL IFNα. Cell surface CD38 and CD138 expression was determined by flow cytometry. C, qRT-PCR was used to determine the expression of miR-26a. D, The CD38 signal in human tonsil tissue samples was detected by immunohistochemistry, and the miR-26a signal was examined by in situ hybridization. Area 1, germinal center B cells. Area 2, plasma cells. Scale bar, 100 μm. E, BLIMP1 mRNA level in naïve B cells and day 10 differentiated B cells was examined by qRT-PCR. Naïve B cells were activated for 3 days and transfected with one of the BLIMP1 siRNAs, with sequence scrambled siRNA as control. F, The cells were differentiated for another 7 days and the cell surface CD38 expression was determined by flow cytometry. G and H, BLIMP1 expression was determined by qRT-PCR and immunoblotting (G) and the miR-26a level was determined by qRT-PCR (H). Naïve B cells were activated for 3 days and then transfected with miR-control or miR-26a mimic. The cells were cultured with IL2, IL6, IL12, and IL10, allowed to differentiate for 4 days and then followed by a 3 days culture with IL6, IL15, and IFNα. I, Cell surface CD38 and CD138 expression was determined by flow cytometry. J, Bone marrow biopsies were obtained from the same patient with multiple myeloma before daratumumab treatment and after became daratumumab resistant. The CD38 expression was examined by IHC and miR-26a level was examined by ISH. Scale bar, 100 μm. **, P < 0.01; ns, nonsignificant.

Close modal

PR domain zinc finger protein 1, also known as BLIMP1, is a key transcription factor that controls the differentiation of activated B cells into plasma cells by silencing several important B cells genes, including Pax5 (28), Myc (29), and Bcl6 (30). We examined BLIMP1 expression in day-10 differentiated plasma cells and found the mRNA level of BLIMP1 was increased compared with naïve B cells (Fig. 7E). To investigate whether BLIMP1controls the expression of miR-26a, we knocked down the BLIMP1 level with siRNA in day 3 activated B cells. After another 7 days’ differentiation, the cells were subjected to flow cytometry, qRT-PCR, and immunoblotting. As shown in Fig. 7F, BLIMP1 mRNA and protein levels were both reduced in the siRNA-treated cells compared with control siRNA-treated cells. The miR-26a level was significantly increased in BLIMP1 knockdown cells (Fig. 7G), indicating that BLIMP1 negatively regulated miR-26a expression. At the same time, the number of CD38-positive cells was significantly reduced in BLIMP1 knockdown groups (Fig. 7H), confirming that BLIMP1 potentially regulates miR-26a and CD38 during B-cell differentiation. To understand whether miR-26a was functionally associated with plasma cell differentiation in human B cells, we ectopically overexpressed miR-26a in B cells that had differentiated into plasma cells. Surprisingly, we found that even though CD38 expression was inhibited in miR-26a-transfected differentiated plasma cells, the total CD138+ plasma cell number was not reduced (Fig. 7I).

miR-26a has been reported recently to be downregulated in patients with CLL (31) and can predict prognosis after adjustment for covariate confounders (e.g., FISH analyses, IGHV mutational status, and ZAP-70 or CD38 expression; ref. 32). Whether miR-26a level and CD38 expression correlate is unknown. The topographic distribution of CD38 expression in CLL, which is often characterized by the formation of CD38-high hot spots within a CD38 negative milieu offer an optimal ground to investigate topographic distribution of the miR-26a expression. We first analyzed the GSE51529 microarray dataset (210 patients with CLL) reported by Maura and colleagues (33), and found a significant inverse correlation between miR-26a level and CD38 mRNA expression level (P = 0.0004; Supplementary Fig. S4A). In situ hybridization and IHC studies for miR-26a and CD38 in consecutive histologic sections from 25 patients with CLL lymph node revealed five cases with CD38 patchy positive staining and two cases with strong CD38+ cell clusters. miR-26a level and CD38 expression inversely correlated in some CD38+ cells spots on serial histologic sections (Supplementary Fig. S4B). The data also supported the rationale of previous miR-26a delivery studies using CD38 conjugated nanoparticles in CLL (34).

Daratumumab-resistant patient multiple myeloma cells express high level of CD38 and low level of miR-26a

In patients, surface CD38 level was decreased 90% in nondepleted myeloma cells after the first daratumumab infusion by selective killing, CD38 microvesicle release, and internalization of CD38-daratumumab (35). CD38 returned to basal level after about 6 months treatment, indicating the development of daratumumab resistance (35). To further study CD38 and miR-26a expression after disease becomes daratumumab resistant, we examined all the patients with multiple myeloma treated and followed up at the Cleveland Clinic Tausig Cancer Center from 2015 to2019 and who donated tissue to our multiple myeloma tissue bank. Of the 20 patients identified, two have experienced relapse and bone marrow from one of these patients was biopsied successfully. IHC revealed that the multiple myeloma cell surface CD38 level was even higher in the relapsed bone marrow biopsy sample compared with pre-daratumumab treatment. At the same time, miR-26a levels were undetectable in both pre- and post-daratumumab treatment multiple myeloma cells (Fig. 7J). Consistent with previous studies (35), greater CD38 expression that daratumumab no longer killed these multiple myeloma cells, even when combined with other drug treatment including dexamethasone, pomalidomide, ixazomib, cafizomib, and panobinostat.

Multiple myeloma is a refractory plasma cell malignancy characterized by accumulation of antibody-secreting malignant plasma cells and osteolytic lesions in the bone marrow. The genetic heterogeneity of multiple myeloma presents obstacles to treatment. New treatments, such as proteasome inhibitors and immunomodulatory agents, have increased patient survival to a limited extent, from 3.5 to 5.5 years (36–38), and patients with relapse have few treatment choices. Multiple myeloma is a disease with complex and variable genomic changes. Consequently, effective treatments thus far developed, including bortezomib, lenalidomide, and dexamethasone, are multiple target drugs. Therefore, we decided to focus on miRNAs, which are natural small RNAs with multiple targets. By analyzing established datasets, we found that miR-26a was markedly downregulated in multiple myeloma cells. miR-26a has been verified in patient tissues as a tumor suppressor in multiple cancers, including osteosarcoma (39), lymphoma (40), colorectal cancer, (41), and others. Given our database findings, we believed miR-26a also plays a role in multiple myeloma.

A type II transmembrane glycoprotein, CD38 is uniformly overexpressed on multiple myeloma cells and regulates signal transduction of specific cell surface proteins (42). The CD38-specific mAb, daratumumab (43), is FDA approved for refractory multiple myeloma and has produced impressive therapeutic effects in clinic. Daratumumab induces multiple myeloma cell death mainly via antibody-dependent cell-mediated cytotoxicity, complement-dependent cytotoxicity, and antibody-dependent cellular phagocytosis, but it also can induce apoptosis through acting as an ectoenzyme (44–46). We showed that knocking down CD38 induces apoptosis in multiple myeloma cells; furthermore, restoring CD38 expression in multiple myeloma cells overexpressing miR-26a suppressed apoptosis significantly. These results indicate that insufficient CD38 expression will cause multiple myeloma cell death without the need for Fc-mediated immunoreactions. Some studies have reported that in vitro, antibody-dependent cell-mediated and complement-dependent cytotoxicity of IgG1-based mAbs may translate into only limited clinical anti-multiple myeloma activity when used alone because patients with multiple myeloma are usually immunocompromised, especially when their disease is resistant to current treatments (47, 48). However, another CD38 mAb, isatuximab, has showed shown efficacy and tolerability as a mono- and combination therapy in phase I and phase II studies in patients with relapse or refractory multiple myeloma; it is in phase III clinical trials now. Isatuximab has strong proapoptotic activity via inhibiting CD38 ectoenzyme function, which is independent of CD38 inter-crosslinking (49–51).

miRNA regulates protein expression at the posttranscriptional level and so can induce cleavage of mRNA or inhibit translation without reducing mRNA level (23, 24). For this reason, we used SILAC to screen for downstream target screening. We are the first to report that miR-26a inhibits multiple myeloma cell proliferation and migration and promotes cell apoptosis by targeting CD38 in multiple myeloma. As we were preparing this manuscript, a report was published in Cancer Research that uncovered a novel CD38 function in which CD38 drives mitochondrial trafficking to promote bioenergetic plasticity in multiple myeloma (52). Consistent with what these investigators found, we found that siRNA mediated knockdown of CD38 improved animal survival. Thus, we believe miR-26a mimic oligonucleotide treatment will have more consistent effects in patients with multiple myeloma.

We also showed that miR-26a enhanced bortezomib and melphalan treatment effects in vitro and in vivo. The FDA has approved several antisense oligonucleotide drugs, including nusinersen for spinal muscular atrophy (53), mipomersen for homozygous familial hypercholesterolemia (54), fomivirsen for cytomegalovirus retinitis (55), and eteplirsen for Duchenne muscular dystrophy (56). As a natural oligonucleotide, a miR-26a mimic will have advantages because it would not induce an immune response or deposit in organs due to inappropriate metabolism. In our mouse xenograft experiments, miR-26a inhibited growth of RPMI8226 and MM.1S xenografts as compared with V-GFP infected xenografts. In addition, CD38 protein level was inhibited significantly in miR-26a-transduced xenografts, and Ki-67 was suppressed, whereas c-caspase-3 was intensely induced, all of which are consistent with our in vitro results. These results indicated that the miR-26a treatment alone effectively inhibits growth of multiple myeloma cells with (RPMI8226) or without (MM.1S and H929) p53 mutation (57). Thus, miR-26a is potentially an effective in multiple myeloma as a single treatment or in combination with standard chemotherapeutics.

All-trans retinoic acid (58), the histone deacetylase inhibitor panobinostat (59), and recently DNA methyltransferase inhibitors (60) are being used as a combination therapy to overexpression CD38 to increase the myeloma cell sensitivity to daratumumab. However, this strategy may not work after once daratumumab resistance develops because CD38 expression level is high in myeloma cells from patients with daratumumab resistance. Loss of cell surface CD38 expression on multiple myeloma cells during long-term daratumumab treatment does not underlie the resistance mechanism that develops. Although CD38 expression remained low during daratumumab treatment, the response was high as others have reported (35). A strategy that uses miR-26a to multiple myeloma cells under pressure to maintain CD38 expression at a certain level may resensitize resistant cells to daratumumab treatment and have clinical benefit.

E.D. Hsi is a consultant at Seattle Genetics, Miltenyi and reports receiving other commercial research support from Abbvie and Cellerant. K.C. Anderson is a consultant at Janssen and Sanofi Aventis. N.C. Munshi is a consultant at Janssen, Amgen, Abbvie, Takeda, Karyopharm, Adaptive, and Oncopep, reports receiving other commercial research support from BMS, and has ownership interest (including patents) in Oncopep. No potential conflicts of interest were disclosed by the other authors.

Conception and design: Y. Hu, H. Liu, J.P. Maciejewski, J.N. Valent, J. Lin, J. Zhao

Development of methodology: Y. Hu, C. Fang, J. Lin, J. Zhao

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): Y. Hu, H. Liu, C. Fang, H. Dysert, J. Bodo, G. Habermehl, B.E. Russell, W. Li, M. Chappell, S.L. Ondrejka, E.D. His, G. Ao, J. Lin

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): Y. Hu, H. Liu, C. Li, W. Li, K.C. Anderson, N.C. Munshi, G. Ao, J. Lin, J. Zhao

Writing, review, and/or revision of the manuscript: Y. Hu, H. Liu, E.D. Hsi, K.C. Anderson, N.C. Munshi, G. Ao, J.P. Maciejewski, J.N. Valent, J. Lin, J. Zhao

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): C. Fang, H. Dysert, J. Bodo, S.L. Ondrejka, Q. Yi, J. Zhao

Study supervision: G. Ao, J. Zhao

The authors thank the Lerner Research Institute proteomic, genomic, and imaging cores for their assistance and support and Dr. Cassandra Talerico provided editorial assistance and helpful comments. This work was financially supported by grant from: NCI R00 CA172292 (to J. Zhao) and start-up funds (to J. Zhao) and two Core Utilization Pilot Grants (to J. Zhao) from the Clinical and Translational Science Collaborative of Cleveland, V Foundation Scholar Award (to J. Zhao), NIH training grant T32 CA094186, Training in Computational Genomic Epidemiology of Cancer (CoGEC) career development program (to J. Lin), 5UL1TR002548 from the National Center for Advancing Translational Sciences (NCATS) component of the NIH and NIH roadmap for Medical Research. The Orbitrap Elite instrument was purchased via an NIH shared instrument grant, 1S10RR031537-01.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Kazandjian
D
. 
Multiple myeloma epidemiology and survival: a unique malignancy
.
Semin Oncol
2016
;
43
:
676
81
.
2.
Croce
CM
,
Calin
GA
. 
miRNAs, cancer, and stem cell division
.
Cell
2005
;
122
:
6
7
.
3.
Calin
GA
,
Liu
CG
,
Sevignani
C
,
Ferracin
M
,
Felli
N
,
Dumitru
CD
, et al
MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias
.
Proc Natl Acad Sci U S A
2004
;
101
:
11755
60
.
4.
Chen
L
,
Li
C
,
Zhang
R
,
Gao
X
,
Qu
X
,
Zhao
M
, et al
miR-17–92 cluster microRNAs confers tumorigenicity in multiple myeloma
.
Cancer Lett
2011
;
309
:
62
70
.
5.
Zhang
L
,
Zhou
L
,
Shi
M
,
Kuang
Y
,
Fang
L
. 
Downregulation of miRNA-15a and miRNA-16 promote tumor proliferation in multiple myeloma by increasing CABIN1 expression
.
Oncol Lett
2018
;
15
:
1287
96
.
6.
Zhou
Y
,
Chen
L
,
Barlogie
B
,
Stephens
O
,
Wu
X
,
Williams
DR
, et al
High-risk myeloma is associated with global elevation of miRNAs and overexpression of EIF2C2/AGO2
.
Proc Natl Acad Sci U S A
2010
;
107
:
7904
9
.
7.
Ahmad
N
,
Haider
S
,
Jagannathan
S
,
Anaissie
E
,
Driscoll
JJ
. 
MicroRNA theragnostics for the clinical management of multiple myeloma
.
Leukemia
2014
;
28
:
732
8
.
8.
Zhao
JJ
,
Carrasco
RD
. 
Crosstalk between microRNA30a/b/c/d/e-5p and the canonical Wnt pathway: implications for multiple myeloma therapy
.
Cancer Res
2014
;
74
:
5351
8
.
9.
Lou
Y
,
Yang
X
,
Wang
F
,
Cui
Z
,
Huang
Y
. 
MicroRNA-21 promotes the cell proliferation, invasion and migration abilities in ovarian epithelial carcinomas through inhibiting the expression of PTEN protein
.
Int J Mol Med
2010
;
26
:
819
27
.
10.
Leone
E
,
Morelli
E
,
Di Martino
MT
,
Amodio
N
,
Foresta
U
,
Gulla
A
, et al
Targeting miR-21 inhibits in vitro and in vivo multiple myeloma cell growth
.
Clin Cancer Res
2013
;
19
:
2096
106
.
11.
Di Martino
MT
,
Leone
E
,
Amodio
N
,
Foresta
U
,
Lionetti
M
,
Pitari
MR
, et al
Synthetic miR-34a mimics as a novel therapeutic agent for multiple myeloma: in vitro and in vivo evidence
.
Clin Cancer Res
2012
;
18
:
6260
70
.
12.
Zarone
MR
,
Misso
G
,
Grimaldi
A
,
Zappavigna
S
,
Russo
M
,
Amler
E
, et al
Evidence of novel miR-34a-based therapeutic approaches for multiple myeloma treatment
.
Sci Rep
2017
;
7
:
17949
.
13.
Kota
J
,
Chivukula
RR
,
O'Donnell
KA
,
Wentzel
EA
,
Montgomery
CL
,
Hwang
HW
, et al
Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model
.
Cell
2009
;
137
:
1005
17
.
14.
Zhang
B
,
Liu
XX
,
He
JR
,
Zhou
CX
,
Guo
M
,
He
M
, et al
Pathologically decreased miR-26a antagonizes apoptosis and facilitates carcinogenesis by targeting MTDH and EZH2 in breast cancer
.
Carcinogenesis
2011
;
32
:
2
9
.
15.
Salvatori
B
,
Iosue
I
,
Djodji Damas
N
,
Mangiavacchi
A
,
Chiaretti
S
,
Messina
M
, et al
Critical role of c-Myc in acute myeloid leukemia involving direct regulation of miR-26a and histone methyltransferase EZH2
.
Genes Cancer
2011
;
2
:
585
92
.
16.
D'Abundo
L
,
Callegari
E
,
Bresin
A
,
Chillemi
A
,
Elamin
BK
,
Guerriero
P
, et al
Anti-leukemic activity of microRNA-26a in a chronic lymphocytic leukemia mouse model
.
Oncogene
2017
;
36
:
6617
26
.
17.
Gutierrez
NC
,
Sarasquete
ME
,
Misiewicz-Krzeminska
I
,
Delgado
M
,
De Las Rivas
J
,
Ticona
FV
, et al
Deregulation of microRNA expression in the different genetic subtypes of multiple myeloma and correlation with gene expression profiling
.
Leukemia
2010
;
24
:
629
37
.
18.
Livak
KJ
,
Schmittgen
TD
. 
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method
.
Methods
2001
;
25
:
402
8
.
19.
Lin
J
,
Zhang
W
,
Zhao
JJ
,
Kwart
AH
,
Yang
C
,
Ma
D
, et al
A clinically relevant in vivo zebrafish model of human multiple myeloma to study preclinical therapeutic efficacy
.
Blood
2016
;
128
:
249
52
.
20.
Ao
G
,
Streit
JK
,
Fagan
JA
,
Zheng
M
. 
Differentiating left- and right-handed carbon nanotubes by DNA
.
J Am Chem Soc
2016
;
138
:
16677
85
.
21.
Chou
TC
. 
Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies
.
Pharmacol Rev
2006
;
58
:
621
81
.
22.
Chou
TC
. 
Drug combination studies and their synergy quantification using the Chou-Talalay method
.
Cancer Res
2010
;
70
:
440
6
.
23.
Filipowicz
W
,
Bhattacharyya
SN
,
Sonenberg
N
. 
Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight?
Nat Rev Genet
2008
;
9
:
102
14
.
24.
Eulalio
A
,
Behm-Ansmant
I
,
Izaurralde
E
. 
P bodies: at the crossroads of post-transcriptional pathways
.
Nat Rev Mol Cell Biol
2007
;
8
:
9
22
.
25.
Perrot
A
,
Lauwers-Cances
V
,
Corre
J
,
Robillard
N
,
Hulin
C
,
Chretien
ML
, et al
Minimal residual disease negativity using deep sequencing is a major prognostic factor in multiple myeloma
.
Blood
2018
;
132
:
2456
64
.
26.
Luo
JH
,
Ren
B
,
Keryanov
S
,
Tseng
GC
,
Rao
UN
,
Monga
SP
, et al
Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas
.
Hepatology
2006
;
44
:
1012
24
.
27.
Hu
Y
,
Lin
J
,
Fang
H
,
Fang
J
,
Li
C
,
Chen
W
, et al
Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma
.
Leukemia
2018
.
28.
Lin
KI
,
Angelin-Duclos
C
,
Kuo
TC
,
Calame
K
. 
Blimp-1-dependent repression of Pax-5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells
.
Mol Cell Biol
2002
;
22
:
4771
80
.
29.
Lin
Y
,
Wong
K
,
Calame
K
. 
Repression of c-myc transcription by Blimp-1, an inducer of terminal B cell differentiation
.
Science
1997
;
276
:
596
9
.
30.
Shaffer
AL
,
Lin
KI
,
Kuo
TC
,
Yu
X
,
Hurt
EM
,
Rosenwald
A
, et al
Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program
.
Immunity
2002
;
17
:
51
62
.
31.
Van Roosbroeck
K
,
Bayraktar
R
,
Calin
S
,
Bloehdorn
J
,
Dragomir
MP
,
Okubo
K
, et al
The involvement of microRNA in the pathogenesis of Richter syndrome
.
Haematologica
2019
;
104
:
1004
15
.
32.
Negrini
M
,
Cutrona
G
,
Bassi
C
,
Fabris
S
,
Zagatti
B
,
Colombo
M
, et al
microRNAome expression in chronic lymphocytic leukemia: comparison with normal B-cell subsets and correlations with prognostic and clinical parameters
.
Clin Cancer Res
2014
;
20
:
4141
53
.
33.
Maura
F
,
Cutrona
G
,
Mosca
L
,
Matis
S
,
Lionetti
M
,
Fabris
S
, et al
Association between gene and miRNA expression profiles and stereotyped subset #4 B-cell receptor in chronic lymphocytic leukemia
.
Leuk Lymphoma
2015
;
56
:
3150
8
.
34.
D'Abundo
L
,
Callegari
E
,
Bresin
A
,
Chillemi
A
,
Elamin
BK
,
Guerriero
P
, et al
Anti-leukemic activity of microRNA-26a in a chronic lymphocytic leukemia mouse model
.
Oncogene
2017
;
36
:
6617
26
.
35.
van de Donk
N
,
Usmani
SZ
. 
CD38 antibodies in multiple myeloma: mechanisms of action and modes of resistance
.
Front Immunol
2018
;
9
:
2134
.
36.
San Miguel
JF
,
Schlag
R
,
Khuageva
NK
,
Dimopoulos
MA
,
Shpilberg
O
,
Kropff
M
, et al
Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma
.
N Engl J Med
2008
;
359
:
906
17
.
37.
Benboubker
L
,
Dimopoulos
MA
,
Dispenzieri
A
,
Catalano
J
,
Belch
AR
,
Cavo
M
, et al
Lenalidomide and dexamethasone in transplant-ineligible patients with myeloma
.
N Engl J Med
2014
;
371
:
906
17
.
38.
Mateos
MV
,
Dimopoulos
MA
,
Cavo
M
,
Suzuki
K
,
Jakubowiak
A
,
Knop
S
, et al
Daratumumab plus bortezomib, melphalan, and prednisone for untreated myeloma
.
N Engl J Med
2018
;
378
:
518
28
.
39.
Tan
X
,
Fan
S
,
Wu
W
,
Zhang
Y
. 
MicroRNA-26a inhibits osteosarcoma cell proliferation by targeting IGF-1
.
Bone Res
2015
;
3
:
15033
.
40.
Zhao
X
,
Lwin
T
,
Zhang
X
,
Huang
A
,
Wang
J
,
Marquez
VE
, et al
Disruption of the MYC-miRNA-EZH2 loop to suppress aggressive B-cell lymphoma survival and clonogenicity
.
Leukemia
2013
;
27
:
2341
50
.
41.
Lopez-Urrutia
E
,
Coronel-Hernandez
J
,
Garcia-Castillo
V
,
Contreras-Romero
C
,
Martinez-Gutierrez
A
,
Estrada-Galicia
D
, et al
MiR-26a downregulates retinoblastoma in colorectal cancer
.
Tumour Biol
2017
;
39
:
1010428317695945
.
42.
Zhao
YJ
,
Lam
CM
,
Lee
HC
. 
The membrane-bound enzyme CD38 exists in two opposing orientations
.
Sci Signal
2012
;
5
:
ra67
.
43.
Bhatnagar
V
,
Gormley
NJ
,
Luo
L
,
Shen
YL
,
Sridhara
R
,
Subramaniam
S
, et al
FDA approval summary: daratumumab for treatment of multiple myeloma after one prior therapy
.
Oncologist
2017
;
22
:
1347
53
.
44.
Sanchez
L
,
Wang
Y
,
Siegel
DS
,
Wang
ML
. 
Daratumumab: a first-in-class CD38 monoclonal antibody for the treatment of multiple myeloma
.
J Hematol Oncol
2016
;
9
:
51
.
45.
Nijhof
IS
,
Lammerts van Bueren
JJ
,
van Kessel
B
,
Andre
P
,
Morel
Y
,
Lokhorst
HM
, et al
Daratumumab-mediated lysis of primary multiple myeloma cells is enhanced in combination with the human anti-KIR antibody IPH2102 and lenalidomide
.
Haematologica
2015
;
100
:
263
8
.
46.
van de Donk
N
,
Richardson
PG
,
Malavasi
F
. 
CD38 antibodies in multiple myeloma: back to the future
.
Blood
2018
;
131
:
13
29
.
47.
Zonder
JA
,
Mohrbacher
AF
,
Singhal
S
,
van Rhee
F
,
Bensinger
WI
,
Ding
H
, et al
A phase 1, multicenter, open-label, dose escalation study of elotuzumab in patients with advanced multiple myeloma
.
Blood
2012
;
120
:
552
9
.
48.
Jurisic
V
,
Srdic
T
,
Konjevic
G
,
Markovic
O
,
Colovic
M
. 
Clinical stage-depending decrease of NK cell activity in multiple myeloma patients
.
Med Oncol
2007
;
24
:
312
7
.
49.
Richardson
PG
,
Attal
M
,
Campana
F
,
Le-Guennec
S
,
Hui
AM
,
Risse
ML
, et al
Isatuximab plus pomalidomide/dexamethasone versus pomalidomide/dexamethasone in relapsed/refractory multiple myeloma: ICARIA Phase III study design
.
Future Oncol
2018
;14:1035–47.
50.
Jiang
H
,
Acharya
C
,
An
G
,
Zhong
M
,
Feng
X
,
Wang
L
, et al
SAR650984 directly induces multiple myeloma cell death via lysosomal-associated and apoptotic pathways, which is further enhanced by pomalidomide
.
Leukemia
2016
;
30
:
399
408
.
51.
Feng
X
,
Zhang
L
,
Acharya
C
,
An
G
,
Wen
K
,
Qiu
L
, et al
Targeting CD38 suppresses induction and function of T regulatory cells to mitigate immunosuppression in multiple myeloma
.
Clin Cancer Res
2017
;
23
:
4290
300
.
52.
Marlein
CR
,
Piddock
RE
,
Mistry
JJ
,
Zaitseva
L
,
Hellmich
C
,
Horton
RH
, et al
CD38-driven mitochondrial trafficking promotes bioenergetic plasticity in multiple myeloma
.
Cancer Res
2019
;79:2285–97.
53.
Aartsma-Rus
A
. 
FDA approval of nusinersen for spinal muscular atrophy makes 2016 the year of splice modulating oligonucleotides
.
Nucleic Acid Ther
2017
;
27
:
67
9
.
54.
Smith
RJ
,
Hiatt
WR
. 
Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder
.
JAMA Intern Med
2013
;
173
:
1491
2
.
55.
Highleyman
L
. 
FDA approves fomivirsen, famciclovir, and thalidomide. food and drug administration
.
BETA
1998
:
5
.
56.
Nelson
SF
,
Miceli
MC
. 
FDA approval of eteplirsen for muscular dystrophy
.
JAMA
2017
;
317
:
1480
.
57.
Pichiorri
F
,
Suh
SS
,
Rocci
A
,
De Luca
L
,
Taccioli
C
,
Santhanam
R
, et al
Downregulation of p53-inducible microRNAs 192, 194, and 215 impairs the p53/MDM2 autoregulatory loop in multiple myeloma development
.
Cancer Cell
2010
;
18
:
367
81
.
58.
Nijhof
IS
,
Groen
RW
,
Lokhorst
HM
,
van Kessel
B
,
Bloem
AC
,
van Velzen
J
, et al
Upregulation of CD38 expression on multiple myeloma cells by all-trans retinoic acid improves the efficacy of daratumumab
.
Leukemia
2015
;
29
:
2039
49
.
59.
Garcia-Guerrero
E
,
Gogishvili
T
,
Danhof
S
,
Schreder
M
,
Pallaud
C
,
Perez-Simon
JA
, et al
Panobinostat induces CD38 upregulation and augments the antimyeloma efficacy of daratumumab
.
Blood
2017
;
129
:
3386
8
.
60.
Choudhry
P
,
Mariano
MC
,
Geng
H
,
Martin
TG
 3rd
,
Wolf
JL
,
Wong
SW
, et al
DNA methyltransferase inhibitors upregulate CD38 protein expression and enhance daratumumab efficacy in multiple myeloma
.
Leukemia
2019
;
34
:
938
41
.