The Hippo pathway plays a critical role in cell growth and tumorigenesis. The activity of TEA domain transcription factor 4 (TEAD4) determines the output of Hippo signaling; however, the regulation and function of TEAD4 has not been explored extensively. Here, we identified glucocorticoids (GC) as novel activators of TEAD4. GC treatment facilitated glucocorticoid receptor (GR)-dependent nuclear accumulation and transcriptional activation of TEAD4. TEAD4 positively correlated with GR expression in human breast cancer, and high expression of TEAD4 predicted poor survival of patients with breast cancer. Mechanistically, GC activation promoted GR interaction with TEAD4, forming a complex that was recruited to the TEAD4 promoter to boost its own expression. Functionally, the activation of TEAD4 by GC promoted breast cancer stem cells maintenance, cell survival, metastasis, and chemoresistance both in vitro and in vivo. Pharmacologic inhibition of TEAD4 inhibited GC-induced breast cancer chemoresistance. In conclusion, our study reveals a novel regulation and functional role of TEAD4 in breast cancer and proposes a potential new strategy for breast cancer therapy.

Significance:

This study provides new insight into the role of glucocorticoid signaling in breast cancer, with potential for clinical translation.

The Hippo signaling pathway, originally discovered in Drosophila melanogaster and highly conserved in mammals, plays key roles in cell proliferation, cell fate determination, organ size control, and tumor suppression (1–3). The Hippo pathway mainly contains upstream kinase complex, transcriptional cofactor Yes associated-protein (YAP) and its paralog WW domain containing transcription regulator 1 (TAZ), and TEA domain transcription factors (TEAD1-4). Upstream core MST-LATS kinase cascade phosphorylates YAP/TAZ and restricts their localization in the cytoplasm, whereas unphosphorylated YAP/TAZ translocate into nucleus and binds with TEADs to activate TEADs transcriptional activity (4, 5). Activated TEADs stimulates the expression of genes involved in cell proliferation and metastasis (CYR61, CTGF, BIRC5, ANKRD1, vimentin, and N-cadherin) and then promote tumorigenesis and progression (2, 6). Regulators, such as energy/osmotic stress (7, 8), cell contact/mechanical force (9, 10) and hormones (11) trigger Hippo pathway by controlling YAP/TAZ activity, whereas YAP/TAZ require TEADs binding to regulate target genes (12). Thus, it is of importance to understand the regulation and function of TEADs.

TEADs have been reported to be phosphorylated by protein kinase A and protein kinase C, which impairs TEADs DNA binding ability (13, 14). TEAD4 is also palmitoylated to enhance its association with YAP/TAZ and transcriptional activity (15). RBM4-facilitated alternative splicing of TEAD4 generates a TEAD4-shorter form to suppress cancer cell proliferation and migration (16). In addition, It has been studied that p38 regulates TEADs nuclear–cytoplasmic shuttling in response to osmotic stress (8). Moreover, TEAD4 nuclear localization is critical for establishing the trophectoderm-specific transcriptional program and segregating trophectoderm from the inner cell mass (17). More importantly, TEAD4 nuclear localization positively autoregulates its own transcription and increases its protein level in the trophectoderm lineage, and the high TEAD4 concentration facilitates its nuclear localization as a positive feedback response (17). Recently, it has been reported that the glucocorticoid receptor (GR) binds to the promoter of TEAD4 to regulate TEAD4 transcription during adipogenesis (18). The activity of TEADs is also regulated by its cofactors. Besides the most well-known coactivators YAP/TAZ, some other Hippo-independent cofactors have been also identified as TEADs-binding partners, such as the vestigial-like protein family (19), C-terminal binding protein 2 (20), transcription factor 4 (21), Krüppel-like factor 5 (KLF5; ref. 22) and activator protein-1 (23). Together with their cofactors, TEADs bind to the conserved MCAT motif to regulate transcriptional activity involved in cancer initiation and progression (24, 25).

Glucocorticoids (GC), as a kind of steroid hormones, function through GR and play important roles in various biological processes, such as cell growth, metabolism, immune and inflammatory reactions (26, 27). Because of its antiproliferative and proapoptotic roles, GCs have been used in various diseases therapies, such as acute lymphoblastic leukemia and multiple myeloma (27). Nevertheless, GCs treatment has side effect for the emergence of GC-induced apoptosis resistance (28). It has been shown that GCs promote cancer cells survival and protect cells from chemotherapy-induced apoptosis (29, 30). For example, dexamethasone treatment inhibits paclitaxel-induced apoptosis especially in breast cancer (11, 31, 32). Consistently, high expression of GC-related GR correlates with poor survival and poor prognosis in patients with breast cancer (11, 33). However, the molecular mechanism and the key mediators that respond to GC-GR signaling and induce cell growth, remain unclear.

Breast cancer is the most common malignancy in women. In clinical diagnosis, breast cancers are divided into four subtypes based on the expression of the markers: estrogen receptor (ER), progesterone receptor (PR), and HER2. Among the different subtypes, patients with triple-negative breast cancer (TNBC), characterized by ER/HER2/PR negative, have the highest frequency of lymph node metastasis and poorest prognosis (34). TNBC has a relatively good response to chemotherapy, however, chemoresistance is an alarming issue following treatment (34). The Hippo signaling pathway has been linked to breast cancer progression. The high expression of YAP and TAZ contribute to breast cancer cell survival and metastasis dependent on TEAD4 interaction (35, 36). Besides, TEAD4 also acts as an oncogene in breast cancer (22).

In this study, we identify GCs as new regulators of TEAD4 in breast cancer. GCs promote TEAD4 transcriptional levels, nuclear accumulation and TEAD4 transcriptional activity. These actions of GCs depend on GRs. Specifically, GC-activated GR is recruited to the promoter of TEAD4 and forms a complex with TEAD4 to regulate TEAD4 transcription and auto-activation. The activity of TEAD4 positively correlates with GR expression in clinical breast cancer samples. Furthermore, high expression of TEAD4 and GR predicts poor survival in patients with breast cancer. GC-GR induced TEAD4 activity is involved in breast cancer cells survival, metastasis and chemoresistance in vitro and in vivo. Pharmacological inhibition of TEAD4 transcriptional activity by niflumic acid inhibited GC-induced breast cancer drug resistance. Our data identify a new GC–GR–TEAD4 axis and a novel mechanism of TEAD4 regulation in breast cancer, suggesting a new strategy for breast cancer therapy.

Reagents and plasmids

The compounds and drugs were shown in Supplementary Table S1. TEAD4, TEAD4-VP16, GR, and GR-2C2A were cloned to the pLEX-HA vector for stable expression in cells. TEAD1/2/3/4, TEAD4-N, TEAD4-C and YAP were cloned to vector pcDNA3.1. GR, GR-DBD, GR-ΔDBD and GR-2C2A were cloned to vector pGEX-4T1-GST, and TEAD4 was cloned to pET28a-His-Sumo for protein purification in E. coli. All constructs for short hairpin RNA (shRNA) were constructed in a modified pLKO.1 vector. The shRNA target sequences as followings.

YAP-1: GACATCTTCTGGTCAGAGA;

TEAD4-1: GAGACAGAGTATGCTCGCTAT;

TEAD4-2: CCTTTCTCTCAGCAAACCTAT;

GR-1: TGGATAAGACCATGAGTATTG;

GR-2: CACAGGCTTCAGGTATCTTAT.

Scramble DNA duplex was also designed as a control: TTCTCCGAACGTGTCACGT.

Cell culture

HEK293T cells, MDA-MB-231, MDA-MB-453, and BT-549 were cultured in DMEM (Invitrogen) supplemented with 10% FBS and antibiotics at 37°C with 5% CO2 in a humidified incubator (Thermo Fisher Scientific), NIH/3T3 cells were cultured in DMEM with 10% NCS and antibiotics. MCF10A cells were maintained in DMEM/F12 medium (Sigma D6421) containing 5% horse serum (Sigma H1270), 10 μg/mL insulin (Sigma I6634), 20 ng/mL hEGF (Sigma E4269), 100 ng/mL cholera toxin (Sigma C8052), 0.5 μg/mL hydrocortisone (Sigma H4001), and antibiotics. Cells were obtained from Shanghai Life Academy of Sciences cell library (Shanghai, China) in June 2016, then the short tandem repeat analysis was performed to authenticate the cell lines. Multiple aliquots were frozen within 10 days when the cells were purchased and thawed. For experimental use, aliquots were resuscitated and cultured for about 20 passages (every 2 days for 6 weeks) before being discarded. All cell lines were ensured to be negative for Mycoplasma contamination.

Small interference RNAs

Duplexes of siRNA targeting TEAD4, GR, YAP, TAZ and negative control were synthesized by Genepharma (Shanghai, China). The siRNA target sequences in human are as followings:

GR-1: AAGTCAAGTTGTCATCTCC;

YAP-1: CCCAGTTAAATGTTCACCAAT;

TAZ: CAGCCAAATCTCGTGATGAA.

The siRNA target sequences in mouse:

YAP-1: GAAGCGCTGAGTTCCGAAAT;

TAZ-1: CAGCCGAATCTCGCAATGAAT;

TAZ-2: CCATGAGCACAGATATGAGAT;

For negative control: UUCUCCGAACGUGUCACGU.

DNA preparation for TEAD4 promoter luciferase reporter

The downstream sequence of TEAD4 gene containing TEAD4 and GR-binding site was amplified by PCR. Target DNA was detected by agarose gel and purified by Gel Extraction Kit (Tiangen). The primers used for PCR were as followings: TEAD4-F: CGAGGTGCCGGTGGC; TEAD4-R: CTCTCCACTGGCGGGACG.

Chromatin immunoprecipitation

Protocol of chromatin immunoprecipitation (ChIP) assay was previous described in detail (20). Chromatin was immunoprecipitated with 2 μg antibody of GR (SC-8992, Cell Signaling Technology), normal rabbit IgG (sc-2027, Santa Cruz Biotechnology), TEAD4 (58310, Abcam) or normal mouse IgG (sc-2025, Santa Cruz Biotechnology). The immunoprecipitated DNA was collected with QIAQIUCK PCR Purification Kit (250). Purified DNA was performed with ChIP-PCR. The primers used were shown in Supplementary Table S1.

Mammosphere formation assay

MDA-MB-231 cells were cultured with MammoCult Human Medium Kit (05620, STEMCELL Technologies) supplemented with 4 μg/mL heparin (07980, STEMCELL Technologies) in 6-well ultralow attachment plates (3,471, Corning), 3 × 105 cells per well for 10 days. Fresh complete medium was added into each well every 3 days. After culture, sphere number was counted.

Immunohistochemistry

Tissues were embedded in paraffin before cutting into 5-μm sections. IHC signals were developed using monoclonal antibodies against human TAZ (1:200, 4883), GR (1:200, 12041), and cleaved caspase-3 (1:200, 9661), which were purchased from Cell Signaling Technology. TEAD4 (1:100, sc-101184) and YAP (1:200, sc-15407) were purchased from Santa Cruz Biotechnology. Ki67 (PA5-19462) was a product of Thermo Fisher Scientific.

Xenograft tumor formation and lung seeding assay

Six-week-old healthy female nude mice (BALB/cA-nu/nu) were obtained from the Shanghai Experimental Animal Center and maintained in pathogen-free conditions. One million MDA-MB-231 cells in 100 μL of PBS was injected into the mammary fat pad of female nude mice for xenograft tumor formation or injected into tail vein for metastatic analysis of lung. Tumor growth at the injection site was monitored by caliper measurements 2 times a week and tumor volume was calculated using the formula: Tumor volume (mm3) = 0.52 × D × d2, where D and d is the longest and the shortest diameters, respectively. Mice were killed after 4 weeks and tumor weight were then weighted. For lung seeding assay, Lung of nude mice were analyzed after 40 days of tail vein injection. All animals were used in accordance with the guidelines of the Institutional Animal Care and Use Committee of the Institute of Biochemistry and Cell Biology.

Human breast cancer sample collection

All the human breast cancer samples were collected from Yunnan Cancer Hospital and The First Affiliated Hospital of Kunming Medical University, with patient written informed consent and the approval from the Institute Research Ethics Committee. The patient studies were conducted according to International Ethical Guidelines for Biomedical Research Involving Human Subjects (CIOMS) ethical guidelines.

Statistical analysis

Statistical parameters including the definitions and exact values of n, statistical test and statistical significance are reported in the figures and figure legends. Comparisons between groups were analyzed using an unpaired Student t test in less than three groups and one-way ANOVA followed by Tukey multiple comparison test in more than two groups by GraphPad Prism. SPSS 13.0 (SPSS, inc.) was used to analyze the Pearson correlation between GR and TEAD4. Survival curves were calculated according to the Kaplan–Meier method, and survival analysis was performed using the log-rank test. Differences are considered statistically significant at *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. ns means no significance. All data were presented as mean ± SD.

Glucocorticoids upregulate TEAD4 transcriptional levels in breast cancer cells

To study the regulation of GCs on Hippo signaling, we treated breast cancer cells MDA-MB-231 with 1 μmol/L dexamethasone for different time. Consistent with earlier findings (11), the total YAP protein levels were increased and phosphorylated YAP protein levels were decreased at 8 and 12 hours. Surprisingly, the protein level of TEAD4 were also upregulated dramatically with the increase of treatment time (Fig. 1A). The expression of TEAD4 and YAP were monitored after dexamethasone treatment (Fig. 1B). However, TEAD4 and YAP were not concurrently activated, and TEAD4 was activated soon after dexamethasone treatment, as well as Hippo target genes CYR61 and ANKRD1. TEAD1 and TEAD2 showed no significant change, and TEAD3 expression was also upregulated but in a time-independent manner (Supplementary Fig. S1A). To confirm the upregulation of TEAD4 was triggered by GCs but not only dexamethasone, 1 μg/mL hydrocortisone was used in MDA-MB-231 cells. Consistently, hydrocortisone also activated TEAD4 in a time-dependent manner (Supplementary Fig. S1B). Regardless the change in YAP/TAZ expression, TEAD4 was also activated in BT-549 and MDA-MB-453 cells (Fig. 1C), implying that the GC-related regulation of TEAD4 is a general phenomenon in breast cancer cells. In addition, we found that TEAD4 also responded to GCs in NIH/3T3 cells, a mouse embryo fibroblast (MEF) cell line (Supplementary Fig. S1C). Consistent with their protein results, TEAD4 and target genes mRNA levels were also increased after GCs treatment in MDA-MB-231 (Fig. 1D) and BT-549 cells (Fig. 1E), whereas the mRNA levels of YAP did not change (Fig. 1D and E). The lowest dose that TEAD4 responded to dexamethasone was 0.01 μmol/L (Supplementary Fig. S1D), and the GLIZ was a GR-regulated gene as positive control (Supplementary Fig. S1E). Again, the mRNAs of TEAD1/2/3 did not show a consistent change (Supplementary Fig. S1F).

Figure 1.

Glucocorticoids upregulate TEAD4 transcriptional level and promote TEAD4 nuclear accumulation in breast cancer cells. A, Western blotting analysis of the protein levels of Hippo components with indicated antibodies. MDA-MB-231 cells were treated with dexamethasone (Dex) 1 μmol/L for 0, 1, 4, 8, or 12 hours. B, Quantification of YAP and TEAD4 protein levels. The protein levels were quantized by ImageJ. C, Protein levels of Hippo signaling components. MDA-MB-453 and BT-549 cells were treated with 1 μmol/L dexamethasone for 0, 4, or 12 hours. D and E, Quantitative PCR with reverse transcription (qRT–PCR) analysis of Hippo components mRNA levels. MDA-MB-231 and BT-549 cells were treated with 1 μmol/L dexamethasone for 4 or 12 hours. Two biological repeats per group. F, Representative confocal immunofluorescence images (left) of TEAD4 in MDA-MB-231 cells treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone (HC) for 12 hours. Ethanol (Etha) was used as a control. TEAD4 and DAPI were stained. Quantification of TEAD4 nuclear localization (N) and cytoplasmic localization (C) is provided (right). Scale bar, 10 μm. G and H, Nuclear and cytoplasmic fraction analysis of TEAD4 expression. MDA-MB-231 or MDA-MB-453 cells were treated as in F. Subcellular fractionation was performed with NE-PERTM nuclear and cytoplasmic extraction reagent (Thermo Fisher Scientific) according to the instructions of the manufacturer. Both fractions were analyzed by Western blotting with indicated antibodies. I and J, 3 × SD luciferase reporter activity analysis of TEAD4 transcriptional activity. MDA-MB-231 and MDA-MB-453 cells were transfected with vector of 3 × SD luciferase reporter, and 24 hours later, cells were treated with ethanol, 1 μmol/L dexamethasone, or 1 μg/mL hydrocortisone for 12 hours. The relative luciferase activities were determined by calculating the ratio of firefly luciferase activities over Renilla luciferase activities. Data were normalized to ethanol. Three biological repeats per group. Data in D–F, I, and J represent the mean ± SD. One-way ANOVA was used to compare the difference between groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Figure 1.

Glucocorticoids upregulate TEAD4 transcriptional level and promote TEAD4 nuclear accumulation in breast cancer cells. A, Western blotting analysis of the protein levels of Hippo components with indicated antibodies. MDA-MB-231 cells were treated with dexamethasone (Dex) 1 μmol/L for 0, 1, 4, 8, or 12 hours. B, Quantification of YAP and TEAD4 protein levels. The protein levels were quantized by ImageJ. C, Protein levels of Hippo signaling components. MDA-MB-453 and BT-549 cells were treated with 1 μmol/L dexamethasone for 0, 4, or 12 hours. D and E, Quantitative PCR with reverse transcription (qRT–PCR) analysis of Hippo components mRNA levels. MDA-MB-231 and BT-549 cells were treated with 1 μmol/L dexamethasone for 4 or 12 hours. Two biological repeats per group. F, Representative confocal immunofluorescence images (left) of TEAD4 in MDA-MB-231 cells treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone (HC) for 12 hours. Ethanol (Etha) was used as a control. TEAD4 and DAPI were stained. Quantification of TEAD4 nuclear localization (N) and cytoplasmic localization (C) is provided (right). Scale bar, 10 μm. G and H, Nuclear and cytoplasmic fraction analysis of TEAD4 expression. MDA-MB-231 or MDA-MB-453 cells were treated as in F. Subcellular fractionation was performed with NE-PERTM nuclear and cytoplasmic extraction reagent (Thermo Fisher Scientific) according to the instructions of the manufacturer. Both fractions were analyzed by Western blotting with indicated antibodies. I and J, 3 × SD luciferase reporter activity analysis of TEAD4 transcriptional activity. MDA-MB-231 and MDA-MB-453 cells were transfected with vector of 3 × SD luciferase reporter, and 24 hours later, cells were treated with ethanol, 1 μmol/L dexamethasone, or 1 μg/mL hydrocortisone for 12 hours. The relative luciferase activities were determined by calculating the ratio of firefly luciferase activities over Renilla luciferase activities. Data were normalized to ethanol. Three biological repeats per group. Data in D–F, I, and J represent the mean ± SD. One-way ANOVA was used to compare the difference between groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Close modal

Glucocorticoids promote TEAD4 nuclear accumulation

Because localization of TEAD is a critical determinant of Hippo signaling output (8), we then investigated the regulation of TEAD4 localization by GCs. TEAD4 was mainly located in cytoplasm in a normal control culture conditions in MDA-MB-231 (Fig. 1F), MCF10A (Supplementary Fig. S2A), and NIH/3T3 cells (Supplementary Fig. S2B), and GC treatment induced obvious TEAD4 nuclear accumulation (Fig. 1F and Supplementary Fig. S1A and S1B). Nuclear and cytoplasmic fraction extraction also confirmed TEAD4 nuclear accumulation in MDA-MB-231 cells (Fig. 1G), MDA-MB-453 cells (Fig. 1H), MCF10A cells (Supplementary Fig. S2C) and NIH/3T3 cells (Supplementary Fig. S2D). Interestingly, the regulation was specific to TEAD4 rather than any other TEADs. TEAD1/2/3 were always located in the nucleus with or without GC treatment (Supplementary Fig. S2E and S2F). 3 × SD luciferase reporter was used to evaluate TEAD4 transcriptional activity (5). GC upregulated the reporter activity both in MDA-MB-231 cells (Fig. 1I) and MDA-MB-453 cells (Fig. 1J), and knockdown of TEAD4 almost blocked the GC-induced reporter activity (Supplementary Fig. S2G). Taken together, GCs regulate TEAD4 not only by promoting its expression, but also nuclear accumulation and transcriptional activity in breast cancer cells.

GC–GR axis regulates TEAD4 independent of YAP/TAZ

GCs regulates the expression of target genes by binding to GR and activating its transcriptional activity (37). To investigate the role of GR in regulating TEAD4, we interfered GR expression by siRNA in MDA-MB-231 cells. Knockdown of GR totally blocked the nuclear upregulation of TEAD4 triggered by dexamethasone or hydrocortisone at both protein (Fig. 2A) and mRNA levels (Fig. 2B). Although GR mainly located in nucleus in the absence of ligand treatment, which could be explained that besides ligand, the nuclear localization of GR also appears to be dependent in large part on nuclear retention mediated through the binding of the receptors to DNA (38). The protein levels of GR in the nucleus were reduced as a negative feedback by GCs treatment (39). Knockdown of GR also blocked the mRNA level up-regulation of GLIZ (Supplementary Fig. S3A). These results were confirmed in NIH/3T3 cells. Knockdown of GR totally blocked the TEAD4 cytoplasmic-nuclear shuttling and at the same time decreased TEAD4 protein levels (Supplementary Fig. S3B and S3C) in NIH/3T3 cells. The activation of TEAD4 induced by GCs was also completely blocked by cotreatment with RU486 (GR antagonist) compared with only GCs treatment in MDA-MB-231 cells (Fig. 2C and D). Furthermore, GR silencing inhibited TEAD4 transcriptional activity stimulated by GCs treatment in MDA-MB-231 cells (Fig. 2E) and MDA-MB-453 cells (Supplementary Fig. S3D). Thus, our results indicate a critical role of GR in GC-induced TEAD4 nuclear accumulation and transactivation.

Figure 2.

The GC–GR axis regulates TEAD4 independent of YAP/TAZ. A and B, Analysis of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells transfected with indicated siRNA for 36 hours and treated with 1 μmol/L dexamethasone (Dex) or 1 μg/mL hydrocortisone (HC) for 12 hours. siNC was used as negative control. Nuclear and cytoplasmic extraction was analyzed by Western blotting (A), and mRNA level was analyzed by qRT–PCR (B). C and D, Analysis of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone alone or in combination with RU486 1 μmol/L for 12 hours. Representative blots (C) and relative mRNA level (D) are shown. E, Analysis of transcriptional activity of TEAD4 by 3 × SD luciferase reporter. MDA-MB-231 cells were transfected with 3 × SD luciferase reporter and siRNA. After 24 hours, cells were treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone alone or in combination with RU486 1 μmol/L for 12 hours. Data were normalized to ethanol (Etha). F, Analysis of protein levels with indicated antibodies in YAP/TAZ deletion cells. MDA-MB-231 cells stably expressing shYAP were transfected with siTAZ for 36 hours and treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone for 12 hours. G, Analysis of mRNA levels with indicated RT-PCR primers in YAP/TAZ knockdown cells. MDA-MB-231 cells were transfected with siTAZ and siYAP for 36 hours and treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone for 12 hours. H, MDA-MB-231 were treated with verteporfin (VP) combined with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone for 12 hours. Data in B, D, E, and G represent the mean ± SD from two biological repeats. One-way ANOVA was used to compare the difference between groups. *, P < 0.05; ***, P < 0.001; ****, P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Figure 2.

The GC–GR axis regulates TEAD4 independent of YAP/TAZ. A and B, Analysis of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells transfected with indicated siRNA for 36 hours and treated with 1 μmol/L dexamethasone (Dex) or 1 μg/mL hydrocortisone (HC) for 12 hours. siNC was used as negative control. Nuclear and cytoplasmic extraction was analyzed by Western blotting (A), and mRNA level was analyzed by qRT–PCR (B). C and D, Analysis of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone alone or in combination with RU486 1 μmol/L for 12 hours. Representative blots (C) and relative mRNA level (D) are shown. E, Analysis of transcriptional activity of TEAD4 by 3 × SD luciferase reporter. MDA-MB-231 cells were transfected with 3 × SD luciferase reporter and siRNA. After 24 hours, cells were treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone alone or in combination with RU486 1 μmol/L for 12 hours. Data were normalized to ethanol (Etha). F, Analysis of protein levels with indicated antibodies in YAP/TAZ deletion cells. MDA-MB-231 cells stably expressing shYAP were transfected with siTAZ for 36 hours and treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone for 12 hours. G, Analysis of mRNA levels with indicated RT-PCR primers in YAP/TAZ knockdown cells. MDA-MB-231 cells were transfected with siTAZ and siYAP for 36 hours and treated with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone for 12 hours. H, MDA-MB-231 were treated with verteporfin (VP) combined with 1 μmol/L dexamethasone or 1 μg/mL hydrocortisone for 12 hours. Data in B, D, E, and G represent the mean ± SD from two biological repeats. One-way ANOVA was used to compare the difference between groups. *, P < 0.05; ***, P < 0.001; ****, P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Close modal

TEAD4 exerts its function mainly by binding with YAP/TAZ (5, 40). Because the GC–GR axis also activates YAP in breast cancer cells (11), we then examined whether there was a correlation between YAP and TEAD4 in GC-dependent regulation. Silencing of YAP/TAZ was incapable of blocking the up-regulation of TEAD4 induced by GCs treatment at both protein and mRNA levels in MDA-MB-231 cells (Fig. 2F and G) and NIH/3T cells (Supplementary Fig. S3E). Moreover, we also disrupted TEAD4 and YAP/TAZ binding by verteporfin (VP) treatment, and there was no obvious influence on GC-regulated TEAD4 expression (Fig. 2H). To further exclude the effect of YAP to TEAD4, we tested whether YAP influence the TEAD4 protein stability. Overexpression of YAP or knockdown of YAP/TAZ did not change TEAD4 protein stability followed by cyclohexane treatment (Supplementary Fig. S3F and S3G). These results indicate that YAP/TAZ are not responsible for GC-triggered TEAD4 activation. Altogether, our data demonstrate that the GC–GR axis regulates TEAD4 independent of YAP/TAZ.

TEAD4 is a direct target of GR in response to GCs

The previous reported regulation of TEAD4 contains phosphorylation (13, 14), palmitoylation (15), nucleocytoplasmic shuttling (8), and nuclear transport in the inner blastomere (17). Our data showed that the GC–GR axis regulates TEAD4 at the transcriptional levels (Fig. 2B–D). As GR regulates genes mainly by binding to their promoters (26), and GR regulates TEAD4 transcription during adipogenesis (18). We hypothesized that TEAD4 is also a direct target of GR during breast tumorigenesis. There are three repeated CATTCC sequences in TEAD4 promoter region that matched with the reported GR-binding sites (41, 42). The schematic diagram of TEAD4 promoter was shown in Fig. 3A. We then performed ChIP assay to detect the binding of GR on TEAD4 promoter in GC-treated MDA-MB-231 cells and MBA-MB-453 cells. Our results confirmed that GR bound to the promoter region of TEAD4 (Fig. 3B and Supplementary Fig. S4A). A region without the CATTCC sequences serves as a negative control (Fig. 3B). The wild-type and core base pair mutant of TEAD4 promoter luciferase reporters were both generated (Fig. 3A). TEAD4 promoter luciferase activity was increased after GCs treatment, and decreased after RU486 cotreatment with GCs (Fig. 3C). In contrast, GCs failed to activate the mutant form of TEAD4 promoter luciferase reporter (Fig. 3C). Knockdown of GR completely blocked the upregulation of TEAD4 promoter luciferase activity triggered by GCs (Fig. 3D). Still, knockdown of YAP/TAZ had no effect to the TEAD4 transcriptional activity (Supplementary Fig. S4B). These data suggest that TEAD4 is a direct target of GR in response to GCs.

Figure 3.

GR, forming a novel complex with TEAD4, is required for TEAD4 transcriptional activation. A, Schematic diagram of TEAD4 promoter region with conserved TEAD4 and GR-binding sites. B, ChIP analysis showed the binding of GR to the TEAD4 promoter. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone (Dex) for 12 hours. Protein-bound chromatin was immunoprecipitated with the GR antibody, and IgG was used as a control. The immunoprecipitated DNA was analyzed by quantitative PCR using primers of TEAD4-binding sequence, and TEAD4-NC was used as a negative control. C, Luciferase reporter driven by wild-type or mutant TEAD4 promoter (as shown in A) was transfected in the presence or absence of dexamethasone or dexamethasone/RU486. D, Luciferase reporter analysis of the TEAD4 transcriptional activity with or without GR expression. Luciferase activity from TEAD4 promoter in MDA-MB-231 cells was measured following treatment with 1 μmol/L dexamethasone for 12 hours on the background of siGR transfection. E, ChIP analysis of the binding of TEAD4 to the TEAD4 promoter. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone. F, Schematic diagram of main domains and sites of TEAD4 and GR. G, GST pull-down assay to detect the interaction of TEAD4 and GR. Purified GST-tagged GR recombinant proteins were incubated with cell lysates overexpressing Flag-tagged TEAD4, TEAD4-N, or TEAD4-C. GST protein was used as a negative control. H, GST pull-down assay to detect the main domain of GR mediating the interaction of TEAD4 and GR. Purified GST-tagged GR full-length and truncated recombinant proteins were incubated with cell lysates overexpressing Flag-tagged TEAD4. I, GST pull-down assay to determine the interaction of TEAD4 and GR with or without DNase. Digestion of DNA was detected by agarose gel. J, Two-step ChIP-PCR analysis of the TEAD4 binding to the TEAD4/CYR61/CTGF promoters with or without siGR transfection. MDA-MB-231 cells were treated with dexamethasone. K, Luciferase reporter analysis of TEAD4–GR complex to enhance TEAD4 transcription. Luciferase reporter driven by TEAD4 promoter was transfected with GR or GR-2C2A overexpression, then MDA-MB-231 cells were treated with ethanol (Etha) or dexamethasone. L, ChIP analysis of the binding of TEAD4 to the TEAD4/CYR61/CTGF promoter with or without siGR transfection. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone. Data in B–E and J–L represent the mean ± SD from three biological repeats. One-way ANOVA was used to compare the difference between groups. *, P < 0.05; ***, P < 0.001; ****, P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Figure 3.

GR, forming a novel complex with TEAD4, is required for TEAD4 transcriptional activation. A, Schematic diagram of TEAD4 promoter region with conserved TEAD4 and GR-binding sites. B, ChIP analysis showed the binding of GR to the TEAD4 promoter. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone (Dex) for 12 hours. Protein-bound chromatin was immunoprecipitated with the GR antibody, and IgG was used as a control. The immunoprecipitated DNA was analyzed by quantitative PCR using primers of TEAD4-binding sequence, and TEAD4-NC was used as a negative control. C, Luciferase reporter driven by wild-type or mutant TEAD4 promoter (as shown in A) was transfected in the presence or absence of dexamethasone or dexamethasone/RU486. D, Luciferase reporter analysis of the TEAD4 transcriptional activity with or without GR expression. Luciferase activity from TEAD4 promoter in MDA-MB-231 cells was measured following treatment with 1 μmol/L dexamethasone for 12 hours on the background of siGR transfection. E, ChIP analysis of the binding of TEAD4 to the TEAD4 promoter. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone. F, Schematic diagram of main domains and sites of TEAD4 and GR. G, GST pull-down assay to detect the interaction of TEAD4 and GR. Purified GST-tagged GR recombinant proteins were incubated with cell lysates overexpressing Flag-tagged TEAD4, TEAD4-N, or TEAD4-C. GST protein was used as a negative control. H, GST pull-down assay to detect the main domain of GR mediating the interaction of TEAD4 and GR. Purified GST-tagged GR full-length and truncated recombinant proteins were incubated with cell lysates overexpressing Flag-tagged TEAD4. I, GST pull-down assay to determine the interaction of TEAD4 and GR with or without DNase. Digestion of DNA was detected by agarose gel. J, Two-step ChIP-PCR analysis of the TEAD4 binding to the TEAD4/CYR61/CTGF promoters with or without siGR transfection. MDA-MB-231 cells were treated with dexamethasone. K, Luciferase reporter analysis of TEAD4–GR complex to enhance TEAD4 transcription. Luciferase reporter driven by TEAD4 promoter was transfected with GR or GR-2C2A overexpression, then MDA-MB-231 cells were treated with ethanol (Etha) or dexamethasone. L, ChIP analysis of the binding of TEAD4 to the TEAD4/CYR61/CTGF promoter with or without siGR transfection. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone. Data in B–E and J–L represent the mean ± SD from three biological repeats. One-way ANOVA was used to compare the difference between groups. *, P < 0.05; ***, P < 0.001; ****, P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Close modal

GR–TEAD4 complex is required for TEAD4 transcriptional activation

TEAD4 positively autoregulates its own transcription by binding to the promoter of itself in the trophectoderm lineage, and high TEAD4 concentration facilitates its nuclear localization (17). Interestingly, the DNA regions where TEAD4 binding overlaps with the GR-binding regions in the promoter of TEAD4. We speculated that TEAD4 may bind with GR to regulate its own transcription in response to GCs. We first detected the binding of TEAD4 to its own promoter by ChIP assay in GC-treated MDA-MB-231 cells. Our results showed that TEAD4 bound to its own promoter region (Fig. 3E) and overexpression of wild type TEAD4 or TEAD4 active form (TEAD4-VP16; ref. 43) upregulated TEAD4 promoter luciferase activity (Supplementary Fig. S4C), which indicated an autoregulation of TEAD4 upon GCs treatment.

We next examined the physical association between GR and TEAD4. TEAD4 contains an N-terminal TEA domain responsible for DNA binding, and a C-terminal YAP-binding domain responsible for YAP/TAZ binding. GR generates two main isoforms: GR-α and GR-β. The longer isoform GR-α contains three distinct domains: transaction domain in the N-terminal, ligand-binding domain (LBD) in the C-terminal and DNA binding domain (DBD) in the middle region responsible for specific DNA sequence recognition and binding (44). The schematic diagram of TEAD4 and GR main domains were shown in Fig. 3F. GST pull-down assay showed that GST-tagged GR pulled down TEAD4, and the interaction was mediated by N-terminal TEA domain but not the C-terminal YAP-binding domain (Fig. 3G). Because the TEA domain of TEADs proteins were conserved, GR could also pull-down TEAD1/2/3 (Supplementary Fig. S4D). GR full-length and DBD bind to TEAD4 but not the truncation form GR-ΔDBD (Fig. 3H), suggesting a specific interaction between the DNA binding domains of TEAD4 and GR. Purified protein–protein pull-down assay also confirmed the direct interaction of GR-DBD and TEAD4 (Supplementary Fig. S4E). Although YAP did not bind to GR in pull-down analysis (Supplementary Fig. S4F). Biotin-labeled DNA from TEAD4 promoter region could pull down both TEAD4 and GR-DBD protein (Supplementary Fig. S4G). Moreover, adding DNase in the pull-down system decreased the interaction of TEAD4 and GR (Fig. 3I), indicating that the interaction between TEAD4 and GR was enhanced by DNA again. ChIP–reChIP further proved that TEAD4 and GR genetically interacted on TEAD4 and CYR61/CTGF promoter (Fig. 3J).

We then asked whether TEAD4–GR interaction is required for GC-induced TEAD4 transcriptional activation. We made GR-2C2A mutant (C463A and C473A) that was unable to bind with TEAD4 (Supplementary Fig. S4H) but did not influence its ability of DNA binding (Supplementary Fig. S4I). Overexpression of GR-2C2A mutant lost the ability of enhancing the GC-induced TEAD4 promoter luciferase activity compared with GR-WT (Fig. 3K). Notably, knockdown of GR completely abolished GC-induced auto-binding of TEAD4 to its own promoter and also blocked TEAD4′s binding to the promoter of CYR61 and CTGF (Fig. 3L). Taken together, these results suggest that GC-activated GR facilitates TEAD4 transcription by co-binding with TEAD4 to the TEAD4 promoter, which further promotes TEAD4–GR transactivation.

The activity of TEAD4 positively correlates with GR expression in clinical breast cancer

To investigate whether the expression of TEAD4 correlates with GR, we performed IHC staining of TEAD4 and GR in human TNBC samples. There were 9 GR-positive and 9 TEAD4-positive samples in 30 total samples, and 8 of these GR or TEAD4 positive samples were GR and TEAD4 double positive (Supplementary Table S2). The results showed that TEAD4 expression positively correlated with the expression of GR (Fig. 4A and B). We also checked their correlation in Her2-positive (Her2+) and ERα-positive (ER+) human breast cancer samples, and found that no expression of TEAD4 was detected (Supplementary Fig. S5A and S5B), which was consistent with the previous study (22). As TEAD4 and GR function mainly in the nucleus, we examined the percentage of TEAD4 and GR nuclear localization in human TNBC samples, respectively. The results showed that almost all of GR and TEAD4 had nuclear expression (Fig. 4C). These results suggest that the activity of TEAD4 positively correlates with GR in human breast cancer samples.

Figure 4.

The activity of TEAD4 positively correlates with GR expression in human breast cancer. A, Representative IHC images of GR and TEAD4 staining in the human TNBC samples; scale bar, 100/25 μm. B, Pearson correlation analysis of the expression correlation of GR and TEAD4 in 30 TNBC samples. C, Percentage statistic of TEAD4 and GR nuclear expression in the human TNBC samples. D, TEAD4 mRNA expression in breast cancer and normal tissue. The data were obtained from The Cancer Genome Atlas database. E, Kaplan–Meier survival analysis of TEAD4 mRNA levels with 3,951 samples of 35 datasets from Kaplan–Meier Plotter website using the log-rank test. Survival curve was calculated according to the Kaplan–Meier method. F and G, MTT analysis of cell proliferation. MDA-MB-231 cells stably expressed shLuc, shTEAD4, or shGR and the MTT assay was done daily for 6 days. Five biological repeats per group. H, Transwell analysis of cell migration. MDA-MB-231 cells stably expressed shLuc, shTEAD4, or shGR and were serum starved. The representative pictures of migrated cells are shown; scale bar, 500 μm. I, Tumorsphere formation assay was conducted with shLuc, shTEAD4, or shGR in 3 × 105 MDA-MB-231 cells. Representative images are shown. Scale bars, 400 μm, based on randomly selected 5 fields. J, Xenograft assay of tumor growth. MDA-MB-231 cells were stably expressed shLuc, shTEAD4, or shGR, and were implanted subcutaneously in nude mice. The average sizes of xenograft tumors were measured twice a week. Each group contained eight biological replicates of four mice. K, Weights of the tumors in G removed after 24 days. L, Representative images of removed tumors and the ratios of metastatic mice are shown; scale bar, 1 cm. Data in F–K represent the mean ± SD. One-way ANOVA was used to compare the difference between groups. **, P < 0.01; ***, P < 0.00; ****, P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Figure 4.

The activity of TEAD4 positively correlates with GR expression in human breast cancer. A, Representative IHC images of GR and TEAD4 staining in the human TNBC samples; scale bar, 100/25 μm. B, Pearson correlation analysis of the expression correlation of GR and TEAD4 in 30 TNBC samples. C, Percentage statistic of TEAD4 and GR nuclear expression in the human TNBC samples. D, TEAD4 mRNA expression in breast cancer and normal tissue. The data were obtained from The Cancer Genome Atlas database. E, Kaplan–Meier survival analysis of TEAD4 mRNA levels with 3,951 samples of 35 datasets from Kaplan–Meier Plotter website using the log-rank test. Survival curve was calculated according to the Kaplan–Meier method. F and G, MTT analysis of cell proliferation. MDA-MB-231 cells stably expressed shLuc, shTEAD4, or shGR and the MTT assay was done daily for 6 days. Five biological repeats per group. H, Transwell analysis of cell migration. MDA-MB-231 cells stably expressed shLuc, shTEAD4, or shGR and were serum starved. The representative pictures of migrated cells are shown; scale bar, 500 μm. I, Tumorsphere formation assay was conducted with shLuc, shTEAD4, or shGR in 3 × 105 MDA-MB-231 cells. Representative images are shown. Scale bars, 400 μm, based on randomly selected 5 fields. J, Xenograft assay of tumor growth. MDA-MB-231 cells were stably expressed shLuc, shTEAD4, or shGR, and were implanted subcutaneously in nude mice. The average sizes of xenograft tumors were measured twice a week. Each group contained eight biological replicates of four mice. K, Weights of the tumors in G removed after 24 days. L, Representative images of removed tumors and the ratios of metastatic mice are shown; scale bar, 1 cm. Data in F–K represent the mean ± SD. One-way ANOVA was used to compare the difference between groups. **, P < 0.01; ***, P < 0.00; ****, P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Close modal

High expression of GR contributes to breast cancer progression and poor survival of patients (33, 45). Consistently, TEAD4 had higher expression in breast tumor compared with normal tissue (Fig. 4D). We analyzed 3951 samples from 35 datasets and found high TEAD4 mRNA levels were associated with poor survival of patients with breast cancer (Fig. 4E). To further investigate the role of TEAD4 and GR in breast cancer, we made shTEAD4 and shGR stable cell lines in MDA-MB-231 cells (Supplementary Fig. S5C and S5D). Knockdown of TEAD4 or GR, respectively, inhibited MDA-MB-231 cell proliferation (Fig. 4F–G) and migration (Fig. 4H). TEAD4 re-expression based on knockdown rescued the proliferation inhibition induced by TEAD4 knocking down (Supplementary Fig. S5E and S5F). More importantly, knockdown of TEAD4 or GR repressed cancer stem cells (CSC) trait, which is considered a major driver for cell proliferation, migration, and chemo-resistance (Fig. 4I). Subcutaneous xenotransplant in nude mice was performed to study the function of TEAD4 and GR in vivo. The results showed shTEAD4 or shGR significantly repressed tumor growth (Fig. 4J–L) and metastasis (Fig. 4L).

GR–TEAD4 mediates GC-triggered CSCs trait, as well as cell survival and metastasis in vitro and in vivo

GCs treatment promotes cancer cell growth and anti-apoptosis (11, 30). We then investigated the role of TEAD4 in GC-induced tumor growth. Knockdown of TEAD4 blocked GC-induced upregulation of proliferation-related genes BIRC5/ANKRD1 and EMT-related genes N-cadherin/vimentin (Fig. 5A), which consequently suppressed the GC-induced cell proliferation (Fig. 5B) and tumor growth (Fig. 5C–E). GCs treatment also promoted metastasis from primary solid tumors, and knockdown of TEAD4 inhibited GC-induced metastasis (Fig. 5E). In line with this, the GCs treatment increased the expression of Ki67 in a TEAD4-dependent manner in xenograft tumors (Fig. 5F). Overexpression of TEAD4-mNLS (nuclear localization signal mutant) blocked the function of GC in promoting proliferation (Supplementary Fig. S6A and S6B). In addition, TEAD4-VP16 overexpression completely mimicked the function of GCs in promoting TEAD4 promoter luciferase activity (Supplementary Fig. S6C) and cell migration (Supplementary Fig. S6D). To further dissect the function of TEAD4 in promoting tumor progression, wound-healing assay was performed. Knockdown of TEAD4 resulted in suppression of GC-induced cell migration (Supplementary Fig. S6E). GR knockdown also blocked the GC-induced upregulation of CYR61, ANKRD1 and vimentin (Supplementary Fig. S6F), as well as promotion of cell proliferation (Supplementary Fig. S6G) and cell migration (Supplementary Fig. S6H). Because of the importance of CSCs trait, we tested whether GC triggered CSCs feature depends on TEAD4 and GR. Knocking down TEAD4, as well as GR blocked GC treatment induced CSCs marker Slug, Nanog, and Oct4 expression (Fig. 5G, Supplementary Fig. S6I), and blocked GC treatment induced tumorsphere formation (Fig. 5H). Lung seeding assay assessing tumor migration ability in vivo showed that knockdown of TEAD4 or GR blocked GC-induced increase of the ratio of lung in the whole-body weight (Fig. 5I) and the number of metastatic tumors (Fig. 5J and K). Besides the contribution of TEAD4 and GR, it is noticeable that YAP also contributed to the growth promotion function of GCs (Supplementary Fig. S6J). It may be a synergistic result of TEAD4/YAP, and the function of YAP/TEAD4 still depends on the transcriptional activity of TEAD4. Moreover, TEAD4 activated form TEAD4-VP16 overexpression satisfied metastasis phenotype (Fig. 5L–N). Thus, several lines of evidence indicate that GR-TEAD4 is essential for GCs induced CSCs feature, cell survival, and metastasis in vitro and in vivo.

Figure 5.

GR-TEAD4 mediates GC-triggered CSCs trait, as well as cell survival and metastasis in vitro and in vivo. A, Protein levels of GC-induced genes with shLuc or shTEAD4 transfection. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone (Dex) for 12 hours with shLuc or shTEAD4 expression. B, MTT analysis of GC-triggered cell proliferation. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were treated with ethanol (Etha), 1 μmol/L dexamethasone, or 1 μg/mL hydrocortisone (HC) when seeding cells. Five biological replicates per group. C, Xenograft analysis of GC-promoted tumor growth. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were pretreated with ethanol or 1 μmol/L dexamethasone for 24 hours and were implanted subcutaneously in nude mice. The average sizes of xenograft tumors were measured twice a week. Each group contained eight biological replicates of four mice. D and E, Weights and pictures of the tumors in C removed after 22 days are shown; scale bar, 1 cm. F, Statistics of Ki67-positive cells in E. G, Protein level of GC-induced CSCs marker. H, Tumorsphere formation assay was conducted with shLuc, shTEAD4, or shGR in 3 × 105 MDA-MB-231 cells with or without GC treatment. Representative images are shown. Scale bars, 400 μm, based on randomly selected 5 fields. I, Lung seeding assay of tumor metastasis in vivo. The ratio of lung in whole body weight is shown. One million cells stably expressing shLuc, shTEAD4, or shGR were pretreated as in C and injected into nude mice via tail vein. Mice were sacrificed after 40 days. More than five mice per group. J, Representative images of lung are shown. Scale bar, 1 cm. K, Statistical graph of tumor numbers in lung. L–N, The function of TEAD4 activation in tumor metastasis in vivo. One million MDA-MB-231 cells stably expressing control or TEAD-VP16 were injected into nude mice via tail vein, and the mice were analyzed as in I–K. Data in B–D, F, H, I, K, L, and N represent the mean ± SD. Unpaired t tests and one-way ANOVA were used to compare the difference between groups. *, P < 0.05; **, P < 0.01; ****P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Figure 5.

GR-TEAD4 mediates GC-triggered CSCs trait, as well as cell survival and metastasis in vitro and in vivo. A, Protein levels of GC-induced genes with shLuc or shTEAD4 transfection. MDA-MB-231 cells were treated with 1 μmol/L dexamethasone (Dex) for 12 hours with shLuc or shTEAD4 expression. B, MTT analysis of GC-triggered cell proliferation. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were treated with ethanol (Etha), 1 μmol/L dexamethasone, or 1 μg/mL hydrocortisone (HC) when seeding cells. Five biological replicates per group. C, Xenograft analysis of GC-promoted tumor growth. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were pretreated with ethanol or 1 μmol/L dexamethasone for 24 hours and were implanted subcutaneously in nude mice. The average sizes of xenograft tumors were measured twice a week. Each group contained eight biological replicates of four mice. D and E, Weights and pictures of the tumors in C removed after 22 days are shown; scale bar, 1 cm. F, Statistics of Ki67-positive cells in E. G, Protein level of GC-induced CSCs marker. H, Tumorsphere formation assay was conducted with shLuc, shTEAD4, or shGR in 3 × 105 MDA-MB-231 cells with or without GC treatment. Representative images are shown. Scale bars, 400 μm, based on randomly selected 5 fields. I, Lung seeding assay of tumor metastasis in vivo. The ratio of lung in whole body weight is shown. One million cells stably expressing shLuc, shTEAD4, or shGR were pretreated as in C and injected into nude mice via tail vein. Mice were sacrificed after 40 days. More than five mice per group. J, Representative images of lung are shown. Scale bar, 1 cm. K, Statistical graph of tumor numbers in lung. L–N, The function of TEAD4 activation in tumor metastasis in vivo. One million MDA-MB-231 cells stably expressing control or TEAD-VP16 were injected into nude mice via tail vein, and the mice were analyzed as in I–K. Data in B–D, F, H, I, K, L, and N represent the mean ± SD. Unpaired t tests and one-way ANOVA were used to compare the difference between groups. *, P < 0.05; **, P < 0.01; ****P < 0.0001; ns, no statistical significance. Significance was relative to control of each group.

Close modal

GR–TEAD4 pathway is involved in GC-induced chemoresistance

Breast cancer is sensitive to cytotoxic compounds like taxanes, and GCs promote breast cancer cell drug resistance during cancer therapy (33, 46). We then assessed whether TEAD4 was involved in GC-induced chemoresistance. We monitored proliferation in cells treated with vehicle, paclitaxel, or paclitaxel combined with dexamethasone. Dexamethasone treatment inhibited the cleaved PARP and cleaved caspase-8 expressions and protected the cells from apoptosis caused by paclitaxel treatment, but lost its function in TEAD4 knockdown cells (Fig. 6A and B), suggesting that TEAD4 mediates GC-induced chemoresistance. To further gain insight into the role of TEAD4 in GC-triggered chemoresistance, we inhibited TEAD-dependent transcriptional activity using niflumic acid (NA), a nonsteroidal anti-inflammatory drug (47). Paclitaxel treatment promoted the expression of apoptosis marker cleaved PARP and inhibited cell growth (Fig. 6C and D). Co-treatment paclitaxel with dexamethasone inhibited the function of paclitaxel (Fig. 6C and D). NA cotreatment abolished dexamethasone-induced expression changes of ANKRD1 and cleaved PARP (Fig. 6C), also repressed dexamethasone-induced cell proliferation (Fig. 6D). NA lost its function in TEAD4 knockdown cells (Fig. 6E). These results indicate that transcriptional activity of TEAD4 is required for GC-induced chemoresistance in breast cancer cells. To investigate whether NA works in vivo, we intraperitoneally injected different combined drugs after cells were subcutaneously transplanted into nude mice. Paclitaxel treatment dramatically repressed tumor growth as shown by reduced tumor volume (Fig. 6F), decreased tumor weight and metastasis (Fig. 6G and H), reduced Ki67 expression and elevated cleaved caspase-3 expression (Fig. 6I) compared with control group. Coinjection of dexamethasone with paclitaxel inhibited the tumor suppression function of paclitaxel, whereas NA treatment reversed Dex-induced tumor chemoresistance (Fig. 6F–I). Our data suggest that activity of TEAD4 is responsible for GC-induced chemoresistance in vitro and in vivo.

Figure 6.

TEAD4 activation is involved in GC-induced chemoresistance. A, Knockdown of TEAD4 blocked GC-induced expression of apoptosis marker. MDA-MB-231 cells were treated with control, 0.1 μmol/L paclitaxel (PX), or 1 μmol/L dexamethasone as labeled with shLuc or shTEAD4 transfection. B, Inhibition of TEAD4 activity blocked GC-induced chemoresistance. MDA-MB-231 cells were treated as in A. Cell viability was detected after 4 days. Five repeats for each group. C and D, MDA-MB-231 cells were treated with DMSO, 100 μmol/L NA, or 1 μmol/L paclitaxel combined with ethanol or 1 μmol/L dexamethasone and then analyzed for protein levels (C) and cell survival (D). E, MDA-MB-231 cells were treated with DMSO or 100 μmol/L NA combined with 1 μmol/L paclitaxel and 1 μmol/L dexamethasone treatment with or without shTEAD4 expression and then analyzed for cell survival. F, Xenograft assay analysis of the function of TEAD4 transcriptional activity in GC-induced drug resistance. One million MDA-MB-231 cells were implanted subcutaneously in nude mice, and paclitaxel combined with dexamethasone or NA was intraperitoneally injected into the nude mice when the tumor volume was up to 50 mm3. The average sizes of xenograft tumors were measured twice a week. The tumor growth curves are shown. Each group contained six biological replicates. G and H, Tumor weight (G) and images of tumors in H removed after 33 days are shown; scale bar, 1 cm. I, IHC analysis of Ki67 and cleaved caspase-3 expression in tumor of G. Representative images are shown; scale bar, 20 μm. Data in B and D–G represent the mean ± SD. One-way ANOVA was used to compare the difference between groups. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. Significance was relative to control of each group. ns, no statistical significance.

Figure 6.

TEAD4 activation is involved in GC-induced chemoresistance. A, Knockdown of TEAD4 blocked GC-induced expression of apoptosis marker. MDA-MB-231 cells were treated with control, 0.1 μmol/L paclitaxel (PX), or 1 μmol/L dexamethasone as labeled with shLuc or shTEAD4 transfection. B, Inhibition of TEAD4 activity blocked GC-induced chemoresistance. MDA-MB-231 cells were treated as in A. Cell viability was detected after 4 days. Five repeats for each group. C and D, MDA-MB-231 cells were treated with DMSO, 100 μmol/L NA, or 1 μmol/L paclitaxel combined with ethanol or 1 μmol/L dexamethasone and then analyzed for protein levels (C) and cell survival (D). E, MDA-MB-231 cells were treated with DMSO or 100 μmol/L NA combined with 1 μmol/L paclitaxel and 1 μmol/L dexamethasone treatment with or without shTEAD4 expression and then analyzed for cell survival. F, Xenograft assay analysis of the function of TEAD4 transcriptional activity in GC-induced drug resistance. One million MDA-MB-231 cells were implanted subcutaneously in nude mice, and paclitaxel combined with dexamethasone or NA was intraperitoneally injected into the nude mice when the tumor volume was up to 50 mm3. The average sizes of xenograft tumors were measured twice a week. The tumor growth curves are shown. Each group contained six biological replicates. G and H, Tumor weight (G) and images of tumors in H removed after 33 days are shown; scale bar, 1 cm. I, IHC analysis of Ki67 and cleaved caspase-3 expression in tumor of G. Representative images are shown; scale bar, 20 μm. Data in B and D–G represent the mean ± SD. One-way ANOVA was used to compare the difference between groups. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. Significance was relative to control of each group. ns, no statistical significance.

Close modal

The Hippo signaling pathway plays critical roles in many biological processes. Although much has been learned about the regulation and function of the cofactors YAP/TAZ, less is known about the transcription factors TEADs. In this report, we provided evidence that GC–GR positively regulated TEAD4. YAP/TAZ deletion was not able to block the transcription regulation of TEAD4 induced by GCs, and overexpression of YAP was not able to stabilize TEAD4. Besides, GR directly interacted with TEAD4 independent of YAP. These results revealed a YAP/TAZ-independent regulation of TEAD4 by GC–GR signaling. Even though, YAP still contributes to the function of GCs. GC-activated YAP–TEAD4 may bind with each other and play their function synergistically in breast cancer.

Several genes have been identified as TEAD4 cofactors and involved in the function of TEAD4. We previously reported that KLF5 forms a complex with TEAD4 and promotes breast cancer progression (22), and GCs also induces KLF5 through GR, and KLF5 partially mediated the GC-induced docetaxel and cisplatin resistance in TNBC (32). In this study, we demonstrated that GR binds to TEAD4 to promote TEAD4 transcription and is involved in tumor growth and drug resistance. It is plausible that GC-stimulated GR form a ternary complex with TEAD4-KLF5 and play its function through TEAD4-KLF5. Interestingly, it is reported that GC-liganded GR regulates target gene expression through binding to GC response elements, or tethering to other transcription factors such as AP1 or TEAD (41, 42). These cues also suggest that GR may be involved in the regulation of Hippo signaling.

Recently, several alternative splicing events were reporter to modulate Hippo signaling activity. RBM4-facilitated TEAD4 alternative splicing produces a truncated isoform: TEAD4 shorter isoform (TEAD4-S; ref. 16). TEAD4-S lacks an N-terminal DNA binding domain whereas maintains C-terminal YAP-binding domain. Exogenous TEAD4-S is located in both nucleus and cytoplasm, whereas TEAD4-FL is mainly located in nucleus. TEAD4-FL functions as a tumor promoter, whereas TEAD4-S as a tumor suppressor (16). Our data demonstrated that GCs trigger TEAD4-FL nuclear accumulation in breast cancer cells. Endogenous TEAD4-FL was mainly located in nucleus, and endogenous TEAD4-S was mainly located in cytoplasm by extraction of nuclear and cytoplasmic fraction. GCs trigger nuclear TEAD4-FL accumulation, but cytoplasmic TEAD4-S does not show obvious change in MDA-MB-231 and MDA-MB-453 cells. The increased ratio of TEAD4-FL/TEAD4-S suggests that GCs could also regulate TEAD4 alternative splicing and help TEAD4 produce more nuclear TEAD4-FL to promote tumor progression.

TNBC is the most aggressive breast cancer subtype. Our work demonstrated the oncogenic role and positive correlation of TEAD4 and GR in breast cancer. The GC–GR–TEAD4 axis was involved in the tumor initiation, progression, and drug resistance in breast cancer especially in TNBC. Our findings illustrated a new molecular mechanism in TNBC regulation, and shed insights in developing new breast cancer therapy.

No potential conflicts of interest were disclosed.

Conception and design: L. He, Z. Wang, C. Chen, L. Zhang

Development of methodology: L. He, Y. Sun, Z. Wang

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): L. He

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): L. He, P. Wang, H. Zhang

Writing, review, and/or revision of the manuscript: L. He, Z. Wang, Y.A. Zeng, Y. Zhao, C. Chen, L. Zhang

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): L. He, Y. Sun, H. Zhang, X. Feng, Z. Wang, W. Zhang, C. Yang, Y.A. Zeng, C. Chen

Study supervision: C. Chen, L. Zhang

Other (cultured the cells, cared the animals and purified the proteins): L. Yuan

We thank Xiaorui Zhang and Liping Kuai for the animal care. We acknowledge Gaoxiang Ge, Zhenfei Li, and Lijian Hui for providing reagents and helpful comments. This work was supported by National Key Research and Development Program of China (2017YFA0103601 to L. Zhang), National Natural Science Foundation of China (No. 31530043 and 31625017 to L. Zhang; U1602221, 81830087, and 31771516 to C. Chen), “Strategic Priority Research Program” of Chinese Academy of Sciences (XDB19000000 to L. Zhang and XDA16010405 to C. Chen), “Shanghai Leading Talents Program” (to L. Zhang), Science and Technology Commission of Shanghai Municipality (19ZR1466300 to Z. Wang), and Youth Innovation Promotion Association of the Chinese Academy of Sciences (to Z. Wang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Wu
S
,
Huang
J
,
Dong
J
,
Pan
D
. 
Hippo encodes a Ste-20 family protein kinase that restricts cell proliferation and promotes apoptosis in conjunction with salvador and warts
.
Cell
2003
;
114
:
445
56
.
2.
Yin
MX
,
Zhang
L.
Hippo signaling in epithelial stem cells
.
Acta Biochim Biophys Sin
2015
;
47
:
39
45
.
3.
Yu
FX
,
Zhao
B
,
Guan
KL
. 
Hippo pathway in organ size control, tissue homeostasis, and cancer
.
Cell
2015
;
163
:
811
28
.
4.
Hao
Y
,
Chun
A
,
Cheung
K
,
Rashidi
B
,
Yang
X
. 
Tumor suppressor LATS1 is a negative regulator of oncogene YAP
.
J Biol Chem
2008
;
283
:
5496
509
.
5.
Zhang
L
,
Ren
F
,
Zhang
Q
,
Chen
Y
,
Wang
B
,
Jiang
J
. 
The TEAD/TEF family of transcription factor Scalloped mediates Hippo signaling in organ size control
.
Dev Cell
2008
;
14
:
377
87
.
6.
Zhou
Y
,
Huang
T
,
Cheng
AS
,
Yu
J
,
Kang
W
,
To
KF
. 
The TEAD family and its oncogenic role in promoting tumorigenesis
.
Int J Mol Sci
2016
;
17
. doi: 10.3390/ijms17010138.
7.
Wang
W
,
Xiao
ZD
,
Li
X
,
Aziz
KE
,
Gan
B
,
Johnson
RL
, et al
AMPK modulates Hippo pathway activity to regulate energy homeostasis
.
Nat Cell Biol
2015
;
17
:
490
9
.
8.
Lin
KC
,
Moroishi
T
,
Meng
Z
,
Jeong
HS
,
Plouffe
SW
,
Sekido
Y
, et al
Regulation of Hippo pathway transcription factor TEAD by p38 MAPK-induced cytoplasmic translocation
.
Nat Cell Biol
2017
;
19
:
996
1002
.
9.
Zhao
B
,
Wei
X
,
Li
W
,
Udan
RS
,
Yang
Q
,
Kim
J
, et al
Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control
.
Genes Dev
2007
;
21
:
2747
61
.
10.
Gao
J
,
He
L
,
Shi
Y
,
Cai
M
,
Xu
H
,
Jiang
J
, et al
Cell contact and pressure control of YAP localization and clustering revealed by super-resolution imaging
.
Nanoscale
2017
;
9
:
16993
7003
.
11.
Sorrentino
G
,
Ruggeri
N
,
Zannini
A
,
Ingallina
E
,
Bertolio
R
,
Marotta
C
, et al
Glucocorticoid receptor signalling activates YAP in breast cancer
.
Nat Commun
2017
;
8
:
14073
.
12.
Chen
L
,
Chan
SW
,
Zhang
X
,
Walsh
M
,
Lim
CJ
,
Hong
W
, et al
Structural basis of YAP recognition by TEAD4 in the hippo pathway
.
Genes Dev
2010
;
24
:
290
300
.
13.
Gupta
MP
,
Kogut
P
,
Gupta
M
. 
Protein kinase-A dependent phosphorylation of transcription enhancer factor-1 represses its DNA-binding activity but enhances its gene activation ability
.
Nucleic Acids Res
2000
;
28
:
3168
77
.
14.
Jiang
SW
,
Dong
M
,
Trujillo
MA
,
Miller
LJ
,
Eberhardt
NL
. 
DNA binding of TEA/ATTS domain factors is regulated by protein kinase C phosphorylation in human choriocarcinoma cells
.
J Biol Chem
2001
;
276
:
23464
70
.
15.
Noland
CL
,
Gierke
S
,
Schnier
PD
,
Murray
J
,
Sandoval
WN
,
Sagolla
M
, et al
Palmitoylation of TEAD transcription factors is required for their stability and function in Hippo pathway signaling
.
Structure
2016
;
24
:
179
86
.
16.
Qi
Y
,
Yu
J
,
Han
W
,
Fan
X
,
Qian
H
,
Wei
H
, et al
A splicing isoform of TEAD4 attenuates the Hippo-YAP signalling to inhibit tumour proliferation
.
Nat Commun
2016
;
7
:
ncomms11840
.
17.
Home
P
,
Saha
B
,
Ray
S
,
Dutta
D
,
Gunewardena
S
,
Yoo
B
, et al
Altered subcellular localization of transcription factor TEAD4 regulates first mammalian cell lineage commitment
.
PNAS
2012
;
109
:
7362
7
.
18.
Park
B
,
Chang
S
,
Lee
GJ
,
Kang
B
,
Kim
JK
,
Park
H
. 
Wnt3a disrupts GR-TEAD4-PPARgamma2 positive circuits and cytoskeletal rearrangement in a beta-catenin-dependent manner during early adipogenesis
.
Cell Death Dis
2019
;
10
:
16
.
19.
Jiao
S
,
Wang
H
,
Shi
Z
,
Dong
A
,
Zhang
W
,
Song
X
, et al
A peptide mimicking VGLL4 function acts as a YAP antagonist therapy against gastric cancer
.
Cancer Cell
2014
;
25
:
166
80
.
20.
Zhang
W
,
Xu
J
,
Li
J
,
Guo
T
,
Jiang
D
,
Feng
X
, et al
The TEA domain family transcription factor TEAD4 represses murine adipogenesis by recruiting cofactors VGLL4 and CtBP2 into a transcriptional complex
.
J Biol Chem
2018
;
293
:
17119
34
.
21.
Jiao
S
,
Li
C
,
Hao
Q
,
Miao
H
,
Zhang
L
,
Li
L
, et al
VGLL4 targets a TCF4-TEAD4 complex to coregulate Wnt and Hippo signalling in colorectal cancer
.
Nat Commun
2017
;
8
:
14058
.
22.
Wang
C
,
Nie
Z
,
Zhou
Z
,
Zhang
H
,
Liu
R
,
Wu
J
, et al
The interplay between TEAD4 and KLF5 promotes breast cancer partially through inhibiting the transcription of p27Kip1
.
Oncotarget
2015
;
6
:
17685
97
.
23.
Zanconato
F
,
Forcato
M
,
Battilana
G
,
Azzolin
L
,
Quaranta
E
,
Bodega
B
, et al
Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers drives oncogenic growth
.
Nat Cell Biol
2015
;
17
:
1218
27
.
24.
Anbanandam
A
,
Albarado
DC
,
Nguyen
CT
,
Halder
G
,
Gao
X
,
Veeraraghavan
S
. 
Insights into transcription enhancer factor 1 (TEF-1) activity from the solution structure of the TEA domain
.
PNAS
2006
;
103
:
17225
30
.
25.
Shi
Z
,
He
F
,
Chen
M
,
Hua
L
,
Wang
W
,
Jiao
S
, et al
DNA-binding mechanism of the Hippo pathway transcription factor TEAD4
.
Oncogene
2017
;
36
:
4362
9
.
26.
Buttgereit
F
,
Scheffold
A.
Rapid glucocorticoid effects on immune cells
.
Steroids
2002
;
67
:
529
34
.
27.
Smith
LK
,
Cidlowski
JA.
Glucocorticoid-induced apoptosis of healthy and malignant lymphocytes
.
Prog Brain Res
2010
;
182
:
1
30
.
28.
Kofler
R
,
Schmidt
S
,
Kofler
A
,
Ausserlechner
MJ
. 
Resistance to glucocorticoid-induced apoptosis in lymphoblastic leukemia
.
J Endocrinol
2003
;
178
:
19
27
.
29.
Moran
TJ
,
Gray
S
,
Mikosz
CA
,
Conzen
SD
. 
The glucocorticoid receptor mediates a survival signal in human mammary epithelial cells
.
Cancer Res
2000
;
60
:
867
72
.
30.
Zhang
C
,
Beckermann
B
,
Kallifatidis
G
,
Liu
Z
,
Rittgen
W
,
Edler
L
, et al
Corticosteroids induce chemotherapy resistance in the majority of tumour cells from bone, brain, breast, cervix, melanoma and neuroblastoma
.
Int J Oncol
2006
;
29
:
1295
301
.
31.
Skor
MN
,
Wonder
EL
,
Kocherginsky
M
,
Goyal
A
,
Hall
BA
,
Cai
Y
, et al
Glucocorticoid receptor antagonism as a novel therapy for triple-negative breast cancer
.
Clin Cancer Res
2013
;
19
:
6163
72
.
32.
Li
Z
,
Dong
J
,
Zou
T
,
Du
C
,
Li
S
,
Chen
C
, et al
Dexamethasone induces docetaxel and cisplatin resistance partially through up-regulating Kruppel-like factor 5 in triple-negative breast cancer
.
Oncotarget
2017
;
8
:
11555
65
.
33.
Chen
Z
,
Lan
X
,
Wu
D
,
Sunkel
B
,
Ye
Z
,
Huang
J
, et al
Ligand-dependent genomic function of glucocorticoid receptor in triple-negative breast cancer
.
Nat Commun
2015
;
6
:
8323
.
34.
Jamdade
VS
,
Sethi
N
,
Mundhe
NA
,
Kumar
P
,
Lahkar
M
,
Sinha
N
. 
Therapeutic targets of triple-negative breast cancer: a review
.
Br J Pharmacol
2015
;
172
:
4228
37
.
35.
Lamar
JM
,
Stern
P
,
Liu
H
,
Schindler
JW
,
Jiang
ZG
,
Hynes
RO
. 
The Hippo pathway target, YAP, promotes metastasis through its TEAD-interaction domain
.
PNAS
2012
;
109
:
E2441
50
.
36.
Shi
P
,
Feng
J
,
Chen
C
. 
Hippo pathway in mammary gland development and breast cancer
.
Acta Biochim Biophys Sin
2015
;
47
:
53
9
.
37.
Biddie
SC
,
Conway-Campbell
BL
,
Lightman
SL
. 
Dynamic regulation of glucocorticoid signalling in health and disease
.
Rheumatology
2012
;
51
:
403
12
.
38.
Hache
RJ
,
Tse
R
,
Reich
T
,
Savory
JG
,
Lefebvre
YA
. 
Nucleocytoplasmic trafficking of steroid-free glucocorticoid receptor
.
J Biol Chem
1999
;
274
:
1432
9
.
39.
Kadmiel
M
,
Cidlowski
JA.
Glucocorticoid receptor signaling in health and disease
.
Trends Pharmacol Sci
2013
;
34
:
518
30
.
40.
Zhao
B
,
Ye
X
,
Yu
J
,
Li
L
,
Li
W
,
Li
S
, et al
TEAD mediates YAP-dependent gene induction and growth control
.
Genes Dev
2008
;
22
:
1962
71
.
41.
Biddie
SC
,
John
S
,
Sabo
PJ
,
Thurman
RE
,
Johnson
TA
,
Schiltz
RL
, et al
Transcription factor AP1 potentiates chromatin accessibility and glucocorticoid receptor binding
.
Mol Cell
2011
;
43
:
145
55
.
42.
Starick
SR
,
Ibn-Salem
J
,
Jurk
M
,
Hernandez
C
,
Love
MI
,
Chung
HR
, et al
ChIP-exo signal associated with DNA-binding motifs provides insight into the genomic binding of the glucocorticoid receptor and cooperating transcription factors
.
Genome Res
2015
;
25
:
825
35
.
43.
Nishioka
N
,
Inoue
K
,
Adachi
K
,
Kiyonari
H
,
Ota
M
,
Ralston
A
, et al
The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass
.
Dev Cell
2009
;
16
:
398
410
.
44.
Gruver-Yates
AL
,
Cidlowski
JA.
Tissue-specific actions of glucocorticoids on apoptosis: a double-edged sword
.
Cells
2013
;
2
:
202
23
.
45.
Pan
D
,
Kocherginsky
M
,
Conzen
SD
. 
Activation of the glucocorticoid receptor is associated with poor prognosis in estrogen receptor-negative breast cancer
.
Cancer Res
2011
;
71
:
6360
70
.
46.
Herr
I
,
Pfitzenmaier
J.
Glucocorticoid use in prostate cancer and other solid tumours: implications for effectiveness of cytotoxic treatment and metastases
.
Lancet Oncol
2006
;
7
:
425
30
.
47.
Pobbati
AV
,
Han
X
,
Hung
AW
,
Weiguang
S
,
Huda
N
,
Chen
GY
, et al
Targeting the central pocket in human transcription factor TEAD as a potential cancer therapeutic strategy
.
Structure
2015
;
23
:
2076
86
.