Sirtuins participate in sensing nutrient availability and directing metabolic activity to match energy needs with energy production and consumption. However, the pivotal targets for sirtuins in cancer are mainly unknown. In this study, we identify the M2 isoform of pyruvate kinase (PKM2) as a critical target of the sirtuin SIRT2 implicated in cancer. PKM2 directs the synthesis of pyruvate and acetyl-CoA, the latter of which is transported to mitochondria for use in the Krebs cycle to generate ATP. Enabled by a shotgun mass spectrometry analysis founded on tissue culture models, we identified a candidate SIRT2 deacetylation target at PKM2 lysine 305 (K305). Biochemical experiments including site-directed mutants that mimicked constitutive acetylation suggested that acetylation reduced PKM2 activity by preventing tetramerization to the active enzymatic form. Notably, ectopic overexpression of a deacetylated PKM2 mutant in Sirt2-deficient mammary tumor cells altered glucose metabolism and inhibited malignant growth. Taken together, our results argued that loss of SIRT2 function in cancer cells reprograms their glycolytic metabolism via PKM2 regulation, partially explaining the tumor-permissive phenotype of mice lacking Sirt2. Cancer Res; 76(13); 3802–12. ©2016 AACR.

Sirtuins are the human and murine homologs of the S. cerevisiae Sir2 deacetylase that regulate replicative and overall lifespan in several species (1–3). While these proteins determine longevity in mammals, they do appear to direct acetylome signaling networks in response to caloric restriction (4, 5). Furthermore, murine models lacking one of the seven sirtuin genes develop illnesses that mimic those commonly observed in older humans (6–9). Sirtuins are deacetylases that share a common catalytic domain and are localized to the nucleus (SIRT1, SIRT6, and SIRT7), mitochondria (SIRT3, SIRT4, and SIRT5), and cytoplasm (SIRT2; ref. 10). One function of the sirtuin gene family is to sense an organism's nutrient requirements and availability and optimize cellular pathways so that energy production matches consumption (11–14). Thus, sirtuins function as fidelity proteins that direct signaling networks via posttranslational modifications involving lysine deacetylation (15, 16) in response to conditions of cellular stress including decreased nutrient availability.

Pyruvate kinase (PK) catalyzes the transfer of phosphate from phosphoenolpyruvate to ADP to yield pyruvate and ATP (17, 18) and determines the production of ATP via oxidative phosphorylation or glycolytic intermediates (19–21). The human genome encodes two PK genes, PKLR and PKM2, which express four PK isoforms: L, R, M1, and M2 (22). When PKM2 is in its active tetramer state, glucose is used for ATP production via oxidative phosphorylation (23, 24). In contrast, when PKM2 dissociates a decrease in enzymatic activity, it is observed that blocks pyruvate production. This leads to the accumulation of upstream intermediates (23, 24) that are used for macromolecule synthesis, including lipids, nucleic acids, and amino acids, in newly dividing cells (25, 26).

The function of PKM2 is dependent on posttranslational modifications such as acetylation, oxidation, phosphorylation, prolyl hydroxylation, and sumoylation (27, 28). Acetylation of PKM2 at K433 by p300 acetyltransferase inhibits its activity, leading to cell proliferation and tumorigenesis (29). Acetylation of K305 decreased the enzymatic activity of PKM2 and promoted its lysosomal-dependent degradation via chaperone-mediated autophagy, which ultimately stimulated the Warburg effect and tumor growth (29, 30). However, the mechanism by which these lysines are acetylated remains undiscovered.

SIRT2 plays an important role in tumor suppression (31, 32) and mice lacking Sirt2 develop liver, gastrointestinal, and mammary tumors (31, 32) and it has been suggested that a loss of metabolic and an increase in glucose metabolism, generally referred to as the Warburg effect, may play a role in this phenotype (12, 33, 34). It has been shown that the dysregulation of PKM2 favors both carcinogenesis and the Warburg effect (23, 25, 30). As such, we hypothesized that the loss of SIRT2 activity, which may occur with increasing age, plays a role in the incidence of solid tumors and one mechanism may involve the dysregulation of energy metabolism.

Cell culture

HEK-293T, HeLa, H1299, MCF-7, and MDA-MB-231 were obtained from ATCC in 2012, authenticated using CellCheck 9 Plus by IDEXX Bioresearch, and tested for mycoplasma using PlasmoTest, Mycoplasma Detection Kit (InvivoGen, Inc). Sirt2−/−-MMT were cultured from Sirt2−/− mammary tumors and verified by PCR and Western blotting. Cell lines were cultured in DMEM (Gibco) supplemented with 10% FBS (Sigma). Genetically altered cell lines were constructed by infecting established lines with lentivirus expressing PKM2, the PKM2 mutants, shPKM2, or other genes. For lentiviral infections, 5 MOIs (multiplicity of infection) were used.

Plasmids, short hairpin RNA constructs, and site-directed mutagenesis

pLKO.1 human SIRT2 short hairpin (shRNA) was generated as AAGTAGTGACAGATGGTTGGC. pLKO.1 human and mouse PKM2 shRNA were generated as CATCTACCACTTGCAATTA and GTGCACTCCACTTCTGTCACT, respectively. pCMV5-Flag-SIRT2 was generated by standard PCR amplification of SIRT2 followed by cloning into the pCMV5-Flag (Sigma). The human SIRT2 and PKM2 genes were cloned into PCDH-CMV vectors (Lentiviral vector, System Biosciences; CD513B-1). Plasmids encoding Flag (DYKDDDDK)-tagged PKM2 (Open Biosystems) were purified and subjected to site-directed mutagenesis (BioInnovatise). WT amino acids (K62 and K305) were either converted to arginine (R) or glutamine (Q). Functionally inactive SIRT2 was created by conversion of H187 (Addgene) to tyrosine (Y).

Western blotting and immunoprecipitation

Cells were lysed for 30 minutes on ice in immunoprecipitation (IP) buffer (11) with protease inhibitors and Trichostatin A (TSA; Sigma). Samples were quantified with BCA assays and analyzed by Western blotting. For IP, cell lysates were incubated with protein-specific antibodies or normal rabbit IgG (Santa Cruz Biotechnology, sc-2027) overnight at 4°C, followed by incubation with protein A/G agarose beads (Millipore; IP10) for 3 hours and washed in lysis buffer supplemented with protease inhibitors. Antibodies for Western blotting were: Flag (Sigma; F3165), HA (Sigma; H9658), actin (Sigma; A5316), tubulin (Sigma; T6074), acetyl-tubulin (Sigma; T7451), SIRT2 (Sigma; S8447), PKM2 (Cell Signaling Technology; 3198), PKM2-Ac-K305 (Dr. Qun-Ying Lei; Fudan University, Shanghai, China), PCAF (Santa Cruz Biotechnology; sc-8999), Tip60 (Santa Cruz Biotechnology; sc-25378), acetyl-lysine (Immunechem; ICP0380), and GAPDH (Millipore; MAB374).

Immunofluorescence

HeLa cells (1 × 104 cells/slide) were fixed with paraformaldehyde, permeabilized with 0.2% Triton X-100 at 4°C with antibodies to: rabbit anti-SIRT2 (Sigma; S8447), mouse anti-PKM2 (Santa Cruz Biotechnology; sc-365684); rabbit anti-Flag (Sigma; F7425), and mouse anti-HA (Sigma; H9658). The FITC- and Cys3-conjugated secondary antibody mixture (BD Pharmingen) was incubated for 1 hour with Vectashield mounting medium with DAPI (Vector Laboratories) and visualized by fluorescence microscope (Olympus, FV1000).

In vitro/tissue culture deacetylation assay

For the in vitro deacetylation assay of PKM2, HEK-293T cells were cotransfected with Flag-PKM2-WT or Flag-PKM2 mutants and histone acetyltransferases (HAT) (PCAF and Tip60), and treated with 1 μmol/L TSA and 20 mmol/L nicotinamide for 12 hours, as described previously (35). For purification of SIRT2, pCMV-Flag-SIRT2-WT or -H187Y was transfected into HEK-293T cells and acetylated PKM2 proteins were resuspended in 20 μL deacetylation reaction buffer (35), and analyzed by Western blotting with anti-acetyl-lysine antibodies (Millipore). For the tissue culture deacetylation assay, HeLa cells were cotransfected with pcDNA3.1-Flag-PKM2, HATs, and HA-SIRT2-WT or -H150Y, immunoprecipitated with anti-Flag agarose beads (Sigma; A2220), and blotted with anti-acetyl-lysine antibody.

Protein purification

The SIRT2 plasmid (pcDNA3-Flag-hSIRT2-WT, -H187Y) or HATs (PCAF, Tip60) and PKM2 plasmid (pcDNA3.1-Flag-PKM2-WT, -K62R, -K305R, K62R/K305R were transiently transfected into HEK-293T cells using polyethylenimine (Polysciences, 24885). Cells were lysed as described in ref. 9, resolved by SDS–PAGE, and stained with Coomassie blue.

PK assay

Cells were washed twice with ice-cold PBS and lysed with PK assay buffer, collected, and PK activity was determined using a PK activity assay kit according to the manufacturer's instructions (BioVision; K709). Total protein was adjusted to 3 μg.

Detection of protein oligomerization using SDS and native gel electrophoresis

Eluted proteins were cross-linked by 0.05% glutaraldehyde on ice for 10 minutes. The reaction was stopped by Laemmli buffer and heating for 5 minutes at 95°C, separated by SDS–PAGE (Invitrogen). Assays in the absence of SDS were harvested and lysed on ice in Native PAGE sample buffer (Invitrogen) supplemented with 0.5% n-dodecyl-β-maltoside and protease inhibitors. Samples were separated followed by Western blotting with anti-PKM2 antibody.

Mass spectrometry sample preparation and mass spectrometry–based proteomics

HATs (p300/CBP, PCAF, GCN5, Tip60) plasmids were cotransfected into HeLa cells, TSA (1 μmol/L) of nicotinamide (20 mmol/L) for 12 hours, lysed in IP buffer, and followed by an in vitro deacetylation assay. The samples were digested by 12.5 ng/μL proteomics-grade trypsin (Sigma; T6567) at an enzyme to protein ratio of 1:40, reimmunoprecipitated with acetyl-lysine–conjugated beads (Immunchem; ICP0388), and peptides were then desalted by solid-phase extraction (Sep-pak C18 cartridges, Waters Corporation; ref. 36). LC/MS-MS analysis of the peptides was performed using a LTQ-Orbitrap mass spectrometer (Thermo Fisher Scientific) with a nanospray source and an Eksigent NanoLC 1D Plus and AS1 Autosampler, as described previously (11).

Cell proliferation and soft-agar assays

For the cell proliferation assay, cells were infected with PKM2-WT and mutants and 50 or 100 cells per well were seeded onto a 6-well plate. After 14 days, the colonies were stained with crystal violet. For the soft-agar colony formation assay, 1 × 103 cells were plated on 0.3% agar and after 14 days, colonies were stained with methylene blue and counted (Microtec Nition).

Human breast cancer tissue array IHC

Breast cancer tissue arrays (catalog no. BC081120) from US Biomax, Inc. and sections were deparaffinized and rehydrated in ethanol in series and processed as published previously (8) using an anti-SIRT2 antibody (1:500, Sigma; S8447), rabbit anti-PKM2 (1:500, Cell Signaling Technology; 3198), or rabbit anti-PKM2-Ac-K305 (1:500). Visualization was performed using a DAB Kit (SK-4100, Vector Laboratories). Bright-field images were captured using a Tissuegnostics microscope and analyzed by Tissuerequest software (Vienna, Austria).

ATP production and glucose uptake assays

The level of intracellular ATP was determined by ATP Colorimetric Assay Kit (Bio vision, K354). Glucose uptake was measured by Fluorimetric Cell-Based Glucose Uptake Assay kit (Bioassay Systems, #EFGU-100). All the measurements were normalized to cell numbers and protein concentration.

Statistical analysis

For comparison of the data presented statistics were done using a two-group, unpaired Student t test, whereas for the comparison of three groups, one-way ANOVA with post hoc analyses were performed via GraphPad Prism software.

Glycolytic metabolism signaling proteins contain reversible acetyl lysines

Sirtuins sense cellular energy requirements as well as availability and direct metabolic pathways to assure that energy production matches consumption. As such, it seemed reasonable to attempt to identify SIRT2 downstream targets involved in glucose metabolism by proteomic analysis. To address this, either Flag-SIRT2 or Flag-overexpressing HeLa cells were cotransfected with HATs, including p300/CBP, PCAF, GCN5, and Tip60. HeLa cells were used as we have significant previous experience using them for sirtuin target discovery experiments and HATs were included to decrease the possibility of false negatives. Proteins were immunoprecipitated using Flag-beads and eluted peptides were then immunoprecipitated again using acetyl-lysine–conjugated beads to enriching the samples for acetylated proteins. LC/MS-MS analysis of the final eluted SIRT2-trapped proteins was performed using an LTQ-Orbitrap mass spectrometer. These experiments identified SIRT2 downstream deacetylation target proteins, including those involved in the glycolysis pathway (Table 1).

Table 1.

SIRT2 downstream deacetylation target proteins in the glycolysis pathway

Spectral counts
GeneAmino acidSequenceGFPSIRT2
PKM2 62 SVETLKEMIK 11 
PKM2 305 GDLGIEIPAEKVFLAQK 
ENO1 60 YMGKGVSK 
ENO1 126 AGAVEKGVPLYR 
ENO1 221 EGGFAPNILENKEGLELLK 
ENO1 199 NVIKEKYGK 
ENO1 256 SGKYDLDFKSPDDPSR16  
ENO1 422 AKFAGR 
LDHB EKLIAPVAEEEATVPNNK 
LDHB 82 IVADKDYSVTANSK 
ALDOA 42 GILAADESTGSIAKR 
ALDOA 147 DGADFAKWR 
ALDOA 330 AAQEEYVKR 
PGK1 11 LTLDKLDVK 
PGK1 106 GPEVEKAANPAAGSVILLEN 
PGK1 146 AEPAKIEAFR 
PGK1 291 ITLPVDFVTADKFDENAK 
PGK1 361 ALMDEVVKATSR 
GAPDH 194 TVDGPSGKLWR 
GAPDH 254 LEKPAKYDDIKK 14 
GAPDH 259 LEKPAKYDDIKK 
GAPDH 334 VVDLMAHMASKE 
PCDHB 198 TATPQQAQEVHEKLR 
TRFP 124 SNTPILVDGKDVMPEVNKVLDK 
Spectral counts
GeneAmino acidSequenceGFPSIRT2
PKM2 62 SVETLKEMIK 11 
PKM2 305 GDLGIEIPAEKVFLAQK 
ENO1 60 YMGKGVSK 
ENO1 126 AGAVEKGVPLYR 
ENO1 221 EGGFAPNILENKEGLELLK 
ENO1 199 NVIKEKYGK 
ENO1 256 SGKYDLDFKSPDDPSR16  
ENO1 422 AKFAGR 
LDHB EKLIAPVAEEEATVPNNK 
LDHB 82 IVADKDYSVTANSK 
ALDOA 42 GILAADESTGSIAKR 
ALDOA 147 DGADFAKWR 
ALDOA 330 AAQEEYVKR 
PGK1 11 LTLDKLDVK 
PGK1 106 GPEVEKAANPAAGSVILLEN 
PGK1 146 AEPAKIEAFR 
PGK1 291 ITLPVDFVTADKFDENAK 
PGK1 361 ALMDEVVKATSR 
GAPDH 194 TVDGPSGKLWR 
GAPDH 254 LEKPAKYDDIKK 14 
GAPDH 259 LEKPAKYDDIKK 
GAPDH 334 VVDLMAHMASKE 
PCDHB 198 TATPQQAQEVHEKLR 
TRFP 124 SNTPILVDGKDVMPEVNKVLDK 

SIRT2 knockdown or genetic deletion alters glycolytic metabolism and PK activity

A careful analysis of the mass spectrometry data identified PKM2 as a potential reversible acetyl protein that directs glucose metabolism. As such, SIRT2 was knocked down by transfecting shSIRT2 RNA into H1299 cells to create a tissue culture model that contains decreased SIRT2 deacetylation activity. These genetically altered cells exhibited a decrease in PKM2 activity (Fig. 1A) as well as an increase in lactate production (Fig. 1B), suggesting a dysregulation of PKM2 activity and glucose metabolism. This was observed both under low (3 mmol/L) and high glucose (25 mmol/L) conditions, although the difference was more dramatic at high glucose. The effectiveness of the shSIRT2 was validated through Western blotting (Fig. 1C). These experiments were repeated in MCF-7, MDA-MB-231, and HeLa cell lines and a very similar change in PK activity (Supplementary Fig. S1A) and glycolysis (Supplementary Fig. S1B) was observed. Finally, similar outcomes were assessed using a tumor cell line isolated from a Sirt2−/− mouse mammary tumor (referred to as Sirt2−/−-MMT). Sirt2−/−-MMT cells transfected with wild-type (WT) SIRT2 exhibited an increase in PK activity, as well as a decrease in lactate production (Fig. 1D).

Figure 1.

SIRT2 knockdown alters PK activity and glycolytic metabolism. A and B, H1299 cells were infected with a control vector or shSIRT2 and cultured in low (3 mmol/L) and high glucose (25 mmol/L) media. PK activity (A) and lactate production (B) assays were performed according to the manufacturer's procedures. Lactate production was used as a measure of the glycolytic rate. C, SIRT2 was knocked down in H1299 cells and SIRT2 and tubulin levels were determined by Western analysis using anti-SIRT2 and tubulin antibodies. D, Sirt2−/−-MMT cells were isolated from a mammary tumor in mice lacking Sirt2 and subsequently infected with either a control virus (PCDH) or lenti-SIRT2. Cellular extracts were isolated and immunoblotted with an anti-SIRT2 or tubulin antibody. E and F, Sirt2−/-MMT cells infected with PCDH or lenti-SIRT2 were used to measure PK activity (E) and glycolysis (F). All experiments were done in triplicate. Representative images are shown. Error bars represent one SD from the mean. *, P < 0.05; **, P < 0.01.

Figure 1.

SIRT2 knockdown alters PK activity and glycolytic metabolism. A and B, H1299 cells were infected with a control vector or shSIRT2 and cultured in low (3 mmol/L) and high glucose (25 mmol/L) media. PK activity (A) and lactate production (B) assays were performed according to the manufacturer's procedures. Lactate production was used as a measure of the glycolytic rate. C, SIRT2 was knocked down in H1299 cells and SIRT2 and tubulin levels were determined by Western analysis using anti-SIRT2 and tubulin antibodies. D, Sirt2−/−-MMT cells were isolated from a mammary tumor in mice lacking Sirt2 and subsequently infected with either a control virus (PCDH) or lenti-SIRT2. Cellular extracts were isolated and immunoblotted with an anti-SIRT2 or tubulin antibody. E and F, Sirt2−/-MMT cells infected with PCDH or lenti-SIRT2 were used to measure PK activity (E) and glycolysis (F). All experiments were done in triplicate. Representative images are shown. Error bars represent one SD from the mean. *, P < 0.05; **, P < 0.01.

Close modal

SIRT2 physically interacts with PKM2

As mass spectrometry data identified PKM2 as a potential reversible acetyl protein (Table 1) and PKM2 activity is dysregulated in cells lacking or exhibiting a decrease in SIRT2 activity (Fig. 1A–D). As such, HEK-293T cells were transiently transfected with Flag-SIRT2 or pGFP and total protein extracts were immunoprecipitated using anti-Flag or PKM2 antibodies, respectively. The results from these experiments showed an interaction between PKM2 and SIRT2 (Fig. 2A). To further confirm this interaction, a reverse coimmunoprecipitation was performed after PKM2 transfection and demonstrated that endogenous SIRT2 binds to PKM2 (Fig. 2B). Immunofluorescence staining showed that SIRT2 and PKM2 colocalized in the cytoplasm (Fig. 2C, top) and similar results were obtained when HA-SIRT2 and Flag-PKM2 were cotransfected into HeLa cells (Fig. 1C, bottom). We also performed in vitro acetylation assays to identify HATs that acetylate PKM2. For this experiment, p300, CBP, GCN5, PCAF, Tip60 as well as Flag-PKM2 were cotransfected into HEK-293T cells, immunoprecipitated by anti-Flag and anti-PKM2 antibodies, followed by immunoblotting with anti-pan-acetyl-lysine antibody. These results indicate that PCAF (P300/CBP-associated factor) and Tip60, supporting previous data (29), are PKM2 acetyltransferases (Supplementary Fig. S2A and S2B). In addition, PKM2 is not deacetylated by SIRT1, SIRT6, or HDAC6 proteins (Supplementary Fig. S2C). Finally, knocking down PKM2 expression did not change PKM1 protein levels (Supplementary Fig. S2D).

Figure 2.

SIRT2 physically interacts with PKM2. A, Flag-SIRT2 or pGFP plasmid were transiently transfected into HEK-293T cells. Total protein extracts were immunoprecipitated with either anti-PKM2 or Flag antibodies and subsequently separated by SDS–PAGE, followed by Western blotting with an anti-PKM2, Flag, or tubulin antibody. B, endogenous PKM2 or SIRT2 were immunoprecipitated from HeLa cell lysates and separated via SDS–PAGE, followed by Western blotting with anti-PKM2 and SIRT2 antibodies. C, endogenous SIRT2 and PKM2 were stained by anti-SIRT2 and anti-PKM2 antibodies in HeLa cells (top). HA-SIRT2 and Flag-PKM2 were cotransfected into HeLa cells (bottom), stained with anti-HA and FLAG antibodies, and subsequently visualized by confocal microscopy. Scale bar, 30 μm. Representative images are shown. All experiments were done in triplicate.

Figure 2.

SIRT2 physically interacts with PKM2. A, Flag-SIRT2 or pGFP plasmid were transiently transfected into HEK-293T cells. Total protein extracts were immunoprecipitated with either anti-PKM2 or Flag antibodies and subsequently separated by SDS–PAGE, followed by Western blotting with an anti-PKM2, Flag, or tubulin antibody. B, endogenous PKM2 or SIRT2 were immunoprecipitated from HeLa cell lysates and separated via SDS–PAGE, followed by Western blotting with anti-PKM2 and SIRT2 antibodies. C, endogenous SIRT2 and PKM2 were stained by anti-SIRT2 and anti-PKM2 antibodies in HeLa cells (top). HA-SIRT2 and Flag-PKM2 were cotransfected into HeLa cells (bottom), stained with anti-HA and FLAG antibodies, and subsequently visualized by confocal microscopy. Scale bar, 30 μm. Representative images are shown. All experiments were done in triplicate.

Close modal

PKM2 lysine 305 is a direct SIRT2 deacetylation target

To determine the mechanisms through which SIRT2 directs PKM2, an in vitro deacetylation assay was done. HEK-293T cells were transfected with Flag-PKM2 in the presence of HATs. This is done as a tissue culture model system where proteins are relatively acetylated as might be expected in a nutrient-rich cellular environment. Cell lysate was immunoprecipitated with an anti-Flag antibody and mixed with either purified WT (SIRT2-WT) or enzymatically inactive (SIRT2-H187Y) SIRT2. Samples were next immunoblotted with a pan anti-acetyl-lysine, anti-PKM2, or anti-SIRT2 antibody. These experiments showed a decrease in PKM2 total protein acetylation when mixed with WT SIRT2, but not in control samples or those mixed with the deacetylation-null SIRT2-H187Y (Fig. 3A, lane 1, 2, and 4 vs. 3). A tissue culture deacetylation assay was also performed by transiently transfecting HATs and Flag-PKM2 with either HA-SIRT2-WT or HA-SIRT2-H187Y into HeLa cells. These experiments also showed that cells transfected with WT SIRT2 exhibited significantly lower PKM2 acetylation, as compared with either control cells (Fig. 3B, lane 2 vs. 1) or cells transfected with SIRT2-H187Y (lane 2 vs. 3). Finally, these samples were subject to LC/MS-MS analysis to detect acetylated PKM2 peptides. Such analysis showed that lysines K62 (Supplementary Fig. S3A) and K305 (Fig. 3C) were acetylated. A genomic analysis was done demonstrating that K62 and K305 are highly conserved among different species throughout evolution (Supplementary Fig. S3B and S3C). Overall, these results support the idea that PKM2 is a direct SIRT2 deacetylation target.

Figure 3.

PKM2 lysine 305 is a direct SIRT2 deacetylation target. A, for in vitro deacetylation assay, HEK-293T cells were treated with 1 μmol/L of TSA for 12 hours and transfected with HATs (p300/CBP, PCAF, GCN5, Tip60) as well as Flag-PKM2. Cells were harvested and PKM2 was immunoprecipitated with an anti-Flag antibody. PKM2 was subsequently mixed with WT or deacetylation-null isolated SIRT2 in the presence of NAD+, and the reaction mixtures were separated by SDS–PAGE and immunoblotted with anti-pan-acetyl-lysine, PKM2, and SIRT2 antibodies. B, for tissue culture deacetylation assay, HeLa cells were transfected with HATs, Flag-PKM2, and with either HA-SIRT2-WT or HA-SIRT2-H187Y, followed by a Flag-IP. Extracts were separated and immunoblotted with anti-pan-acetyl-lysine, Flag, and HA antibodies. C, LC/MS-MS of PKM2 showing the acetylation of PKM2 K305. HeLa cells were treated with 1 μmol/L of TSA and transfected with HATs (p300/CBP, PCAF, GCN5, Tip60) along with either a SIRT2 or GFP expression vector. Cellular protein extracts were sent for LC/MS-MS analysis of the acetylation intensity of PKM2 peptides. D, HEK-293T cells were transfected with HA-PKM2-WT or deacetylation mimetic mutants, PKM2K62R, PKM2K305R, or PKM2K6R2/K305R, as well as HATs and TSA. PKM2 was immunoprecipitated, mixed with WT isolated SIRT2 with NAD+ (and NAM as a control) and reaction mixtures were separated and immunoblotted with anti-pan-acetyl-lysine, and flag antibodies. E, Sirt2−/−-MMT cells isolated from a mammary tumor in mice lacking Sirt2 were stably infected with PCDH or Flag-SIRT2-WT, cultured in 0.5% or 10% serum and 3 mmol/L (low) or 25 mmol/L (high) glucose, immunoprecipitated with an anti-PKM2 antibody, and immunoblotted with either anti-PKM2-Ac-K305, PKM2, or SIRT2, acetyl-tubulin (Ac-tubulin), and tubulin antibodies. F, Sirt2−/−-MMT cells were stably infected with PCDH or Flag-SIRT2-WT, were cultured in 0.5% or 10% serum and 3 mmol/L (low) or 25 mmol/L (high) glucose. Cell lysates were immunoblotted by anti-PKM2-Ac-K305, PKM2, Flag, Ac-tubulin, tubulin, and actin antibodies. ns, nonspecific band. Representative images are shown. All experiments were done in triplicate.

Figure 3.

PKM2 lysine 305 is a direct SIRT2 deacetylation target. A, for in vitro deacetylation assay, HEK-293T cells were treated with 1 μmol/L of TSA for 12 hours and transfected with HATs (p300/CBP, PCAF, GCN5, Tip60) as well as Flag-PKM2. Cells were harvested and PKM2 was immunoprecipitated with an anti-Flag antibody. PKM2 was subsequently mixed with WT or deacetylation-null isolated SIRT2 in the presence of NAD+, and the reaction mixtures were separated by SDS–PAGE and immunoblotted with anti-pan-acetyl-lysine, PKM2, and SIRT2 antibodies. B, for tissue culture deacetylation assay, HeLa cells were transfected with HATs, Flag-PKM2, and with either HA-SIRT2-WT or HA-SIRT2-H187Y, followed by a Flag-IP. Extracts were separated and immunoblotted with anti-pan-acetyl-lysine, Flag, and HA antibodies. C, LC/MS-MS of PKM2 showing the acetylation of PKM2 K305. HeLa cells were treated with 1 μmol/L of TSA and transfected with HATs (p300/CBP, PCAF, GCN5, Tip60) along with either a SIRT2 or GFP expression vector. Cellular protein extracts were sent for LC/MS-MS analysis of the acetylation intensity of PKM2 peptides. D, HEK-293T cells were transfected with HA-PKM2-WT or deacetylation mimetic mutants, PKM2K62R, PKM2K305R, or PKM2K6R2/K305R, as well as HATs and TSA. PKM2 was immunoprecipitated, mixed with WT isolated SIRT2 with NAD+ (and NAM as a control) and reaction mixtures were separated and immunoblotted with anti-pan-acetyl-lysine, and flag antibodies. E, Sirt2−/−-MMT cells isolated from a mammary tumor in mice lacking Sirt2 were stably infected with PCDH or Flag-SIRT2-WT, cultured in 0.5% or 10% serum and 3 mmol/L (low) or 25 mmol/L (high) glucose, immunoprecipitated with an anti-PKM2 antibody, and immunoblotted with either anti-PKM2-Ac-K305, PKM2, or SIRT2, acetyl-tubulin (Ac-tubulin), and tubulin antibodies. F, Sirt2−/−-MMT cells were stably infected with PCDH or Flag-SIRT2-WT, were cultured in 0.5% or 10% serum and 3 mmol/L (low) or 25 mmol/L (high) glucose. Cell lysates were immunoblotted by anti-PKM2-Ac-K305, PKM2, Flag, Ac-tubulin, tubulin, and actin antibodies. ns, nonspecific band. Representative images are shown. All experiments were done in triplicate.

Close modal

To determine whether PKM2 K62 and K305 are direct SIRT2 deacetylation targets, we generated a series of PKM2 K62 and K305 mutants, including Flag-PKM2, Flag-PKM2K62R, Flag-PKM2K305R, and Flag-PKM2K62R/K305R. In these mutants, the substitution of a lysine with an arginine mimics constitutive deacetylation (9). These vectors were subsequently transfected into HEK-293T cells, and an in vitro deacetylation assay was performed. These results showed that PKM2−K305R and PKM2−K62/K305R exhibited lower acetylation levels as compared with PKM2-K62R (Fig. 3D, lanes 3 and 4 vs. lane 2), suggesting that lysine 305, but not 62, is deacetylated by SIRT2. Thus, when K305 is mutated, only K62 can be acetylated, and as such, the greater acetylation in the presence of K62R means that K305 was the primary contributor to the acetylation, as has been shown by other (30), whereas the lower acetylation in the presence of K305R means that K62 was not acetylated.

A tissue culture deacetylation assay was performed using Sirt2−/−-MMT that stably overexpress WT SIRT2 or PCDH (a vector only negative control). Cells in low and high serum were isolated and exogenous PKM2 was immunoprecipitated using an anti-Flag antibody and extracts were subsequently immunoblotted with a previously described anti-PKM2-Ac-K305 antibody (29). These experiments showed a decrease in PKM2 K305 acetylation in Sirt2−/−-MMT cells expressing WT SIRT2 in low (Fig. 3E, lane 1 vs. 3) and high serum (lane 2 vs. 4) conditions. The deacetylation of acetyl-tubulin is a positive control (bottom two panels). Interestingly, the decrease was greatest in cells cultured in low serum, suggesting that high tissue culture nutrient conditions may slightly decrease SIRT2 activity, resulting in a small increase in PKM2 acetylation (lane 3 vs. 4). These tissue culture deacetylation assays using the anti-PKM2-Ac-K305 antibody were repeated with both high and low serum and high and low glucose.

To further address the idea that nutrient conditions may direct SIRT2 deacetylation activity, these experiments were repeated in high and low serum as well as low glucose levels. These tissue culture deacetylation assays using the anti-PKM2-Ac-K305 antibody showed that cotransfection of SIRT2 decreased PKM2 acetylation levels (Fig. 3F, lanes 1, 3, 5, and 7 vs. lanes 2, 4, 6, and 8). In addition, the acetylation of PKM2 was lowest in cells cotransfection of SIRT2 that were cultured in both low serum and glucose (Fig. 3F, lane 6) as compared with cells cultured in high serum and low glucose (lane 2) or high glucose and low serum (lane 8). These results suggest that SIRT2 is less active in cells maintained in a nutrient-rich environment, whereas in low serum or low glucose levels, SIRT2 deacetylation activity is increased, resulting in a decrease in PKM2 K305 acetylation. Overall, these results strongly support the idea that PKM2 lysine 305 is a reversibly acetylated lysine and a direct SIRT2 deacetylation target.

Acetylation status of K305 directs PKM2 activity

To determine whether the acetylation status of PKM2 directs enzymatic activity, an in vitro PK activity assay was performed in HeLa cells infected with shPKM2 to decrease WT PKM2 levels. These HeLa-PKM2–knockdown cells were subsequently transfected with Flag-PKM2-WT and the expression vectors for several PKM2 mutants (FlagPKM2K62Q, FlagPKM2K305Q, and FlagPKM2K62Q/K305Q). In these mutants, the substitution of a lysine with a glutamine mimics constitutive acetylation (8, 9, 37). When lysine 305 was substituted with glutamine (K305Q or K62Q/K305Q), PK activity was significantly lower (Fig. 4A) and lactate production was higher, as compared with WT- or K62Q-transfected control cells (Fig. 4B) although PKM2 expression levels were similar (Fig. 4C). In contrast, when K62 was substituted with glutamine (K62Q), there was no significant change in PK activity or lactate levels compared with those of WT control cells (Fig. 4A and 4B).

Figure 4.

Acetylation status of K305 directs PKM2 activity. A–C, HeLa cells were infected with shPKM2 and were subsequently transiently transfected with Flag-PKM2 and the PKM2-mutant acetylated mimic expression vectors Flag-PKM2K62Q, Flag-PKM2K305Q, Flag-PKM2K62Q/K305Q. PK activity (A) and lactate production assay (B) were performed using eluted PKM2-WT protein as well as protein from cells transfected with the PKM2 mutants. *, P < 0.05; **, P < 0.01. C, extracts from the shPKM2 cells transfected with these expression vectors were immunoblotted with anti-Flag and tubulin antibodies. D and F, PKM2 was knocked down in Sirt2−/−-MMT cells that were subsequently transfected with Flag-PKM2WT, Flag-PKM2K305R, and Flag-PKM2K305Q. Glucose uptake (D), lactate production (E), and ATP production assays (F) were performed. G, Sirt2−/−-MMT cells were infected with lenti-SIRT-WT, and control and SIRT2-expressing stable cells were lysed in native-PAGE sample buffer, separated by native-PAGE or SDS–PAGE, and immunoblotted with anti-PKM2, SIRT2, and tubulin antibodies. H and I, HeLa cells were transfected with HATs (PCAF/Tip60) with either Flag-PKM2 or the PKM2 deacetylation mimic mutants, Flag-PKM2K62R and Flag-PKM2K305R (H). HeLa cells were transfected with Flag-PKM2 or Flag-PKM2 acetylation mimic mutants, Flag-PKM2K62Q and Flag-PKM2K305Q (I). Cells then were lysed and acetylated PKM2 proteins were eluted by Flag peptide. Eluted proteins were cross-linked by 0.05% glutaraldehyde on ice. The samples were separated by SDS–PAGE and immunoblotted with anti-PKM2 and tubulin antibodies.

Figure 4.

Acetylation status of K305 directs PKM2 activity. A–C, HeLa cells were infected with shPKM2 and were subsequently transiently transfected with Flag-PKM2 and the PKM2-mutant acetylated mimic expression vectors Flag-PKM2K62Q, Flag-PKM2K305Q, Flag-PKM2K62Q/K305Q. PK activity (A) and lactate production assay (B) were performed using eluted PKM2-WT protein as well as protein from cells transfected with the PKM2 mutants. *, P < 0.05; **, P < 0.01. C, extracts from the shPKM2 cells transfected with these expression vectors were immunoblotted with anti-Flag and tubulin antibodies. D and F, PKM2 was knocked down in Sirt2−/−-MMT cells that were subsequently transfected with Flag-PKM2WT, Flag-PKM2K305R, and Flag-PKM2K305Q. Glucose uptake (D), lactate production (E), and ATP production assays (F) were performed. G, Sirt2−/−-MMT cells were infected with lenti-SIRT-WT, and control and SIRT2-expressing stable cells were lysed in native-PAGE sample buffer, separated by native-PAGE or SDS–PAGE, and immunoblotted with anti-PKM2, SIRT2, and tubulin antibodies. H and I, HeLa cells were transfected with HATs (PCAF/Tip60) with either Flag-PKM2 or the PKM2 deacetylation mimic mutants, Flag-PKM2K62R and Flag-PKM2K305R (H). HeLa cells were transfected with Flag-PKM2 or Flag-PKM2 acetylation mimic mutants, Flag-PKM2K62Q and Flag-PKM2K305Q (I). Cells then were lysed and acetylated PKM2 proteins were eluted by Flag peptide. Eluted proteins were cross-linked by 0.05% glutaraldehyde on ice. The samples were separated by SDS–PAGE and immunoblotted with anti-PKM2 and tubulin antibodies.

Close modal

The results given above measure total lactate production and as such, it seems reasonable to determine whether the increase in glucose is a result of maintaining a constant flux split ratio from increased lactate production and mitochondrial respiration. Thus, PKM2 was knocked down in Sirt2−/−-MMT cells (i.e., loss of Sirt2 and PKM2 cells) and these cells were subsequently transfected with FlagPKM2WT, FlagPKM2K305R, and FlagPKMK305Q (Supplementary Fig. S4). These experiments showed an increase in glucose uptake (Fig. 4D) and lactate production (Fig. 4E) in cells transfected with the PKM2 K-Q acetylated mutant. In contrast, ATP production was increased in cells transfected with the PKM2 K-R deacetylated mutant (Fig. 4F, bar 1 vs. 2) and decreased with the PKM2 K-Q acetylated mutant (bar 3 vs. 4).

It is known that the active form of PKM2 is a tetramer, and it is proposed that posttranslational modifications disrupt tetramer formation and, thereby, PK activity. As such, Sirt2−/−-MMT and Sirt2−/−-MMT cells stably expressing exogenous SIRT2 were harvested and prepared for native-PAGE analysis. SIRT2 reexpression in Sirt2−/−-MMT produced higher levels of PKM2 tetramer formation, as compared with Sirt2−/−-MMT cells (Fig. 4G). In addition, similar experiments were done using the PKM2 deacetylation mimic mutants (K62R and K305R) and the PKM2 acetylation mimic mutants (K62Q and K305Q), these experiments showed that K305 favors the formation of the active, tetrameric form of PKM2 (Fig. 4H and I and Supplementary Fig. S5). These results suggest, for the first time, that the acetylation status of PKM2, as directed by SIRT2, determines enzymatic activity via a mechanism involving the complex formation that forms the PKM2 tetramer.

Acetylated PKM2 contributes to tumor cell proliferation

It is well known that aberrant glycolysis is one of the major hallmarks of carcinogenesis and that increased glucose metabolism is related to tumor cell proliferation. Therefore, to assess the contribution of the SIRT2/PKM2 axis to these events, PKM2 was knocked down in Sirt2−/−-MMT cells by shPKM2, and cells were subsequently infected with Flag-PKM2-WT, FlagPKM2K305R, and FlagPKM2K62R/K305R to stably overexpress these genes. Protein levels in these cell lines were confirmed by Western blotting (Supplementary Fig. S4). These experiments clearly showed that cells expressing the deacetylated PKM2 protein exhibited a decrease in tumor cell proliferation (Fig. 5A, top and B) and growth in soft agar (Fig. 5A, middle and bottom, C), consistent with a less aggressive phenotype. In addition, similar experiments were done using the PKM2 acetylation mimic mutants (FlagPKM2K305Q, and FlagPKM2K62R/K305Q) in reoverexpressed SIRT2 of Sirt2−/−-MMT cells showed that cells expressing the acetylated K305-PKM2 protein exhibited an increase in tumor cell proliferation (Fig. 5D, top) and growth in soft agar (Fig. 5D, bottom).

Figure 5.

The PKM2 deacetylation mimetic mutants inhibit tumor growth. A–C, Sirt2−/−-MMT cells were infected with shPKM2 and reinfected with Flag-SIRT2-WT, Flag-PKM2-WT, Flag-PKM2K305R, or Flag-PKM2K62R/K305R. These cell lines were subsequently used for representative images of cell proliferation assays (doubling time; A, top, and B) and growth in soft-agar assays (A, middle and bottom, and C), as measured by colony formation (invasion assay). Scale bar, 100 μm. *, P < 0.05; **, P < 0.01. D, Sirt2−/−-MMT cells were infected with shPKM2 and reinfected with Flag-SIRT2-WT, Flag-PKM2-WT, Flag-PKM2K305Q, or Flag-PKM2K62R/K305Q. These cells were used for cell proliferation assays (top) and soft-agar assays (bottom). Experiments were repeated three times and data expressed as mean ± SEM. Representative images are shown.

Figure 5.

The PKM2 deacetylation mimetic mutants inhibit tumor growth. A–C, Sirt2−/−-MMT cells were infected with shPKM2 and reinfected with Flag-SIRT2-WT, Flag-PKM2-WT, Flag-PKM2K305R, or Flag-PKM2K62R/K305R. These cell lines were subsequently used for representative images of cell proliferation assays (doubling time; A, top, and B) and growth in soft-agar assays (A, middle and bottom, and C), as measured by colony formation (invasion assay). Scale bar, 100 μm. *, P < 0.05; **, P < 0.01. D, Sirt2−/−-MMT cells were infected with shPKM2 and reinfected with Flag-SIRT2-WT, Flag-PKM2-WT, Flag-PKM2K305Q, or Flag-PKM2K62R/K305Q. These cells were used for cell proliferation assays (top) and soft-agar assays (bottom). Experiments were repeated three times and data expressed as mean ± SEM. Representative images are shown.

Close modal

PKM2 K305 acetylation status correlates with recurrence in human breast cancer samples

On the basis of the results given above, it seemed reasonable to determine a potential relationship between SIRT2 and PKM2 acetylation in breast cancer tumor clinical samples. Thus, we compared the immunohistochemical staining intensities of SIRT2 and PKM2 acetylated at K305 (PKM2-Ac-K305) in human breast cancer samples (Fig. 6A–C). A total of 40 breast tumors were analyzed by immunohistochemical assay and blindly analyzed by two expert investigators. Interestingly, a negative correlation between the levels of SIRT2 and PKM2-Ac-K305 was found (Pearson correlation coefficient, R = −0.6914, P < 0.0001, n = 40 patients; Fig. 6B). We further separated the tumor samples into high and low SIRT2 expression groups, according to their staining intensities. Tumors with high SIRT2 expression showed low PKM2-Ac-K305 expression, and vice versa (P < 0.001, n = 20; Fig. 6A and C). Taken together, these results suggest that a negative correlation exists between SIRT2 and PKM2 acetylation in breast cancer, and thus PKM2 K305 acetylation status might be used to predict tumor progression in human breast cancer.

Figure 6.

PKM2 K305 acetylation status correlates with recurrence risk in human breast cancer samples. A, representative bright-field images showing SIRT2, PKM2-Ac-K305, and PKM2 staining (brown) in human breast cancer sections. Nuclei (blue) were marked by hematoxylin staining. Scale bar, 50 μm. B, dot plot correlates the level of PKM2-Ac-K305 (y-axis) and SIRT2 (x-axis) expression in 40 human breast cancer cases. The dotted line shows the negative correlation of SIRT2 and PKM2-Ac-K305. Pearson r =−0.6914, P < 0.0001 (correlation analysis by Prism 6). C, the bar graph shows the average intensity of PKM2-Ac-K305 signals in 20 high SIRT2 expression cases and 20 low SIRT2 expression cases. ***, P < 0.001. Experiments were repeated three times and data expressed as mean ± SEM. Representative images are shown. D, schematic summarizing the role of SIRT2 in directing PKM2 acetylation (PMK2-K305) in tumor cell growth.

Figure 6.

PKM2 K305 acetylation status correlates with recurrence risk in human breast cancer samples. A, representative bright-field images showing SIRT2, PKM2-Ac-K305, and PKM2 staining (brown) in human breast cancer sections. Nuclei (blue) were marked by hematoxylin staining. Scale bar, 50 μm. B, dot plot correlates the level of PKM2-Ac-K305 (y-axis) and SIRT2 (x-axis) expression in 40 human breast cancer cases. The dotted line shows the negative correlation of SIRT2 and PKM2-Ac-K305. Pearson r =−0.6914, P < 0.0001 (correlation analysis by Prism 6). C, the bar graph shows the average intensity of PKM2-Ac-K305 signals in 20 high SIRT2 expression cases and 20 low SIRT2 expression cases. ***, P < 0.001. Experiments were repeated three times and data expressed as mean ± SEM. Representative images are shown. D, schematic summarizing the role of SIRT2 in directing PKM2 acetylation (PMK2-K305) in tumor cell growth.

Close modal

Tumor cells exhibit increased rates of glycolysis even in the presence of oxygen and this physiologic reprogramming is referred to as the Warburg effect (21, 33, 38). PKM2 is a critical regulatory node in directing glucose metabolism, and its dysregulation via one of several potentially aberrant processes is associated with a phenotype similar to the Warburg effect (17, 19, 24, 39). PKM2 is a unique metabolic enzyme that shows a cancer-specific switch of expression from PKM1 to PKM2 (29, 30). It has previously been shown that PKM2 activity is directed by changes in acetylation of lysines 305 (30) and 433 (29); however, the mechanism that directing its posttranslational acetylation remains unknown.

This work suggests that this is one mechanism by which acetylation directs PKM2 enzymatic activity is due to the deacetylation of K305, by SIRT2, that directs activity via a mechanism that favors a tetrameric structure. In addition, using anti-SIRT2 and PKM2-Ac-K305 antibodies, we have shown that human breast cancer samples that exhibit high SIRT2 expression showed low PKM2-Ac-K305 levels. We also showed vesicular-like cytoplasm punctate staining cytoplasm that might result from its colocalization with microtubules. As we have previously shown that female mice lacking Sirt2 developed mammary tumors, and we have now extended these results to identify a subgroup of breast cancer malignancies that exhibit a loss-of-SIRT2/PMK2 signature. This information may be used in the future in personalized therapy to predict risk for tumorigenesis and tumor recurrence.

Thus, under conditions of nutrient excess, SIRT2 activity is decreased, which increases PKM2 acetylation as well as enzymatic activity. This favors lactate production while simultaneously decreasing the accumulation of pyruvate creating a metabolic state similar to the Warburg effect (Fig. 6D). It is also proposed that a decrease in PKM2 activity results in a tumor proliferation permissive resistance phenotype. In contrast, under conditions lacking sufficient nutrients, it would be proposed that SIRT2, and other sirtuins, would be active, resulting in the deacetylation of multiple downstream targets including PKM2. This would activate PKM2 and favor the accumulation of pyruvate that would feed substrates used by Krebs cycle and oxidative phosphorylation (Fig. 6D).

One important and unaddressed question in regards to SIRT2 biology is: what are the dysregulated downstream targets that create a tumor permissive phenotype. For example, loss of Sirt2 has been shown to dysregulate DNA repair (40), cell-cycle checkpoints (31), energy metabolism and/or lipid biosynthesis (41), and inflammation (42) and all of these pathways may play a role, at least in some part, in a tumor permissive phenotype. This work adds to this list. Finally, it has been previously shown that lysine acetylation modifications can direct the complex formation of PKM2 and acetylation of K305 prevents tetramer formation that subsequently promotes a glycolytic as well as progrowth tumor cell phenotype.

No potential conflicts of interest were disclosed.

Conception and design: S.-H. Park, O. Ozden, Y.-I. Cha, D. Gius

Development of methodology: S.-H. Park, G. Liu

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): S.-H. Park, G. Liu, Y. Zhu, Y. Yan, X. Zou, D.R. Principe, Y.-I. Cha

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): S.-H. Park, O. Ozden, G. Liu, H.Y. Song, Y. Zhu, X. Zou, H.-J. Kang, D.R. Principe, A. Vassilopoulos

Writing, review, and/or revision of the manuscript: S.-H. Park, O. Ozden, G. Liu, H.Y. Song, Y. Zhu, Y. Yan, X. Zou, H.-J. Kang, M. Roh, A. Vassilopoulos, D. Gius

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): S.-H. Park, G. Liu, H.Y. Song, H. Jiang, A. Vassilopoulos, D. Gius

Study supervision: S.-H. Park

The authors thank Melissa Stauffer, PhD, of Scientific Editing Solutions, for providing editorial assistance.

D. Gius is supported by 2R01CA152601-06A1, 1R01CA152799-01A1, 1R01CA168292-01A1, and 1R01CA16383801A1. A. Vassilopoulos is supported by NCI-R01CA182506-01A1, the Lefkofsky Family Foundation/Liz and Eric Lefkofsky Innovation Research Award. Y. Zhu is supported by a Robert H. Lurie Translation Bridge Fellowship Award.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Wang
RH
,
Zheng
Y
,
Kim
HS
,
Xu
X
,
Cao
L
,
Luhasen
T
, et al
Interplay among BRCA1, SIRT1, and Survivin during BRCA1-associated tumorigenesis
.
Mol Cell
2008
;
32
:
11
20
.
2.
Wang
RH
,
Sengupta
K
,
Li
C
,
Kim
HS
,
Cao
L
,
Xiao
C
, et al
Impaired DNA damage response, genome instability, and tumorigenesis in SIRT1 mutant mice
.
Cancer Cell
2008
;
14
:
312
23
.
3.
Finkel
T
,
Deng
CX
,
Mostoslavsky
R
. 
Recent progress in the biology and physiology of sirtuins
.
Nature
2009
;
460
:
587
91
.
4.
Sinclair
DA
. 
Toward a unified theory of caloric restriction and longevity regulation
.
Mech Ageing Devel
2005
;
126
:
987
1002
.
5.
Guarente
L
,
Picard
F
. 
Calorie restriction–the SIR2 connection
.
Cell
2005
;
120
:
473
82
.
6.
Kim
EJ
,
Kho
JH
,
Kang
MR
,
Um
SJ
. 
Active regulator of SIRT1 cooperates with SIRT1 and facilitates suppression of p53 activity
.
Mol Cell
2007
;
28
:
277
90
.
7.
Wood
JG
,
Rogina
B
,
Lavu
S
,
Howitz
K
,
Helfand
SL
,
Tatar
M
, et al
Sirtuin activators mimic caloric restriction and delay ageing in metazoans
.
Nature
2004
;
430
:
686
9
.
8.
Kim
HS
,
Patel
K
,
Muldoon-Jacobs
K
,
Bisht
KS
,
Aykin-Burns
N
,
Pennington
JD
, et al
SIRT3 is a mitochondria-localized tumor suppressor required for maintenance of mitochondrial integrity and metabolism during stress
.
Cancer Cell
2010
;
17
:
41
52
.
9.
Tao
R
,
Coleman
MC
,
Pennington
JD
,
Ozden
O
,
Park
SH
,
Jiang
H
, et al
Sirt3-mediated deacetylation of evolutionarily conserved lysine 122 regulates MnSOD activity in response to stress
.
Mol Cell
2010
;
40
:
893
904
.
10.
Hallows
WC
,
Albaugh
BN
,
Denu
JM
. 
Where in the cell is SIRT3?–functional localization of an NAD+-dependent protein deacetylase
.
Biochem J
2008
;
411
:
e11
13
.
11.
Vassilopoulos
A
,
Pennington
JD
,
Andresson
T
,
Rees
DM
,
Bosley
AD
,
Fearnley
IM
, et al
SIRT3 Deacetylates ATP synthase F complex proteins in response to nutrient- and exercise-induced stress
.
Antioxid Redox Signal
2014
;
21
:
551
64
.
12.
Guarente
L
. 
The many faces of sirtuins: Sirtuins and the Warburg effect
.
Nat Med
2014
;
20
:
24
5
.
13.
Verdin
E
. 
The many faces of sirtuins: Coupling of NAD metabolism, sirtuins and lifespan
.
Nat Med
2014
;
20
:
25
7
.
14.
Baur
JA
,
Chen
D
,
Chini
EN
,
Chua
K
,
Cohen
HY
,
de Cabo
R
, et al
Dietary restriction: standing up for sirtuins
.
Science
2010
;
329
:
1012
3
.
15.
Schwer
B
,
Verdin
E
. 
Conserved metabolic regulatory functions of sirtuins
.
Cell Metab
2008
;
7
:
104
12
.
16.
Saunders
LR
,
Verdin
E
. 
Sirtuins: critical regulators at the crossroads between cancer and aging
.
Oncogene
2007
;
26
:
5489
504
.
17.
Ferguson
EC
,
Rathmell
JC
. 
New roles for pyruvate kinase M2: working out the Warburg effect
.
Trends Biochem Sci
2008
;
33
:
359
62
.
18.
Gius
D
,
Spitz
DR
. 
Redox signaling in cancer biology
.
Antioxid Redox Signal
2006
;
8
:
1249
52
.
19.
Bayley
JP
,
Devilee
P
. 
The warburg effect in 2012
.
Curr Opin Oncol
2012
;
24
:
62
7
.
20.
Redel
BK
,
Brown
AN
,
Spate
LD
,
Whitworth
KM
,
Green
JA
,
Prather
RS
. 
Glycolysis in preimplantation development is partially controlled by the Warburg Effect
.
Mol Reprod Develop
2012
;
79
:
262
71
.
21.
Meldrum
NU
,
Tarr
HL
. 
The reduction of glutathione by the Warburg-Christian system
.
Biochem J
1935
;
29
:
108
15
.
22.
Mazurek
S
. 
Pyruvate kinase type M2: a key regulator of the metabolic budget system in tumor cells
.
Int J Biochem Cell Biol
2011
;
43
:
969
80
.
23.
Hitosugi
T
,
Kang
S
,
Vander Heiden
MG
,
Chung
TW
,
Elf
S
,
Lythgoe
K
, et al
Tyrosine phosphorylation inhibits PKM2 to promote the Warburg effect and tumor growth
.
Sci Signal
2009
;
2
:
ra73
.
24.
Yang
W
,
Lu
Z
. 
Nuclear PKM2 regulates the Warburg effect
.
Cell Cycle
2013
;
12
:
3154
8
.
25.
Dang
CV
. 
PKM2 tyrosine phosphorylation and glutamine metabolism signal a different view of the Warburg effect
.
Sci Signal
2009
;
2
:
pe75
.
26.
Yang
W
,
Zheng
Y
,
Xia
Y
,
Ji
H
,
Chen
X
,
Guo
F
, et al
ERK1/2-dependent phosphorylation and nuclear translocation of PKM2 promotes the Warburg effect
.
Nat Cell Biol
2012
;
14
:
1295
304
.
27.
Luo
W
,
Semenza
GL
. 
Emerging roles of PKM2 in cell metabolism and cancer progression
.
Trends Endocrinol Metab
2012
;
23
:
560
6
.
28.
Chaneton
B
,
Gottlieb
E
. 
Rocking cell metabolism: revised functions of the key glycolytic regulator PKM2 in cancer
.
Trends Biochem Sci
2012
;
37
:
309
16
.
29.
Lv
L
,
Xu
YP
,
Zhao
D
,
Li
FL
,
Wang
W
,
Sasaki
N
, et al
Mitogenic and oncogenic stimulation of K433 acetylation promotes PKM2 protein kinase activity and nuclear localization
.
Mol Cell
2013
;
52
:
340
52
.
30.
Lv
L
,
Li
D
,
Zhao
D
,
Lin
R
,
Chu
Y
,
Zhang
H
, et al
Acetylation targets the M2 isoform of pyruvate kinase for degradation through chaperone-mediated autophagy and promotes tumor growth
.
Mol Cell
2011
;
42
:
719
30
.
31.
Kim
HS
,
Vassilopoulos
A
,
Wang
RH
,
Lahusen
T
,
Xiao
Z
,
Xu
X
, et al
SIRT2 maintains genome integrity and suppresses tumorigenesis through regulating APC/C activity
.
Cancer Cell
2011
;
20
:
487
99
.
32.
Park
SH
,
Zhu
Y
,
Ozden
O
,
Kim
HS
,
Jiang
H
,
Deng
CX
, et al
SIRT2 is a tumor suppressor that connects aging, acetylome, cell cycle signaling, and carcinogenesis
.
Transl Cancer Res
2012
;
1
:
15
21
.
33.
Warburg
O
,
Wind
F
,
Negelein
E
. 
The Metabolism of tumors in the body
.
J Gen Physiol
1927
;
8
:
519
30
.
34.
Warburg
O
. 
The chemical constitution of respiration ferment
.
Science
1928
;
68
:
437
43
.
35.
Ozden
O
,
Park
SH
,
Wagner
BA
,
Yong Song
H
,
Zhu
Y
,
Vassilopoulos
A
, et al
SIRT3 deacetylates and increases pyruvate dehydrogenase activity in cancer cells
.
Free Radic Biol Med
2014
;
76
:
163
72
.
36.
Vassilopoulos
A
,
Pennington
JD
,
Andresson
T
,
Rees
DM
,
Bosley
AD
,
Fearnley
IM
, et al
SIRT3 deacetylates ATP synthase F1 complex proteins in response to nutrient- and exercise-induced stress
.
Antioxid Redox Signal
2014
;
21
:
551
64
.
37.
Haigis
MC
,
Deng
CX
,
Finley
LW
,
Kim
HS
,
Gius
D
. 
SIRT3 Is a mitochondrial tumor suppressor: a scientific tale that connects aberrant cellular ROS, the Warburg effect, and carcinogenesis
.
Cancer Res
2012
;
72
:
2468
72
.
38.
Warburg
O
. 
Iron, the oxygen-carrier of respiration-ferment
.
Science
1925
;
61
:
575
82
.
39.
Stoyanovsky
DA
,
Tyurina
YY
,
Tyurin
VA
,
Anand
D
,
Mandavia
DN
,
Gius
D
, et al
Thioredoxin and lipoic acid catalyze the denitrosation of low molecular weight and protein S-nitrosothiols
.
J Am Chem Soc
2005
;
127
:
15815
23
.
40.
Zhang
H
,
Park
SH
,
Pantazides
BG
,
Karpiuk
O
,
Warren
MD
,
Hardy
CW
, et al
SIRT2 directs the replication stress response through CDK9 deacetylation
.
Proc Natl Acad Sci U S A
2013
;
110
:
13546
51
.
41.
Lin
R
,
Tao
R
,
Gao
X
,
Li
T
,
Zhou
X
,
Guan
KL
, et al
Acetylation stabilizes ATP-citrate lyase to promote lipid biosynthesis and tumor growth
.
Mol Cell
2013
;
51
:
506
18
.
42.
Rothgiesser
KM
,
Erener
S
,
Waibel
S
,
Luscher
B
,
Hottiger
MO
. 
SIRT2 regulates NF-kappaB dependent gene expression through deacetylation of p65 Lys310
.
J Cell Sci
2010
;
123
:
4251
8
.