Improved targeted therapies are needed to combat metastatic prostate cancer. Here, we report the identification of the spleen kinase SYK as a mediator of metastatic dissemination in zebrafish and mouse xenograft models of human prostate cancer. Although SYK has not been implicated previously in this disease, we found that its expression is upregulated in human prostate cancers and associated with malignant progression. RNAi-mediated silencing prevented invasive outgrowth in vitro and bone colonization in vivo, effects that were reversed by wild-type but not kinase-dead SYK expression. In the absence of SYK expression, cell surface levels of the progression-associated adhesion receptors integrin α2β1 and CD44 were diminished. RNAi-mediated silencing of α2β1 phenocopied SYK depletion in vitro and in vivo, suggesting an effector role for α2β1 in this setting. Notably, pharmacologic inhibitors of SYK kinase currently in phase I–II trials for other indications interfered similarly with the invasive growth and dissemination of prostate cancer cells. Our findings offer a mechanistic rationale to reposition SYK kinase inhibitors for evaluation in patients with metastatic prostate cancer. Cancer Res; 75(1); 230–40. ©2014 AACR.

Prostate cancer is the most common cancer in males and the second leading cause of cancer deaths among men in the Western world (1). Nondetectable micro-metastatic disease may be present in up to 40% of patients (2) while 8% to 14% may have visible or symptomatic bone metastases at diagnosis (3). Although the majority of prostate cancers are diagnosed as organ-confined disease, which is curable by prostatectomy or radiation therapy, 20% to 25% of patients will experience relapse within 5 years of treatment (4). Androgen deprivation therapy is used when prostate cancer reappears, but in most cases, resistance develops within 1 to 3 years. Chemotherapy, particularly docetaxel, is able to prolong overall survival in these cases but it also causes significant toxicity and not all patients receive this therapy. To more successfully combat prostate cancer, screening programs for early diagnosis and treatment of localized disease are important. In addition, some alternatives for docetaxel as first-line treatment for metastatic disease and options for those cases where docetaxel failed have become available (5). Nevertheless, once the disease has spread beyond the prostate, no curative treatments are currently available (6). Hence, there is an urgent need for novel targeted therapies to improve treatment of metastatic prostate cancer.

SYK is a nonreceptor tyrosine kinase containing two adjacent Src homology 2 (SH2) domains, a kinase domain, but no SH3 domain. SYK is expressed in hematopoietic cells where it binds phosphorylated immunoreceptor tyrosine-based activation motifs (ITAM) to mediate immune receptor signaling (7). For malignant hematopoietic cells that rely on immune receptor-mediated survival signals, SYK might represent an attractive drug target. Indeed, pharmacologic inhibition of SYK has shown promising results in the context of non-Hodgkin lymphoma and leukemias (8). SYK is also widely expressed in a variety of cell types outside the hematopoietic system and it is required for proper development of blood and lymph vessels during embryonic development (9, 10). The role of SYK in epithelial cancers appears diverse. SYK abundance negatively correlates with breast cancer progression and SYK suppresses tumor growth and metastasis in breast cancer xenografts (11, 12). Conversely, SYK levels in head and neck squamous cell carcinomas and lymph node metastases are high compared with corresponding normal tissue and SYK promotes migration of squamous carcinoma cells (13). SYK has not been implicated in prostate cancer.

In the current study, we find that SYK adenoviral shRNAs interfere with PC3 human prostate cancer dissemination using a semiautomated whole animal bioimaging platform (14). Further investigations of SYK in patient cohorts, three-dimensional (3D) in vitro cultures, and zebrafish and mouse xenografts indicate that SYK may represent a novel candidate drug target for further study in prostate cancer.

Cell lines, antibodies, and pharmacologic inhibitors

LNCaP, PC3, DU-145, and HEK293T cells were obtained from ATCC and cultured for fewer than 6 months after receipt or resuscitation according to the provided protocol. ATTC characterized the cell lines using short tandem repeat profiling. PC3-derived PC3-M-Pro4luc cells (15) and LNCaP-derived cell lines C4-2 and C4-2 B were grown in DMEM and T-Medium, respectively. For FACS, primary antibodies included AIIB2 anti-human integrin β1, 4A10 anti-human integrin α2, and sc-18849 anti-human CD44 (Santa Cruz Biotechnology). Goat-anti-mouse APC and donkey-anti-rat PE (Jackson laboratories) were used as secondary antibodies. For IHC in patient tumor samples and Western blot analysis, rabbit anti-human SYK monoclonal antibody (clone EP573Y, ab40781; Abcam) was used. For Western blot analysis, anti-human AKT (#4691; Cell Signaling Technology), anti-phospho-Ser473 AKT (#9271; Cell Signaling Technology), anti-human CD44 MAb (kindly provided by Dr. Marcel Spaargaren, Academic Medical Center, Amsterdam, the Netherlands), and α-tubulin (B-5-1-2; Sigma) were used. R-406 and BAY-61-3606 were obtained from Selleckchem and Sigma, respectively.

Zebrafish xenotransplantation experiments

For quantification of tumor cell spreading, tumor cells were labeled with CM-DiI (Invitrogen), mixed with 2% PVP, and injected into the yolk sac of enzymatically dechorionated, 2-day-old Casper fli-EGFP transgenic zebrafish embryos using an air-driven microinjector (20 psi, PV820 Pneumatic PicoPump; World precision Inc). Embryos were maintained in egg water at 34°C for 6 days and subsequently fixed with 4% paraformaldehyde. Imaging was done in 96-well plates containing a single embryo per well using a Nikon Eclipse Ti confocal laser-scanning microscope. Z stacks (12 × 30 μm) were obtained using a Plan Apo 4X Nikon dry objective with 0.2 NA and 20 mm WD. Images were converted into a single Z projection in Image-Pro Plus (Version 6.2; Media Cybernetics). Automated quantification of tumor cell spreading per embryo, cumulative distance of cells per embryo, and mean cumulative distance (MCD) for all embryos was determined using an in-house built Image-Pro Plus plugin as previously described (14).

Transient adenoviral shRNA transduction

PC3 cells were transduced one day after seeding with adenoviral shRNA constructs from Galapagos BV (Leiden) using a multiplicity of infection of 15 for 24 hours. After 3 days, medium was replaced and after an additional 2 days, the transduced PC3 cells were detached with trypsin and single cell suspensions were used for zebrafish xenotransplantation.

Stable shRNA and cDNA expression

PC3 or PC3-M-Pro4luc cells were transduced using Sigma's MISSION library lentiviral shRNAs (shSYK#1: TRCN0000003167, shSYK#2:TRCN0000199566; shITGB1#1:TRCN0000029645, shITGB1#2:TRCN0000029646; shITGA2#1: TRCN0000057730, shITGA2#2: TRCN00000057731). For lentivirus production, HEK293T cells were transfected with the short hairpin constructs together with the packaging plasmids REV, GAG, and VSV in a 1:1:1:1 ratio using PE (Sigma) as transfection reagent. Lentiviral supernatant was collected 48 hours after transfection and used for transduction or target cells in the presence of 8 μg Polybrene (Sigma). Transduced cells were bulk selected in medium containing 2 μg/mL puromycin. Lentiviral shRNA vector targeting TurboGFP was used as a negative control. Retroviral cDNAs for wild-type and kinase dead SYK were a gift from Drs. Wei Zou and Steven Teitelbaum, Washington University, St Louis, MO (16). Retrovirus was produced in Plat-E packaging cells and used for transduction of PC3-M-Pro4-luc cells stably expressing shRNA targeting SYK 3′ untranslated region (UTR), followed by bulk blasticidin selection.

mRNA expression analysis

For qPCR, total RNA was extracted using RNA easy Plus Mini Kit (Qiagen). cDNA was randomly primed from 50 ng total RNA using iScript cDNA Synthesis Kit (Bio-Rad) and real-time qPCR was subsequently performed in triplicate using SYBR green PCR (Applied Biosystems) on a 7900HT fast real-time PCR system (Applied Biosystems). The following qPCR primer sets were used:

  • GAPDH: forward AGCCACATCGCTCAGACACC, reverse ACCCGTTGACTCCGACCTT;

  • SYK forward GATGCTGGTTATGGAGATG, reverse TCTATGATGTTCTTATCCTTGAC;

  • CD44 forward TGGCACCCGCTATGTCCAG, reverse GTAGCAGGGATTCTGTCTG;

  • ITGB1 forward ATTGACCTCTACTACCTT, reverse GTGTTGTGCTAATGTAAG;

  • ITGA2 forward AACTCTTTGGATTTGCGTGTG, reverse TGGCAGTCTCAGAATAGGCTTC.

Data were collected and analyzed using SDS2.3 software (Applied Biosystems). Relative mRNA levels after correction for GAPDH control mRNA were expressed using 2(−ΔΔCt) method.

For mRNA expression analysis of human prostate cancer patient material either directly or following xenografting in mice, existing datasets were queried as described (17).

Colony formation assay

Cells were seeded into a 96-well plate containing approximately 1 cell per well. After 1 to 3 weeks, percentage of wells showing colonies and colony size was determined by microscopy (Zeiss Axiovert 200M).

3D invasion assays

Cell suspensions in PBS containing 2% polyvinylpyrrolidone (PVP; Sigma-Aldrich) were microinjected (∼1 × 104 cells/droplet) using an air-driven microinjector (20 psi, PV820 Pneumatic PicoPump; World precision Inc) into solidified 3D collagen gels in 8-well μslides (IBIDI) as previously described (18). Collagen gels were prepared from 2.5 mg/mL acid-extracted rat tail collagen type I. Collagen was diluted to working concentration of 1 mg/mL in complete medium containing 44 mmol/L NaHCO3 (stock 440 mmol/L, Merck) and 0.1 mol/L Hepes (stock 1 mol/L, BioSolve). Tumor cell spheroids were monitored for approximately 1 week using Nikon eclipse TS100. For immunostaining, gels were incubated for 1 hour with 5 μg/mL collagenase (Clostridium histolyticum, Boehringer Mannheim) at room temperature, fixed with 4% paraformaldehyde, and permeabilized in 0.2% Triton X-100. After fixation, collagen gels were stained using a cocktail containing 4% paraformaldehyde, 0.2% Triton X-100 (Sigma), and 0.1 μmol/L rhodamine phalloidin (Sigma) for 3 hours. Thereafter, wells were washed with PBS. Preparations were then mounted in Aqua-Poly/Mount solution (Polysciences, Inc) and imaged using a Plan Apo 4X Nikon dry objective with 0.2 NA and 20 mm WD. A total of 15 Z planes at an interval of 30 μm were captured. Image stacks were converted into two-dimensional maximum intensity projections using ImagePro 7.0. Cell spheroids were analyzed using an automated Image pro 7-based plugin to calculate surface area of spheroid, number of cells migrating out of the cell spheroid, and cumulative distance travelled by these cells.

Immunohistochemistry

Immunohistochemistry (IHC) was performed on a series of formalin-fixed, paraffin-embedded radical prostatectomies and prostate lymph node metastases. Five micron sections were dewaxed and rehydrated using xylene and ethanol. Endogenous peroxidase was blocked in 0.3% H2O2 and antigen retrieval was performed under pressure (0.9 bar) in TRIS-EDTA buffer (pH = 9, Klinipath). SYK antibody (ab40781, Abcam) was diluted 1:300 in normal antibody diluent (Scytek) and incubated overnight at 4°C. Envision (DAKO) was used to visualize the antibody, counterstaining was performed with hematoxylin. The percentage and intensity (negative 0, weak 1+, moderate 2+, strong 3+) of positive SYK staining were estimated in benign luminal epithelial cells and prostate adenocarcinoma. Lymphocytes served as internal positive control in all prostate and lymph node samples. Mann–Whitney U testing was performed to compare median expression levels.

Experimental bone metastasis assay

Male nude (BALB/c nu/nu) mice were anesthetized and injected with a single-cell suspension of 105 cells/100 μL in PBS into the left cardiac ventricle. Outgrowth of spread PC3-M-Pro4luc cells was monitored weekly by whole body bioluminescent imaging (BLI) using an intensified charge-coupled device video camera of the in vivo Imaging System (IVIS100; Xenogen) as described previously (15). Values are expressed as RLUs in photons/second. Bone metastases in a subset of mice were also examined by Goldner staining after mice were sacrificed using decalcified bone.

Flow cytometry and Western blot analysis

For flow-cytometry, surface expression levels were determined using primary antibodies, followed by fluorescence-conjugated secondary antibodies, and analysis on a FACSCanto or sorting on a FACSCalibur (Becton Dickinson). For Western blot analysis, cells were lysed with modified RIPA buffer (150 mmol/L NaCl, 1.0% triton-X 100, 0.5% Na deoxycholate, 0.1% 50 mmol/L Tris, pH 8, and protease cocktail inhibitor; Sigma-Aldrich). Samples were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore), incubated with primary antibodies then horseradish peroxidase-labeled secondary antibodies (Jackson ImmunoResearch Laboratories, Inc.), and developed with enhanced chemiluminescence substrate mixture (ECL plus, Amersham, GE Healthcare). Blots were scanned on a Typhoon 9400 (GE Healthcare).

Statistical analysis

Data are presented as mean ± SEM of at least three independent biologic replicates unless otherwise stated. Student t test (two tailed) was used to compare groups except for IHC on human prostatectomies and lymph node metastasis where Mann–Whitney U testing was used to compare the median expression levels between groups.

Identification and validation of SYK in prostate cancer zebrafish xenografts

A panel of human prostate cancer cell lines was xenografted in the yolk of zebrafish embryos and dissemination was analyzed using a whole animal automated bioimaging platform as described (14). Prostate cancer cell lines reported to be androgen independent and/or metastatic in mice (LnCaP-derived C4-2 and C4-2B; DU145 and PC3) showed enhanced dissemination in comparison with androgen-dependent nonmetastatic LnCAP cells (Supplementary Fig. S1A–S1D; refs. 19–22).

As a first step toward an adenovirus-based RNAi screening platform for regulators of prostate cancer dissemination, we used adenoviruses targeting two genes previously implicated in prostate cancer (Fig. 1A). These were the CD44 cell surface hyaluronan receptor and the SRC tyrosine kinase (23–26). In addition, the SYK tyrosine kinase was included because it plays apparently opposite roles in different epidermal malignancies and has not been analyzed in prostate cancer (11–13). In agreement with their reported link to growth and progression of prostate cancer, targeting CD44 or SRC, each by two independent shRNAs and in two independent experiments using approximately 25 embryos per condition, led to a significant reduction in PC3 spreading throughout the embryos (Fig. 1B and C). Interestingly, these criteria were also fulfilled for SYK (Fig. 1B and C and Supplementary Fig. S2).

Figure 1.

SYK supports growth, invasion, and dissemination of human prostate cancer cells. A, schematic overview of the in vivo screening procedure. B, MCD of tumor foci relative to site of injection for PC3 cells transiently transduced with indicated adenoviral shRNAs calculated from >40 xenografts obtained from two independent experiments. C, representative scatter plots showing tumor foci detected by automated confocal imaging and automated image analysis as described (14) in zebrafish injected with PC3 cells expressing indicated adenoviral shRNAs. Each color shows foci detected in one embryo. Arrows, foci in tail region. D, qPCR verification of SYK silencing in PC3 cells expressing two independent lentiviral shSYK vectors. E and F, MCD (E) and representative images (F) for dissemination in zebrafish of PC3 cells stably expressing indicated lentiviral SYK shRNAs (combined data from two independent experiments using >32 embryos per condition are shown; arrowheads, tumor foci in tail region). G and H, representative images (G) and quantification of expansion (mean spheroid area) and ECM invasion (MCD; H) for control and shSYK PC3 cell spheroids at 6 days postinjection in collagen gels (blue, Hoechst; red, phalloidin). Scale bars, 100 μm. ns, nonsignificant; *, P < 0.05; **, P < 0.01; ***, P < 0.005.

Figure 1.

SYK supports growth, invasion, and dissemination of human prostate cancer cells. A, schematic overview of the in vivo screening procedure. B, MCD of tumor foci relative to site of injection for PC3 cells transiently transduced with indicated adenoviral shRNAs calculated from >40 xenografts obtained from two independent experiments. C, representative scatter plots showing tumor foci detected by automated confocal imaging and automated image analysis as described (14) in zebrafish injected with PC3 cells expressing indicated adenoviral shRNAs. Each color shows foci detected in one embryo. Arrows, foci in tail region. D, qPCR verification of SYK silencing in PC3 cells expressing two independent lentiviral shSYK vectors. E and F, MCD (E) and representative images (F) for dissemination in zebrafish of PC3 cells stably expressing indicated lentiviral SYK shRNAs (combined data from two independent experiments using >32 embryos per condition are shown; arrowheads, tumor foci in tail region). G and H, representative images (G) and quantification of expansion (mean spheroid area) and ECM invasion (MCD; H) for control and shSYK PC3 cell spheroids at 6 days postinjection in collagen gels (blue, Hoechst; red, phalloidin). Scale bars, 100 μm. ns, nonsignificant; *, P < 0.05; **, P < 0.01; ***, P < 0.005.

Close modal

Stable expression of either of two independent lentiviral SYK shRNAs further confirmed the effect of SYK gene silencing in the zebrafish xenograft model (Fig. 1D–F). Reduced SYK protein expression in the presence of lentiviral shSYK was confirmed by Western blot analysis and by IHC on agar embedded cells, using the same antibody as used for IHC on human tissue sections (Supplementary Fig. S3A and S3B). Reduced SYK abundance also effectively blocked migration in a model where cell spheroids are embedded in 3D extracellular matrix (ECM) scaffolds (Fig. 1G and H and Supplementary Fig. S4A; ref. 18). In addition, SYK gene silencing attenuated spheroid expansion in vitro and tumor outgrowth at the primary injection site in zebrafish xenografts (Fig. 1G and H and Supplementary Fig. S2 and S4A). No signs of increased nuclear fragmentation in SYK-depleted spheroids were observed, pointing to decreased proliferation rather than cell death as the underlying mechanism (Supplementary Fig. S4B). We also analyzed the effect of silencing SYK on the ability of PC3 cells to form colonies when plated as single cells in vitro (Supplementary Fig. S5A). Reduced SYK levels led to a significant decrease in colony number and size. This was not associated with an apparent decrease in PI3K/AKT signaling because shSYK did not affect AKT phosphorylation on Ser473 reporting AKT activity (Supplementary Fig. S5B). These findings point to a role for SYK in growth and migration of PC3 prostate cancer cells.

Expression of SYK in human prostate cancer

On the basis of these findings, we next analyzed SYK expression levels in human prostate cancer. Breast cancer cells with reported low and high levels of SYK mRNA expression were used as controls (27, 28). Compared with LnCaP, mRNA expression was increased in the androgen-independent LNCaP-derived C4-2 and C4-2B sublines and in DU145 and PC3 androgen-independent, metastatic prostate cancer cell lines (Fig. 2A). Likewise, in a series of human prostate cancer xenografts (29), SYK mRNA expression was higher in androgen-independent tumors (Fig. 2B). Moreover, SYK RNA expression in prostate cancer metastasis resection specimens was significantly increased compared with primary prostate cancer in two different datasets (Fig. 2C). The EMC dataset used had Gene Expression Omnibus (GEO) number: GSE41410 (30); the Taylor dataset had GEO number GSE21032 (31). The expression of SYK was also compared between normal adjacent prostate (NAP) and primary prostate cancer and in both datasets, there was no significant difference in expression between NAP and prostate cancer [prostate cancer/NAP ratios: 0.97 (EMC), 0.94 (Taylor)]. This was further confirmed in the Brase dataset (GEO number GSE29079; ref. 32) where the prostate cancer/NAP ratio was 1.01. These findings indicated that SYK is unlikely to play a role in the early prostate cancer development but rather may have a role in progression of the disease.

Figure 2.

SYK is expressed in human prostate cancer. A, SYK RNA expression determined by qPCR in indicated cell lines. MDA-MB-435S (hypermethylated SYK gene promoter; refs. 27, 28) and HCC-1954 breast cancer cells (high SYK expression; ref. 28) were used as negative and positive controls, respectively. B, SYK RNA expression in human prostate cancer resection specimens xenografted in mice. C, ratio between SYK RNA expression in prostate cancer metastases [prostate cancer (PCa) Met] and primary prostate cancers and significance (t test) in two different datasets. D, semiquantitative analysis (mean and SEM) of SYK expression in normal luminal epithelium, primary prostate cancer, and prostate cancer lymph node metastases. E, IHC detection of SYK in human benign glandular prostate epithelium (1; note staining of basal but rarely of luminal cells), prostate adenocarcinoma (2, weak; and 3, moderate SYK expression), and prostate lymph node metastasis (4, negative; and 5, strong SYK expression). Arrows point to prostate epithelial/cancer cells. Original magnifications, ×200 (1, 4, 5) and ×100 (2, 3). Strong staining in lymphocytes served as internal positive control in all cases (arrowheads). ns, nonsignificant; **, P < 0.005; ***, P < 0.001 (Mann–Whitney U test).

Figure 2.

SYK is expressed in human prostate cancer. A, SYK RNA expression determined by qPCR in indicated cell lines. MDA-MB-435S (hypermethylated SYK gene promoter; refs. 27, 28) and HCC-1954 breast cancer cells (high SYK expression; ref. 28) were used as negative and positive controls, respectively. B, SYK RNA expression in human prostate cancer resection specimens xenografted in mice. C, ratio between SYK RNA expression in prostate cancer metastases [prostate cancer (PCa) Met] and primary prostate cancers and significance (t test) in two different datasets. D, semiquantitative analysis (mean and SEM) of SYK expression in normal luminal epithelium, primary prostate cancer, and prostate cancer lymph node metastases. E, IHC detection of SYK in human benign glandular prostate epithelium (1; note staining of basal but rarely of luminal cells), prostate adenocarcinoma (2, weak; and 3, moderate SYK expression), and prostate lymph node metastasis (4, negative; and 5, strong SYK expression). Arrows point to prostate epithelial/cancer cells. Original magnifications, ×200 (1, 4, 5) and ×100 (2, 3). Strong staining in lymphocytes served as internal positive control in all cases (arrowheads). ns, nonsignificant; **, P < 0.005; ***, P < 0.001 (Mann–Whitney U test).

Close modal

Because the stromal compartment may affect mRNA analysis in clinical samples, SYK protein expression was analyzed subsequently in a set of radical prostatectomies for human prostate adenocarcinoma and lymph node metastases. SYK expression was variable in prostate adenocarcinoma ranging from complete absence of staining to moderate (2+) staining in the majority of tumor cells. Expression of SYK in normal luminal glandular epithelium and low-grade prostate cancer (Gleason score <7) did not differ significantly (Fig. 2D). Notably, in preexistent epithelial glands, SYK was expressed in basal cells while luminal cells were only rarely weakly positive (Fig. 2E). Intermediate (Gleason score 7) and high-grade (Gleason score 8-10) prostate cancer demonstrated significantly higher expression of SYK than normal luminal epithelium or low-grade (Gleason score <7) prostate cancer (Fig. 2D and E). SYK expression in prostate cancer lymph node metastasis ranged from undetectable to 100% moderate (2+) staining (Fig. 2E). Median SYK expression in all metastases was significantly higher than that in all intermediate and high-grade primary prostate cancers taken together (Fig. 2D). These results further supported the notion that SYK expression is associated with progression, rather than early development of prostate cancer.

SYK supports cell surface expression of CD44 and integrin α2β1

In acute myeloid leukemia, inhibition of SYK promotes differentiation (33). We analyzed a set of transcripts previously associated with undifferentiated characteristics of prostate cancer cells (34) but observed no gross changes in the expression of these genes upon depletion of SYK. However, although mRNA levels of the prostate cancer progression-associated markers CD44 and integrin α2β1 (23, 24, 35–37) were unaffected, their cell surface expression, but not total CD44 or integrin β1 protein levels, was suppressed following SYK silencing (Fig. 3A–C and Supplementary Fig. S5C and data not shown). SYK has been previously reported to regulate surface expression of transmembrane receptors (38, 39) and two adenoviral CD44 shRNAs decreased PC3 dissemination in zebrafish (Fig. 1B). Moreover, lentiviral silencing of α2 or β1 integrin subunits, each by two independent shRNAs, suppressed invasive outgrowth in 3D ECM as well as dissemination in the zebrafish xenograft model (Fig. 3D–H). Together, these results identify regulation of surface expression of adhesion receptors as a potential underlying mechanism for the support of prostate cancer dissemination by SYK.

Figure 3.

SYK regulation of adhesion receptor surface expression in human prostate cancer cells modulates invasive outgrowth in vitro and dissemination in zebrafish and metastatic colonization in mice. A, FACS analysis of surface expression of CD44 and integrin subunits α2 (ITGA2) and β1 (ITGB1) in PC3 cells expressing control or SYK shRNAs. MFI, mean fluorescence intensity. B and C, qPCR analysis of ITGA2 and ITGB1 mRNA expression in PC3 cells expressing control or SYK shRNAs. D, FACS verification of ITGA2 and ITGB1 silencing in PC3 cells expressing two independent lentiviral vectors targeting ITGA2 or ITGB1, respectively. E and F, quantification of expansion (mean spheroid area) and ECM invasion (MCD; E) and representative images (F) for control, shITGA2, and shITGB1 PC3 cell spheroids at 6 days postinjection in collagen gels (blue, Hoechst; red, phalloidin). G and H, representative images (G) and quantification of MCD (H) for dissemination in zebrafish of PC3 cells expressing indicated lentiviral shRNAs (combined data from two independent experiments using >40 embryo's per condition are shown; arrowheads, tumor foci in tail region). Scale bars, 100 μm. **, P < 0.01; ***, P < 0.005.

Figure 3.

SYK regulation of adhesion receptor surface expression in human prostate cancer cells modulates invasive outgrowth in vitro and dissemination in zebrafish and metastatic colonization in mice. A, FACS analysis of surface expression of CD44 and integrin subunits α2 (ITGA2) and β1 (ITGB1) in PC3 cells expressing control or SYK shRNAs. MFI, mean fluorescence intensity. B and C, qPCR analysis of ITGA2 and ITGB1 mRNA expression in PC3 cells expressing control or SYK shRNAs. D, FACS verification of ITGA2 and ITGB1 silencing in PC3 cells expressing two independent lentiviral vectors targeting ITGA2 or ITGB1, respectively. E and F, quantification of expansion (mean spheroid area) and ECM invasion (MCD; E) and representative images (F) for control, shITGA2, and shITGB1 PC3 cell spheroids at 6 days postinjection in collagen gels (blue, Hoechst; red, phalloidin). G and H, representative images (G) and quantification of MCD (H) for dissemination in zebrafish of PC3 cells expressing indicated lentiviral shRNAs (combined data from two independent experiments using >40 embryo's per condition are shown; arrowheads, tumor foci in tail region). Scale bars, 100 μm. **, P < 0.01; ***, P < 0.005.

Close modal

SYK kinase activity supports formation of bone metastases

We next addressed the role of SYK in a preclinical mouse xenograft model for prostate cancer bone metastasis. This preclinical in vivo model has been extensively characterized and the PC-3M-Pro4luc cells were selected, by multiple in vivo passaging, for extremely high bone tropism (which reflects castration-resistant prostate cancer with bone metastasis in advanced prostate cancer patients) and virtually exclusively colonize bone (marrow; ref. 15). Depletion of SYK led to a strong reduction in metastatic bone tumor burden following intracardiac inoculation of PC3M-Pro4luc cells (Fig. 4A and B). Similar to its effect in vitro and in zebrafish xenografts, shRNA targeting the integrin α2-subunit mRNA, phenocopied shSYK in this model (Fig. 4A). To interrogate the specific role for SYK kinase activity in colony formation and prostate cancer bone colonization, wild-type or kinase dead SYK was expressed in PC3M-Pro4luc cells expressing an shRNA targeting the SYK 3′UTR. The reduced capacity to form colonies as well as colony growth in PC3M-Pro4luc-shSYK cells was restored to control levels by wild-type but not kinase dead SYK (Fig. 4C). Moreover, effective bone colonization of shSYK cells was restored by wild-type SYK, whereas expression of kinase dead SYK even further suppressed the process with very few detectable metastases (Fig. 4D–F).

Figure 4.

SYK kinase activity supports metastatic bone colonization in mice. A, total metastatic tumor burden determined by BLI monitoring at indicated time points following intracardiac inoculation in immune-compromised mice for PC3M-Pro4luc variants expressing indicated lentiviral shRNAs (data obtained from at least 9 mice per experimental group). B, bones of mice collected 31 days after intracardiac inoculation with PC3M-Pro4-luc shCTR or shSYK cells and stained with Goldner staining. *, tumor lesion. C, quantification of colony formation assay for PC3M-Pro4-luc cells expressing control or SYK shRNAs in combination with wild-type (SYKwt) or kinase dead SYK (SYKkd) expression vectors. Gray, small; white, medium; black, large colonies. D, BLI images of PC3M-Pro4luc variants expressing control or SYK shRNAs in combination with wild-type (SYKwt) or kinase dead (SYKkd) expression vectors taken 31 days following intracardiac inoculation. E and F, quantification of the experiment shown in D where total metastatic tumor burden was determined by BLI monitoring at indicated time points (E) and the number of metastatic colonies was determined by counting of BLI foci at 31 days following intracardiac inoculation (data obtained from at least 10 mice per experimental group; F). ns, nonsignificant; *, P < 0.05; **, P < 0.01; ***, P < 0.005 versus shCTR.

Figure 4.

SYK kinase activity supports metastatic bone colonization in mice. A, total metastatic tumor burden determined by BLI monitoring at indicated time points following intracardiac inoculation in immune-compromised mice for PC3M-Pro4luc variants expressing indicated lentiviral shRNAs (data obtained from at least 9 mice per experimental group). B, bones of mice collected 31 days after intracardiac inoculation with PC3M-Pro4-luc shCTR or shSYK cells and stained with Goldner staining. *, tumor lesion. C, quantification of colony formation assay for PC3M-Pro4-luc cells expressing control or SYK shRNAs in combination with wild-type (SYKwt) or kinase dead SYK (SYKkd) expression vectors. Gray, small; white, medium; black, large colonies. D, BLI images of PC3M-Pro4luc variants expressing control or SYK shRNAs in combination with wild-type (SYKwt) or kinase dead (SYKkd) expression vectors taken 31 days following intracardiac inoculation. E and F, quantification of the experiment shown in D where total metastatic tumor burden was determined by BLI monitoring at indicated time points (E) and the number of metastatic colonies was determined by counting of BLI foci at 31 days following intracardiac inoculation (data obtained from at least 10 mice per experimental group; F). ns, nonsignificant; *, P < 0.05; **, P < 0.01; ***, P < 0.005 versus shCTR.

Close modal

Pharmacologic inhibition of SYK prevents in vitro invasion and in vivo dissemination

On the basis of the dependency on SYK kinase activity determined in the mouse model, we performed initial experiments to evaluate whether pharmacologic inhibition of SYK could interfere with in vitro invasive outgrowth and in vivo dissemination using zebrafish xenografts. Small-molecule inhibitors of SYK are in clinical development for autoimmune diseases and lymphoid malignancies (8, 40). Two of these compounds, R-406 and BAY-61-3606, show efficacy in preclinical leukemia and retinoblastoma studies (33, 41–44). When used at 1 to 10 μmol/L, the concentration widely used in vitro (33, 41–44), these compounds reduced spheroid outgrowth and ECM invasion of PC3 as well as C4-2B cells (Fig. 5A–C). Moreover, R-406 significantly inhibited dissemination of PC3 cells (Fig. 5D) without significant signs of toxicity at 10 μmol/L (e.g., no effects were observed when yolk sac edema, cardiac edema, bending of the tail, hepatic necrosis, and impaired cardiovascular function were compared for R-406 and vehicle control-treated animals). Thus, pharmacologic inactivation of SYK recapitulated the effect of silencing the SYK gene in vitro and in zebrafish xenografts.

Figure 5.

Pharmacological inhibition of SYK prevents growth, invasion, and dissemination of prostate cancer cells. A, bright field images showing PC3 spheroids 6 days postinjection into collagen gels in the absence or presence of the indicated concentrations of BAY-61-360 (one of three experiments is shown). B, representative images and quantification of expansion (mean spheroid area) and ECM invasion (MCD) for PC3 cell spheroids measured at 6 days postinjection in collagen gels and treated with indicated concentrations of R-406 (blue, Hoechst; red, phalloidin). C, brightfield images showing C4-2B cell spheroids at 6 days postformation in the absence or presence of the indicated concentrations of SYK inhibitors. Arrowheads point to ECM invading strands seen under control conditions, which are not observed in presence of inhibitors. D, representative images and quantified MCD for dissemination in zebrafish of PC3 cells in the absence or presence of indicated concentrations of R-406. Combined data from two independent experiments using >70 embryos per condition are shown. Arrows, cells disseminated to tail region. Scale bars, 120 μm; ns, nonsignificant; *, P < 0.05; ***, P < 0.005.

Figure 5.

Pharmacological inhibition of SYK prevents growth, invasion, and dissemination of prostate cancer cells. A, bright field images showing PC3 spheroids 6 days postinjection into collagen gels in the absence or presence of the indicated concentrations of BAY-61-360 (one of three experiments is shown). B, representative images and quantification of expansion (mean spheroid area) and ECM invasion (MCD) for PC3 cell spheroids measured at 6 days postinjection in collagen gels and treated with indicated concentrations of R-406 (blue, Hoechst; red, phalloidin). C, brightfield images showing C4-2B cell spheroids at 6 days postformation in the absence or presence of the indicated concentrations of SYK inhibitors. Arrowheads point to ECM invading strands seen under control conditions, which are not observed in presence of inhibitors. D, representative images and quantified MCD for dissemination in zebrafish of PC3 cells in the absence or presence of indicated concentrations of R-406. Combined data from two independent experiments using >70 embryos per condition are shown. Arrows, cells disseminated to tail region. Scale bars, 120 μm; ns, nonsignificant; *, P < 0.05; ***, P < 0.005.

Close modal

There is an urgent need for further insights into aspects of prostate cancer progression that provide new avenues for targeted therapy. Our study demonstrates that a semiautomated whole animal bioimaging assay based on zebrafish xenotransplantation (14) can be productive in RNAi-based preclinical prostate cancer drug target discovery. Efficacy of human prostate cancer cell spreading throughout the embryo correlates with androgen independence, a major hallmark of prostate cancer progression, and with behavior in rodent models. Two signaling proteins, previously associated with prostate cancer progression, Src and CD44, are effectively identified using adenoviral shRNAs (23–26). Although the pipeline is currently only partly automated, screening of small adenoviral RNAi sublibraries (∼100 genes) is feasible. Integration of the established automated imaging and quantitative image analysis with recently described methods for automated injection and sorting of zebrafish embryos can widen applicability to larger scale screening (45).

Our findings indicate that the protein tyrosine kinase, SYK, supports growth and migration of prostate cancer cells. The evidence comes from two transiently expressed adenoviral and two stably expressed and bulk-sorted lentiviral shRNA vectors. In addition, expression of wild-type SYK rescues the attenuated in vitro clonogenic outgrowth and in vivo formation of bone metastases of shSYK cells, further arguing against off-target effects. This suggests that the role of SYK in prostate cancer is opposite to its proposed “progression suppressor” role in breast cancer (11, 12). In further support of that, we show that expression of SYK is somewhat increased in more aggressive prostate cancer cell lines and in metastases as compared with primary prostate cancer lesions. A wider analysis of SYK protein expression and activity in a large cohort of patients with prostate cancer will be needed to firmly establish if SYK is positively correlated to progression of prostate cancer, as it appears to be for head and neck squamous cell carcinoma (13).

In hematopoietic cells, immune receptors provide the ITAM for recruitment and activation of SYK. In the epithelial cell types where SYK is expressed, it has not been established whether and how SYK may be activated. Src family kinases are responsible for the ITAM phosphorylation that is required to recruit SYK (7, 46). Src has been associated with prostate cancer progression and RNAi targeting Src also interfered with PC3 dissemination in the zebrafish model. Src may act on a large number of substrates in prostate cancer cells. One potential target in the context of SYK activation that we evaluated was “migration and invasion enhancer 1” (Mien1; also termed C35/C17orf37). Expression of Mien1 is correlated with progression of breast, ovarian, and colon cancer, it contains an ITAM, and it has been reported to require SYK for its breast cancer promoting activity (47–51). However, stable silencing of MIEN1 in PC3 cells did not affect outgrowth or invasion in 3D cultures, indicating that this is unlikely to be involved in prostate cancer growth or invasion (not shown). Further studies will address additional possible mechanisms in the context of prostate cancer.

It is not known how SYK contributes to, or in the case of breast cancer, interferes with tumor progression but modulation of NF-κB activity may be one aspect involved (52). In immune cells, SYK mediates the activation of MAPK signaling, calcium fluxes, and cytoskeletal remodeling when immune receptors are engaged (7, 46). In addition, SYK has been previously reported to support the surface expression of integrins (38, 39). Our findings indicate that stimulation of α2β1 and CD44 cell surface expression may play a role in the stimulation by SYK of invasive growth in 3D ECM in vitro and dissemination in the zebrafish model. A role for β1 integrins in intravascular locomotion of MDA-MB-435 breast cancer cells in zebrafish has been previously reported (53). In our study, silencing either α2 or β1 subunits prohibits effective migration in the zebrafish. Moreover, silencing α2β1 phenocopies the effect of silencing SYK in the experimental mouse bone metastasis model. Thus, SYK-mediated stimulation of the cell surface expression of adhesion receptors may contribute to aspects of prostate cancer progression.

Our experiments using a kinase-dead mutant show that stimulation of clonogenic growth in vitro and experimental bone metastasis in the mouse depend on SYK kinase activity. Moreover, R-406 and BAY-61-3606 SYK kinase inhibitors that were effective in preclinical leukemia and retinoblastoma studies (33, 41–44) interfere with invasive growth in 3D ECM in vitro and dissemination in the zebrafish model. So, genetic or pharmacologic inactivation of SYK kinase activity inhibits invasive growth and dissemination of prostate cancer. We verify that SYK mRNA and protein are detected in human prostate cancer tissues and SYK inhibitors have already been tested in phase I–II clinical trials for other diseases. Altogether, this establishes SYK as a potential new drug target in prostate cancer for which existing pharmacologic inhibitors with known toxicological profiles can be tested for clinical efficacy.

No potential conflicts of interest were disclosed.

Conception and design: V.P.S. Ghotra, S. He, S. Nijhoff, R. Janssen, Z. Baranski, J. Xiong, G. van der Pluijm, B.E. Snaar-Jagalska, E.H.J. Danen

Development of methodology: S. He, S. Nijhoff, H. de Bont, A. Lekkerkerker, R. Janssen, A.M.M. Hoogland, G. van der Pluijm, B.E. Snaar-Jagalska, E.H.J. Danen

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): S. He, G. van der Horst, S. Nijhoff, H. de Bont, A. Lekkerkerker, R. Janssen, G. Jenster, G.J.L.H. van Leenders, A.M.M. Hoogland, E.I. Verhoef, G. van der Pluijm, B.E. Snaar-Jagalska, E.H.J. Danen

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): V.P.S. Ghotra, G. van der Horst, H. de Bont, A. Lekkerkerker, R. Janssen, G.J.L.H. van Leenders, A.M.M. Hoogland, E.I. Verhoef, G. van der Pluijm, B.E. Snaar-Jagalska, E.H.J. Danen

Writing, review, and/or revision of the manuscript: V.P.S. Ghotra, S. He, G. van der Horst, A. Lekkerkerker, R. Janssen, G. Jenster, E.I. Verhoef, B. van de Water, G. van der Pluijm, B.E. Snaar-Jagalska, E.H.J. Danen

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): A. Lekkerkerker, E.I. Verhoef, G. van der Pluijm, B.E. Snaar-Jagalska

Study supervision: R. Janssen, G. van der Pluijm, B.E. Snaar-Jagalska, E.H.J. Danen

The authors thank Drs. Wei Zou and Steven Teitelbaum for kindly providing SYK plasmids, Dr. Marcel Spaargaren for the CD44 antibody, Dr. Rene Bottcher for bioinformatics analysis of Syk expression in the different datasets, and Lizette Haazen for technical assistance.

This work was supported by grants from EU FP7 (HEALTH-F2-2008-201439) and Dutch Cancer Society (UL-2010-4670).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Nelson
WG
,
De Marzo
AM
,
Isaacs
WB
. 
Prostate cancer
.
N Engl J Med
2003
;
349
:
366
81
.
2.
Freedland
SJ
,
Humphreys
EB
,
Mangold
LA
,
Eisenberger
M
,
Dorey
FJ
,
Walsh
PC
, et al
Risk of prostate cancer-specific mortality following biochemical recurrence after radical prostatectomy
.
JAMA
2005
;
294
:
433
9
.
3.
Landis
SH
,
Murray
T
,
Bolden
S
,
Wingo
PA
. 
Cancer statistics, 1999
.
CA Cancer J Clin
1999
;
49
:
8
31
, 1.
4.
Wirth
MP
,
See
WA
,
McLeod
DG
,
Iversen
P
,
Morris
T
,
Carroll
K
. 
Bicalutamide 150 mg in addition to standard care in patients with localized or locally advanced prostate cancer: results from the second analysis of the early prostate cancer program at median followup of 5.4 years
.
J Urol
2004
;
172
:
1865
70
.
5.
Drake
CG
,
Sharma
P
,
Gerritsen
W
. 
Metastatic castration-resistant prostate cancer: new therapies, novel combination strategies and implications for immunotherapy
.
Oncogene
2013
;
33
:
5053
64
.
6.
Mundy
GR
. 
Metastasis to bone: causes, consequences and therapeutic opportunities
.
Nat Rev Cancer
2002
;
2
:
584
93
.
7.
Turner
M
,
Schweighoffer
E
,
Colucci
F
,
Di Santo
JP
,
Tybulewicz
VL
. 
Tyrosine kinase SYK: essential functions for immunoreceptor signalling
.
Immunol Today
2000
;
21
:
148
54
.
8.
Friedberg
JW
,
Sharman
J
,
Sweetenham
J
,
Johnston
PB
,
Vose
JM
,
Lacasce
A
, et al
Inhibition of Syk with fostamatinib disodium has significant clinical activity in non-Hodgkin lymphoma and chronic lymphocytic leukemia
.
Blood
2010
;
115
:
2578
85
.
9.
Abtahian
F
,
Guerriero
A
,
Sebzda
E
,
Lu
MM
,
Zhou
R
,
Mocsai
A
, et al
Regulation of blood and lymphatic vascular separation by signaling proteins SLP-76 and Syk
.
Science
2003
;
299
:
247
51
.
10.
Coopman
PJ
,
Mueller
SC
. 
The Syk tyrosine kinase: a new negative regulator in tumor growth and progression
.
Cancer Lett
2006
;
241
:
159
73
.
11.
Toyama
T
,
Iwase
H
,
Yamashita
H
,
Hara
Y
,
Omoto
Y
,
Sugiura
H
, et al
Reduced expression of the Syk gene is correlated with poor prognosis in human breast cancer
.
Cancer Lett
2003
;
189
:
97
102
.
12.
Coopman
PJ
,
Do
MT
,
Barth
M
,
Bowden
ET
,
Hayes
AJ
,
Basyuk
E
, et al
The Syk tyrosine kinase suppresses malignant growth of human breast cancer cells
.
Nature
2000
;
406
:
742
7
.
13.
Luangdilok
S
,
Box
C
,
Patterson
L
,
Court
W
,
Harrington
K
,
Pitkin
L
, et al
Syk tyrosine kinase is linked to cell motility and progression in squamous cell carcinomas of the head and neck
.
Cancer Res
2007
;
67
:
7907
16
.
14.
Ghotra
VP
,
He
S
,
de Bont
H
,
van der Ent
W
,
Spaink
HP
,
van de Water
B
, et al
Automated whole animal bio-imaging assay for human cancer dissemination
.
PLoS ONE
2012
;
7
:
e31281
.
15.
van den Hoogen
C
,
van der Horst
G
,
Cheung
H
,
Buijs
JT
,
Pelger
RC
,
van der Pluijm
G
. 
Integrin alphav expression is required for the acquisition of a metastatic stem/progenitor cell phenotype in human prostate cancer
.
Am J Pathol
2011
;
179
:
2559
68
.
16.
Zou
W
,
Reeve
JL
,
Zhao
H
,
Ross
FP
,
Teitelbaum
SL
. 
Syk tyrosine 317 negatively regulates osteoclast function via the ubiquitin-protein isopeptide ligase activity of Cbl
.
J Biol Chem
2009
;
284
:
18833
9
.
17.
Martens-Uzunova
ES
,
Jalava
SE
,
Dits
NF
,
van Leenders
GJ
,
Moller
S
,
Trapman
J
, et al
Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer
.
Oncogene
2012
;
31
:
978
91
.
18.
Truong
HH
,
de Sonneville
J
,
Ghotra
VP
,
Xiong
J
,
Price
L
,
Hogendoorn
PC
, et al
Automated microinjection of cell-polymer suspensions in 3D ECM scaffolds for high-throughput quantitative cancer invasion screens
.
Biomaterials
2012
;
33
:
181
8
.
19.
Thalmann
GN
,
Anezinis
PE
,
Chang
SM
,
Zhau
HE
,
Kim
EE
,
Hopwood
VL
, et al
Androgen-independent cancer progression and bone metastasis in the LNCaP model of human prostate cancer
.
Cancer Res
1994
;
54
:
2577
81
.
20.
Shevrin
DH
,
Kukreja
SC
,
Ghosh
L
,
Lad
TE
. 
Development of skeletal metastasis by human prostate cancer in athymic nude mice
.
Clin Exp Metastasis
1988
;
6
:
401
9
.
21.
Wu
TT
,
Sikes
RA
,
Cui
Q
,
Thalmann
GN
,
Kao
C
,
Murphy
CF
, et al
Establishing human prostate cancer cell xenografts in bone: induction of osteoblastic reaction by prostate-specific antigen-producing tumors in athymic and SCID/bg mice using LNCaP and lineage-derived metastatic sublines
.
Int J Cancer
1998
;
77
:
887
94
.
22.
Ware
JL
,
Paulson
DF
,
Mickey
GH
,
Webb
KS
. 
Spontaneous metastasis of cells of the human prostate carcinoma cell line PC-3 in athymic nude mice
.
J Urol
1982
;
128
:
1064
7
.
23.
Paradis
V
,
Eschwege
P
,
Loric
S
,
Dumas
F
,
Ba
N
,
Benoit
G
, et al
De novo expression of CD44 in prostate carcinoma is correlated with systemic dissemination of prostate cancer
.
J Clin Pathol
1998
;
51
:
798
802
.
24.
Desai
B
,
Rogers
MJ
,
Chellaiah
MA
. 
Mechanisms of osteopontin and CD44 as metastatic principles in prostate cancer cells
.
Mol Cancer
2007
;
6
:
18
.
25.
Slack
JK
,
Adams
RB
,
Rovin
JD
,
Bissonette
EA
,
Stoker
CE
,
Parsons
JT
. 
Alterations in the focal adhesion kinase/Src signal transduction pathway correlate with increased migratory capacity of prostate carcinoma cells
.
Oncogene
2001
;
20
:
1152
63
.
26.
Agoulnik
IU
,
Vaid
A
,
Bingman
WE
 III
,
Erdeme
H
,
Frolov
A
,
Smith
CL
, et al
Role of SRC-1 in the promotion of prostate cancer cell growth and tumor progression
.
Cancer Res
2005
;
65
:
7959
67
.
27.
Yuan
Y
,
Mendez
R
,
Sahin
A
,
Dai
JL
. 
Hypermethylation leads to silencing of the SYK gene in human breast cancer
.
Cancer Res
2001
;
61
:
5558
61
.
28.
Wang
L
,
Duke
L
,
Zhang
PS
,
Arlinghaus
RB
,
Symmans
WF
,
Sahin
A
, et al
Alternative splicing disrupts a nuclear localization signal in spleen tyrosine kinase that is required for invasion suppression in breast cancer
.
Cancer Res
2003
;
63
:
4724
30
.
29.
van Weerden
WM
,
de Ridder
CM
,
Verdaasdonk
CL
,
Romijn
JC
,
van der Kwast
TH
,
Schroder
FH
, et al
Development of seven new human prostate tumor xenograft models and their histopathological characterization
.
Am J Pathol
1996
;
149
:
1055
62
.
30.
Boormans
JL
,
Korsten
H
,
Ziel-van der Made
AJ
,
van Leenders
GJ
,
de Vos
CV
,
Jenster
G
, et al
Identification of TDRD1 as a direct target gene of ERG in primary prostate cancer
.
Int J Cancer
2013
;
133
:
335
45
.
31.
Taylor
BS
,
Schultz
N
,
Hieronymus
H
,
Gopalan
A
,
Xiao
Y
,
Carver
BS
, et al
Integrative genomic profiling of human prostate cancer
.
Cancer Cell
2010
;
18
:
11
22
.
32.
Brase
JC
,
Johannes
M
,
Mannsperger
H
,
Fälth
M
,
Metzger
J
,
Kacprzyk
LA
, et al
TMPRSS2-ERG -specific transcriptional modulation is associated with prostate cancer biomarkers and TGF-β signaling
.
BMC Cancer
2011
;
11
:
507
.
33.
Hahn
CK
,
Berchuck
JE
,
Ross
KN
,
Kakoza
RM
,
Clauser
K
,
Schinzel
AC
, et al
Proteomic and genetic approaches identify Syk as an AML target
.
Cancer Cell
2009
;
16
:
281
94
.
34.
Floryk
D
,
Tollaksen
SL
,
Giometti
CS
,
Huberman
E
. 
Differentiation of human prostate cancer PC-3 cells induced by inhibitors of inosine 5′-monophosphate dehydrogenase
.
Cancer Res
2004
;
64
:
9049
56
.
35.
Hall
CL
,
Dubyk
CW
,
Riesenberger
TA
,
Shein
D
,
Keller
ET
,
van Golen
KL
. 
Type I collagen receptor (alpha2beta1) signaling promotes prostate cancer invasion through RhoC GTPase
.
Neoplasia
2008
;
10
:
797
803
.
36.
Van Slambrouck
S
,
Hilkens
J
,
Bisoffi
M
,
Steelant
WF
. 
AsialoGM1 and integrin alpha2beta1 mediate prostate cancer progression
.
Int J Oncol
2009
;
35
:
693
9
.
37.
Trerotola
M
,
Rathore
S
,
Goel
HL
,
Li
J
,
Alberti
S
,
Piantelli
M
, et al
CD133, Trop-2 and alpha2beta1 integrin surface receptors as markers of putative human prostate cancer stem cells
.
Am J Transl Res
2010
;
2
:
135
44
.
38.
Fotheringham
JA
,
Coalson
NE
,
Raab-Traub
N
. 
Epstein-barr virus latent membrane protein-2A induces ITAM/Syk and Akt dependent epithelial migration through alphaV-integrin membrane translocation
.
J Virol
2012
;
86
:
10308
20
.
39.
Woollard
KJ
,
Fisch
C
,
Newby
R
,
Griffiths
HR
. 
C-reactive protein mediates CD11b expression in monocytes through the non-receptor tyrosine kinase, Syk, and calcium mobilization but not through cytosolic peroxides
.
Inflamm Res
2005
;
54
:
485
92
.
40.
Weinblatt
ME
,
Kavanaugh
A
,
Genovese
MC
,
Musser
TK
,
Grossbard
EB
,
Magilavy
DB
. 
An oral spleen tyrosine kinase (Syk) inhibitor for rheumatoid arthritis
.
N Engl J Med
2010
;
363
:
1303
12
.
41.
Baudot
AD
,
Jeandel
PY
,
Mouska
X
,
Maurer
U
,
Tartare-Deckert
S
,
Raynaud
SD
, et al
The tyrosine kinase Syk regulates the survival of chronic lymphocytic leukemia B cells through PKCdelta and proteasome-dependent regulation of Mcl-1 expression
.
Oncogene
2009
;
28
:
3261
73
.
42.
Suljagic
M
,
Longo
PG
,
Bennardo
S
,
Perlas
E
,
Leone
G
,
Laurenti
L
, et al
The Syk inhibitor fostamatinib disodium (R788) inhibits tumor growth in the Emu-TCL1 transgenic mouse model of CLL by blocking antigen-dependent B-cell receptor signaling
.
Blood
2010
;
116
:
4894
905
.
43.
Buchner
M
,
Baer
C
,
Prinz
G
,
Dierks
C
,
Burger
M
,
Zenz
T
, et al
Spleen tyrosine kinase inhibition prevents chemokine- and integrin-mediated stromal protective effects in chronic lymphocytic leukemia
.
Blood
2010
;
115
:
4497
506
.
44.
Zhang
J
,
Benavente
CA
,
McEvoy
J
,
Flores-Otero
J
,
Ding
L
,
Chen
X
, et al
A novel retinoblastoma therapy from genomic and epigenetic analyses
.
Nature
2012
;
481
:
329
34
.
45.
Spaink
HP
,
Cui
C
,
Wiweger
MI
,
Jansen
HJ
,
Veneman
WJ
,
Marin-Juez
R
, et al
Robotic injection of zebrafish embryos for high-throughput screening in disease models
.
Methods
2013
;
62
:
246
54
.
46.
Berton
G
,
Mocsai
A
,
Lowell
CA
. 
Src and Syk kinases: key regulators of phagocytic cell activation
.
Trends Immunol
2005
;
26
:
208
14
.
47.
Dasgupta
S
,
Cushman
I
,
Kpetemey
M
,
Casey
PJ
,
Vishwanatha
JK
. 
Prenylated c17orf37 induces filopodia formation to promote cell migration and metastasis
.
J Biol Chem
2011
;
286
:
25935
46
.
48.
Dasgupta
S
,
Wasson
LM
,
Rauniyar
N
,
Prokai
L
,
Borejdo
J
,
Vishwanatha
JK
. 
Novel gene C17orf37 in 17q12 amplicon promotes migration and invasion of prostate cancer cells
.
Oncogene
2009
;
28
:
2860
72
.
49.
Katz
E
,
Dubois-Marshall
S
,
Sims
AH
,
Faratian
D
,
Li
J
,
Smith
ES
, et al
A gene on the HER2 amplicon, C35, is an oncogene in breast cancer whose actions are prevented by inhibition of Syk
.
Br J Cancer
2010
;
103
:
401
10
.
50.
Leung
TH
,
Wong
SC
,
Chan
KK
,
Chan
DW
,
Cheung
AN
,
Ngan
HY
. 
The interaction between C35 and DeltaNp73 promotes chemo-resistance in ovarian cancer cells
.
Br J Cancer
2013
;
109
:
965
75
.
51.
Hsu
CH
,
Shen
TL
,
Chang
CF
,
Chang
YY
,
Huang
LY
. 
Solution structure of the oncogenic MIEN1 protein reveals a thioredoxin-like fold with a redox-active motif
.
PLoS ONE
2012
;
7
:
e52292
.
52.
Zhou
Q
,
Geahlen
RL
. 
The protein-tyrosine kinase Syk interacts with TRAF-interacting protein TRIP in breast epithelial cells
.
Oncogene
2009
;
28
:
1348
56
.
53.
Stoletov
K
,
Kato
H
,
Zardouzian
E
,
Kelber
J
,
Yang
J
,
Shattil
S
, et al
Visualizing extravasation dynamics of metastatic tumor cells
.
J Cell Sci
2010
;
123
:
2332
41
.