Despite their clinicopathologic heterogeneity, malignant germ cell tumors (GCT) share molecular abnormalities that are likely to be functionally important. In this study, we investigated the potential significance of downregulation of the let-7 family of tumor suppressor microRNAs in malignant GCTs. Microarray results from pediatric and adult samples (n = 45) showed that LIN28, the negative regulator of let-7 biogenesis, was abundant in malignant GCTs, regardless of patient age, tumor site, or histologic subtype. Indeed, a strong negative correlation existed between LIN28 and let-7 levels in specimens with matched datasets. Low let-7 levels were biologically significant, as the sequence complementary to the 2 to 7 nt common let-7 seed “GAGGUA” was enriched in the 3′ untranslated regions of mRNAs upregulated in pediatric and adult malignant GCTs, compared with normal gonads (a mixture of germ cells and somatic cells). We identified 27 mRNA targets of let-7 that were upregulated in malignant GCT cells, confirming significant negative correlations with let-7 levels. Among 16 mRNAs examined in a largely independent set of specimens by quantitative reverse transcription PCR, we defined negative-associations with let-7e levels for six oncogenes, including MYCN, AURKB, CCNF, RRM2, MKI67, and C12orf5 (when including normal control tissues). Importantly, LIN28 depletion in malignant GCT cells restored let-7 levels and repressed all of these oncogenic let-7 mRNA targets, with LIN28 levels correlating with cell proliferation and MYCN levels. Conversely, ectopic expression of let-7e was sufficient to reduce proliferation and downregulate MYCN, AURKB, and LIN28, the latter via a double-negative feedback loop. We conclude that the LIN28/let-7 pathway has a critical pathobiologic role in malignant GCTs and therefore offers a promising target for therapeutic intervention. Cancer Res; 73(15); 4872–84. ©2013 AACR.

Germ cell tumors (GCT) are clinically and histopathologically complex. They present from early infancy through to late adulthood, occur at both gonadal and extragonadal sites, and comprise diverse histologic subtypes (1). Benign forms show somatic differentiation and are termed teratomas, whereas malignant GCTs are classified into germinomas (a collective term for testicular seminoma, ovarian dysgerminoma, and extragonadal germinoma) and non-germinomatous tumors, the main types of which are yolk sac tumors (YST) and embryonal carcinoma (1).

Although most patients with malignant GCTs have a good prognosis, some patients still have inferior outcomes, and testicular germ cell malignancy remains a leading cause of death in young men (2). Improved understanding of the molecular pathogenesis of malignant GCTs would represent an important step toward developing novel therapeutic agents with favorable toxicity profiles, which may improve survival for patients with high-risk disease and reduce toxicity for low-risk patients. It is particularly important to identify abnormalities that are shared across the diverse spectrum of malignant GCTs, as these are likely to be of fundamental significance in disease pathogenesis.

Using microarray profiling, we previously identified that all 9 members of the lethal-7 (let-7) microRNA family were significantly underexpressed in pediatric malignant GCTs, when compared with nonmalignant control tissues (3). MicroRNAs regulate gene expression via their 5′ seed region (nucleotides at positions 1–8; 1–8 nt), which binds the corresponding seed complementary region (SCR) located predominantly in the 3′untranslated region (3′UTR) of mRNA targets (4). Within the seed, 2 to 7 nt are most critical for binding specificity (5). Importantly, all 9 let-7 microRNAs share the same 2 to 7 nt seed sequence (GAGGUA) and therefore share mRNA targets containing the 3′UTR SCR “TACCTC.”

Let-7 microRNAs are important tumor suppressor genes (6) that regulate cell proliferation (7). The let-7 microRNA family is negatively regulated by the RNA-binding proteins LIN28 homolog-A (LIN28) and LIN28 homolog-B (LIN28B; refs. 8, 9), with LIN28 depletion resulting in specific increases in all let-7 family members (8, 10). The LIN28 proteins bind let-7 primary transcripts (pri-let-7) and precursor hairpins (pre-let-7), preventing processing by DROSHA and DICER1, respectively (11). Binding of pre-let-7 by LIN28 occurs through a stem loop motif that includes “GGAG” (12, 13), leading to recruitment of the terminal-uridyl-transferase (TUTase) ZCCHC11 (10, 12), resulting in pre-let-7 uridylation and subsequent degradation (14).

LIN28 can reprogram human somatic cells into pluripotent stem cells, and is a putative cancer stem-cell marker (9, 11, 15). Of note, LIN28 is expressed at high levels in primordial germ cells (16), believed to be the cell of origin for malignant GCTs (1). Previous studies used immunohistochemistry (17–19) and RNA interference (RNAi; ref. 20) to investigate the expression and some aspects of LIN28 function in malignant GCTs. Here, we provide the first demonstration that low let-7 levels in malignant GCTs are directly attributable to LIN28 expression and are likely to contribute to significant upregulation of important cancer-associated protein-coding genes.

Tumor samples

Our study received ethical approval from Trent-MREC (ref: 02/4/071) and Cambridge-LREC (ref: 01/128). We analyzed the following tissue samples and datasets:

Set 1.

Forty-eight samples of pediatric malignant GCTs and nonmalignant controls, which we previously used for global microRNA profiling (3) and for global mRNA profiling, a subset of 21 cases (3). Across the sample set, the controls (n = 8) represented fetal yolk sac, fetal ovary, prepubertal testis, postpubertal testis, prepubertal ovary, and postpubertal ovary. These samples contain germ cells, with variable representation of somatic cells (21). One apparent teratoma sample (MT-34) was not included in any subsequent analysis as it was a component of a mixed malignant GCT and clustered with malignant cases on microRNA profiling (3). The remaining 20 samples with matched microRNA and mRNA profiles comprised 17 malignant GCTs (10 YSTs, 6 germinomas, and 1 embryonal carcinoma) and 3 normal gonadal controls (1 pre- and 1 postpubertal testis and 1 postpubertal ovary; ref. 3).

Set 2.

A published dataset of global mRNA expression profiles of 25 samples from a study of adult testicular malignant GCTs (8 YSTs; 12 germinomas) and controls (5 normal adult testes, containing germ cells and somatic cells). Further details are available in the original publication (22) and our previous study (3).

Set 3.

Thirty-two samples in which we measured levels of selected mRNAs and microRNAs by quantitative reverse transcription PCR (qRT-PCR). Full details are given in Supplementary Table S1. The malignant GCTs represented 9 YSTs, 9 germinomas, and 3 embryonal carcinomas, with all except 3 being from pediatric patients (< 16 years). In addition, we used 6 malignant GCT cell lines and 5 benign teratomas. Twenty-four of the 32 samples overlapped with set 1 and had previously been used for microRNA profiling (3). However, only 6 of the 32 had undergone mRNA profiling (3; Supplementary Table S1), enabling set 3 to be used for independent qRT-PCR validation of findings from our mRNA microarray analyses of sets 1 and 2.

When combining sets 1 to 3, our study encompassed a total of 81 samples, comprising 54 different malignant GCTs (31 pediatric, 23 adult; 43 gonadal, 11 extragonadal), 6 malignant GCT cell lines, and 21 control samples (8 teratomas and 13 gonads/yolk sac).

MicroRNA and mRNA microarray expression analysis

We reanalyzed microRNA expression profiles for set 1 [obtained using the miRCURY-LNA array-v9.2 (Exiqon); ref. 3] and mRNA expression profiles for sets 1 and 2 [obtained using the HG-U133A GeneChip (Affymetrix); refs. 3, 22]. Differential gene expression was assessed using a moderated t statistic and P values adjusted for multiple testing using Benjamini and Hochberg method (23). MicroRNAs with adjusted P values less than 0.01 were considered to be significantly differentially expressed, whereas mRNAs with log2 fold-change 1.5 or more and adjusted P < 0.01 were considered to be overexpressed (3).

Sylamer bioinformatic algorithm

Sylamer assesses enrichment and/or depletion of SCR nucleotide words of specific length in the 3′UTRs of genes within ranked lists (24). We used Sylamer to identify whether the let-7 downregulation in malignant GCTs was of biologic significance by causing shifts in expression of mRNAs with a 3′UTR let-7 SCR (3). We conducted 3 analyses of mRNA microarray data, examining the pediatric samples from set 1 with matched microRNA and mRNA profiles (n = 20), the adult samples from set 2 (n = 25), and both groups in combination (n = 45). In Sylamer landscape plots, mRNA gene lists were ranked on the x-axis from downregulated (left) to upregulated (right). The y-axis showed log10-transformed and sign-adjusted enrichment P values for each SCR word, relative to P values of all other words. Consequently, an SCR showing a negative y-axis deflection on the right-hand side of each plot was enriched in upregulated genes. As previously (3), we calculated a single summed significance score and P value for each SCR. We only considered SCR elements that contained the core 2 to 7 nt sequence of the microRNA seed region, summating data for 1 hexamer (2–7 nt), 2 heptamers (1–7 nt and 2–8 nt), and 1 octamer (1–8 nt). P values less than 0.01 were considered significant (3). We tested for enrichment in the upregulated genes of 3′UTR SCRs corresponding to the 1 to 8 nt seeds of all 126 microRNAs downregulated in the 48 set 1 pediatric malignant GCTs (3).

mRNA qRT-PCR

Relative mRNA transcript levels were measured in triplicate in clinical samples and cell lines using QuantiTect One-Step SYBR-Green qRT-PCR (Qiagen), following reverse transcription of 1 μg of total RNA using QuantiTect Reverse Transcription (Qiagen). Primers (Supplementary Table S2) were designed using Primer3 (25), ensuring that they crossed exon–exon boundaries. Expression ratios were calculated using the comparative threshold cycle (Ct) method (26) and normalized using 4 housekeeping genes ACTB (Qiagen), YWHAZ, RPL13A, and HMBS (27). In analyses of clinical samples, results were referenced to a pooled normal gonadal control, using total RNA from human ovaries and testes (AM6974/AM7972, Ambion). It should be noted that these tissues contain both germ cells and somatic cells. For cell lines, results were referenced to cells treated with either nontargeting control (NTC) siRNA, or mimic negative control (MNC) RNA, as appropriate.

qRT-PCR for microRNA and pri-microRNA

MicroRNA levels were quantified in triplicate using TaqMan assays (Applied Biosystems), as described in references (3, 28). Levels of pri-microRNA were determined in quadruplicate, using TURBO DNA-free, TaqMan High Capacity RNA-to-cDNA, and TaqMan assays (all Applied Biosystems). Expression ratios were calculated using the comparative Ct method, with microRNAs normalized to RNU24 (3, 28) and pri-microRNAs to RPLO, GUS-B, and 18S. Reference samples were as for mRNA qRT-PCR. In test amplifications using 0.01 nmol/L single-stranded let-7e RNA (Sigma Aldrich) TaqMan qRT-PCR for let-7b and let-7d showed no cross-reactivity with let-7e (data not shown).

Western blotting

Western blots were conducted for LIN28, LIN28B, AURKB, and MYCN proteins using the antibodies ab46020 (1:10,000 dilution), ab119367 (1:1,000), ab2254 (1:5,000), and ab16898 (1:250), respectively. Results were normalized to β-tubulin (ab6046; 1:10,000). All antibodies were from Abcam. Western blot densitometry was conducted using FluorChem-9900 imaging system software (Alpha Innotech).

GCT cell lines

We selected four cell lines that reflected the range of malignant GCT histologic subtypes commonly observed in clinical practice, namely embryonal carcinoma (2102Ep; ref. 29), YST (GCT44 and 1411H), and germinoma/seminoma (TCam2; ref. 30). Cells were cultured at 37°C in 5% CO2 in medium containing 10% fetal calf serum and 1% penicillin/streptomycin, and were authenticated using short tandem repeat profiling (3).

RNA depletion and overexpression

Transcripts were depleted by RNAi in overexpressing malignant GCT cell lines using pools of 4 separate siRNAs to reduce any off-target effects (31). The probes targeted LIN28 (L-018411-01), LIN28B (L-028584-01), and MYCN (L-003913-01; all Dharmacon). Each pool was used at 66.7 nmol/L, which represented the minimal concentration of LIN28 siRNAs that achieved more than 75% LIN28 transcript depletion in test experiments (data not shown). All results were normalized to cells treated with a 66.7 nmol/L pool of 4 NTC siRNAs (D-001810-10-05, Dharmacon; ref. 32). We confirmed the specific effects of the LIN28-targeting pool using 2 independent siRNAs (Hs_LIN28_7 and Hs_LIN28_8, both Qiagen; target sequences TAAAGACTTATTGGTACGCAA and CACGCTGTGAGATCACCGCAA, respectively). Differences between experimental observations were assessed using an unpaired, 2-sample t test (2-tailed with 95% confidence intervals). Let-7e was replenished in underexpressing malignant GCT cell lines using let-7e miRIDIAN double-stranded RNA-mimic (C-300479-05) at 100 nmol/L (33) and was normalized to cells treated with 100 nmol/L miRIDIAN MNC (CN-001000-01, both Dharmacon).

Cell transfection and proliferation assays

Following optimization of transfection conditions (data not shown), cells were seeded in 6-well plates, with 2102Ep at 7 × 104 cells per well, 1411H and GCT44 at 1.0 × 105 cells per well, and TCam2 1.5 × 105 cells per well. On day 0 (d0), when cells were approximately 20% confluent, transfection was conducted using Opti-MEM media and Lipofectamine-RNAiMAX (both Invitrogen). The optimal length of transfection, which maximized transfection efficiency and minimized toxicity, was 24 hours for 2102Ep cell line, 6 to 8 hours for 1411H and GCT44, and 4 to 6 hours for TCam2. At least three biologic replicates were done for each treatment. For RNA and protein quantification, the replicate samples were pooled prior to further analysis. For qRT-PCR, at least three technical replicates were done per analysis.

Cell numbers were quantified using Trypan blue on a Countess automated cell counter (Invitrogen), determining the mean of two values for each of three biologic replicates and then taking the mean of the resulting three values. Maximal growth rates were determined by plotting cell numbers at 24-hour time-points on a logarithmic scale and calculating population doubling-time from the linear section of the curve, as described (34).

Luciferase reporter assays

We studied let-7 effects on target genes using GoClone luciferase reporter plasmids containing the full-length 3′UTR for LIN28 (S813978), MYCN (S807230), or AURKB (custom-made), plus a control luciferase plasmid containing no 3′UTR (S890005; all plasmids from SwitchGear Genomics). Test oligonucleotides were let-7e, nontargeting RNA (NT2; MIM9002), and a mutant let-7e (let-7e-mutant; sequence UGAGUGAGGAGGUUGUAUAGUU), in which the 2 to 7 nt seed was mutated to “GAGUGA.” The latter sequence did not correspond to any known human microRNA seed, thereby avoiding seed-like off-target effects in transfected cells. All experiments were done twice in quadruplicate in 96-well plates, using more than 80% confluent cells, with 50 ng of plasmid per well and 100 nmol/L oligonucleotides. Luminescence was quantified on a BioTek Synergy-HT multi-mode microplate reader (BioTek Instruments Inc). After background correction, the means for the test let-7e/let-7e-mutant oligonucleotides were normalized to values for NT2-treated cells, then referenced to cells containing the no 3′UTR control reporter that had also been treated with let-7e/let-7e-mutant, as appropriate.

Let-7 and LIN28 expression in malignant GCTs

In our previous microRNA profiling study of sample set 1, we identified that all 9 members of the tumor-suppressor let-7 microRNA family were significantly downregulated in pediatric malignant GCTs, compared with nonmalignant tissues (benign GCTs and normal gonad; ref. 3), which contain a variable representation of germ cells and somatic cells. The fold changes observed for each let-7 family member are given in Supplementary Table S3, with let-7e being the most significantly underexpressed by P value. For the subset of 20 pediatric samples with matched microRNA and mRNA profiles, the malignant GCTs again showed significant reductions in let-7 microRNAs, when assessing each family member individually (Supplementary Fig. S1A), or collectively (Fig. 1A).

Figure 1.

Let-7 and LIN28 expression in malignant GCTs. A, left and middle, show median levels of all 9 let-7 family members and levels of LIN28 in the 20 samples from set 1 with matching microRNA and mRNA data, respectively. Right, levels of LIN28 in sample set 2. B, linear-regression analysis of median let-7 family levels versus LIN28 levels in the set 1 samples with matching data. In A and B, all values are referenced to the mean of the normal gonadal samples. C, qRT-PCR validation in sample set 3, referenced to the pooled normal gonadal control sample. Error bars, SEM. For one sample (*), there was insufficient RNA for let-7e quantification. The color code for all panels is shown in the key. For details of the normal gonadal controls, see Materials and Methods.

Figure 1.

Let-7 and LIN28 expression in malignant GCTs. A, left and middle, show median levels of all 9 let-7 family members and levels of LIN28 in the 20 samples from set 1 with matching microRNA and mRNA data, respectively. Right, levels of LIN28 in sample set 2. B, linear-regression analysis of median let-7 family levels versus LIN28 levels in the set 1 samples with matching data. In A and B, all values are referenced to the mean of the normal gonadal samples. C, qRT-PCR validation in sample set 3, referenced to the pooled normal gonadal control sample. Error bars, SEM. For one sample (*), there was insufficient RNA for let-7e quantification. The color code for all panels is shown in the key. For details of the normal gonadal controls, see Materials and Methods.

Close modal

As individual let-7 members are transcribed from multiple genomic loci, this observation suggested the possibility of a common posttranscriptional mechanism regulating let-7 biogenesis in malignant GCTs. We therefore sought to identify whether let-7 downregulation was associated with overexpression of LIN28. Using all available mRNA microarray data, we found that LIN28 was highly expressed in 44 of 45 (97.8%) of malignant GCTs from pediatric and adult patients (from sets 1 and 2 combined; Fig. 1A), regardless of tumor site (gonadal/extragonadal) or histologic subtype. For the 20 pediatric samples with matched microRNA and mRNA data, LIN28 showed a highly significant negative correlation with median let-7 levels (R2 = 0.63; P < 0.0001; Fig. 1B) and with levels of each individual let-7 family member (all P < 0.005; Supplementary Fig. S1B).

We validated these microarray findings using the independent technique of qRT-PCR in a panel of 32 samples (set 3). Compared with pooled normal gonadal control RNA, all 27 of the malignant GCT samples and cell lines showed high LIN28 expression (Fig. 1C). Twenty-four of the 27 also showed high expression of LIN28B (Fig. 1C), which is located at a different chromosomal locus (6q16.3; vs. 1p36.11 for LIN28). In contrast, levels of the TUTase ZCCHC11 were not elevated either in malignant GCT samples or teratomas (Fig. 1C). Using TaqMan qRT-PCR, we confirmed that let-7e (the most significantly downregulated let-7 in our microarray analysis) showed low expression in all the malignant GCT samples/cell lines (Fig. 1C). Linear regression using the qRT-PCR data confirmed that let-7e levels were significantly negatively correlated with LIN28 and LIN28B (P = 0.017 and P = 0.036, respectively; Supplementary Fig. S2), but not with ZCCHC11.

Biologic significance of low let-7 levels in malignant GCTs

Sylamer showed that “TACCTC” (complementary to the 2–7 nt common let-7 seed “GAGGUA”) was the top-ranking SCR in mRNAs that significantly upregulated in malignant GCTs (compared with the normal gonadal control tissues), irrespective of patient age. There were highly significant P values for the summed significance scores of the let-7 1 to 8 nt SCR in the datasets for the pediatric malignant GCTs (set 1; P = 0.00057), the adult malignant GCTs (set 2; P = 0.00026; both Supplementary Fig. S3), and the combined analysis (P = 0.0013; Fig. 2A). In all analyses, there was no significant enrichment in the upregulated mRNAs of SCRs for any of the other 126 microRNAs tested.

Figure 2.

Significance of let-7 downregulation in malignant GCTs. A, Sylamer landscape plots for SCR words corresponding to the common seed of the 9 let-7 microRNA family members in the combined analysis of pediatric (set 1) and adult (set 2) malignant GCTs. Log10-transformed P values for each SCR word are plotted on the y-axis, against the ranked gene list on the x-axis. A negative y-axis deflection on the right-hand side of the plot signifies SCR enrichment in upregulated genes. The left-hand plot shows data for the hexamer complementary to the core 2 to 7 nt component of the common seed region, the central plot the 2 heptamers (1–7 nt; 2–8 nt), and the right-hand plot the octamer (1–8 nt). The single summed significance score and P value for all 4 SCR words is shown. B, levels of the 6 selected let-7 mRNA targets in sample set 3 determined by qRT-PCR. Error bars, SEM. C, correlations between each mRNA and let-7e in set 3. P values were determined by linear regression.

Figure 2.

Significance of let-7 downregulation in malignant GCTs. A, Sylamer landscape plots for SCR words corresponding to the common seed of the 9 let-7 microRNA family members in the combined analysis of pediatric (set 1) and adult (set 2) malignant GCTs. Log10-transformed P values for each SCR word are plotted on the y-axis, against the ranked gene list on the x-axis. A negative y-axis deflection on the right-hand side of the plot signifies SCR enrichment in upregulated genes. The left-hand plot shows data for the hexamer complementary to the core 2 to 7 nt component of the common seed region, the central plot the 2 heptamers (1–7 nt; 2–8 nt), and the right-hand plot the octamer (1–8 nt). The single summed significance score and P value for all 4 SCR words is shown. B, levels of the 6 selected let-7 mRNA targets in sample set 3 determined by qRT-PCR. Error bars, SEM. C, correlations between each mRNA and let-7e in set 3. P values were determined by linear regression.

Close modal

We used Sylamer to produce a list of let-7 mRNA targets that were overexpressed in all malignant GCTs, for further validation in clinical samples and functional investigation in vitro. We identified 198 upregulated genes from the pediatric mRNA dataset (set 1), of which 50 (25.3%) had at least one “TACCTC” 3′UTR sequence. For the adult dataset (set 2), we identified 428 upregulated genes, of which 106 (24.8%) contained at least one 3′UTR TACCTC. These values compared with an overall frequency of 19.8% for the TACCTC sequence in the 3′UTR of all annotated genes on the array. Thirty-six let-7 mRNA targets were common to both datasets, with 27 having a significant negative correlation with median let-7 levels in the 20 pediatric tissue samples from set 1 that had matched microRNA and mRNA microarray data (Supplementary Table S4 and Supplementary Fig. S4). We selected 16 of these 27 genes for further interrogation, based on their reported functions in human disease, including cancer. The genes were: MYCN, CCNF, RRM2, AURKB, MKI67, C12orf5, FZD5, KRAS, PGK1, SMAGP, RAB25, RAB15, MRS2, SLC2A3, LASP1, and AGL.

HMGA2, a known let-7 target in carcinoma cells (35), was included in the initial list of 36 mRNAs, as it was upregulated in both pediatric set 1 (rank 40/50) and adult set 2 (rank 63/106). However, HMGA2 showed no significant correlation with median let-7 levels across these datasets (P = 0.12). To investigate these observations further, we measured HMGA2 levels in set 3 using qRT-PCR. This showed that while HMGA2 was overexpressed in some subtypes of malignant GCT (YSTs and embryonal carcinoma), it showed only minimal expression changes in another major subtype, germinoma (Supplementary Fig. S5A and S5B). The lack of overall association between HMGA2 and let-7 levels was also confirmed in this qRT-PCR analysis (P = 0.12; Supplementary Fig. S5C).

Validation of let-7 mRNA targets

By qRT-PCR analysis of the 32 samples in set 3, we confirmed overexpression of all 16 selected mRNAs in malignant GCTs, compared with the control samples used (Fig. 2B, Supplementary Fig. S6). We identified a negative association with let-7e qRT-PCR levels for 6 mRNAs (MYCN, AURKB, CCNF, RRM2, MKI67, and C12orf5; Supplementary Table S5; Fig. 2C). It should be noted that the associations were only significant when including the control samples, in which there was a mixture of germ cells and somatic cells. Accordingly, these findings should be viewed with caution in the absence of follow-up functional data (see below). On the other hand, there was no significant association for the other 10 of the 16 genes, when the control samples were included. Of these other 10 mRNAs, RAB25, MRS2, PGK1, KRAS, and LASP1 were overexpressed in malignant GCTs of particular histologic subtypes (Supplementary Fig. S6), but did not show an association with let-7e levels across the whole sample set. The other 5 mRNAs (FZD5, SMAGP, RAB15, SLC2A3, and AGL) showed no association with let-7e qRT-PCR levels (Supplementary Fig. S6), suggesting that their expression is regulated by additional factors, which may include other microRNAs.

Depletion of LIN28 and LIN28B

We next tested the functional significance of our observations in vitro, using multiple complementary experimental approaches to minimize the possibility of nonspecific observations. We tested for phenotypic and functional consistencies when: (i) depleting LIN28 or LIN28B by RNAi, using panels of 4 siRNAs to minimize any off-target effects (31), with separate confirmation using independent siRNAs; (ii) directly overexpressing let-7e (the let-7 family member that showed the most significant underexpression in vivo; Supplementary Table S3) using a double-stranded RNA mimic; and (iii) depleting MYCN, a major let-7e target, by RNAi using a panel of 4 independent siRNAs. In this in vitro work, we used 4 representative malignant GCT cell lines, all of which showed LIN28 upregulation and let-7 underexpression (Fig. 1C).

In 2102Ep cells, a single treatment with pooled siRNAs depleted LIN28 mRNA by more than 90% over a 7-day period. There were parallel reductions in protein levels, which fell to less than 10% from d3 (Fig. 3A and Supplementary Fig. S7A). There was no effect on LIN28B or ZCCHC11 mRNA levels on d1 to d3 (data not shown). The reductions in LIN28 protein levels were mirrored by changes in cell proliferation, which fell from d3 (Fig. 3B). There was a 36% increase in mean population doubling time over the 7d time-course (33.9 vs. 24.9 hours, respectively).

Figure 3.

LIN28 depletion in 2102Ep malignant GCT cells. A, depletion of LIN28, measured by qRT-PCR over d1–d7 (left) and by Western blot analysis over d3–d5 (right). NTC, nontargeting control siRNA; kd, knockdown. B, cell numbers following LIN28 depletion. C, levels of let-7e more than d1–d7 following LIN28 depletion. A–C, statistical comparisons are versus NTC-treated cells. d, day. D, levels of let-7 family members (let-7b, let-7d, and let-7e) and the 6 selected let-7 mRNA targets at d2, d4, and d7 following LIN28 depletion. Expression values are referenced to NTC-treated cells. Statistical comparisons are for LIN28kd cells at d4 and d7 versus LIN28kd cells at d2. Error bars, SEM. B–D, *, P < 0.05; **, P < 0.005; ***, P ≤ 0.0001.

Figure 3.

LIN28 depletion in 2102Ep malignant GCT cells. A, depletion of LIN28, measured by qRT-PCR over d1–d7 (left) and by Western blot analysis over d3–d5 (right). NTC, nontargeting control siRNA; kd, knockdown. B, cell numbers following LIN28 depletion. C, levels of let-7e more than d1–d7 following LIN28 depletion. A–C, statistical comparisons are versus NTC-treated cells. d, day. D, levels of let-7 family members (let-7b, let-7d, and let-7e) and the 6 selected let-7 mRNA targets at d2, d4, and d7 following LIN28 depletion. Expression values are referenced to NTC-treated cells. Statistical comparisons are for LIN28kd cells at d4 and d7 versus LIN28kd cells at d2. Error bars, SEM. B–D, *, P < 0.05; **, P < 0.005; ***, P ≤ 0.0001.

Close modal

In keeping with these observations, levels of let-7e started increasing from d3, with significant changes from d4 (Fig. 3C). The specificity of the effects of the pooled LIN28 siRNAs on cell proliferation and let-7e levels was confirmed using 2 independent siRNAs (Supplementary Fig. S8). The pooled LIN28 siRNAs also caused increases in other representative let-7 family members (let-7b and let-7d), when assessed at d4 and d7 (Fig. 3D). There was no difference in levels of the pri-let-7e precursor at d7 (data not shown). Of the selected let-7 mRNA targets (Fig. 2B), all 6 showed decreased levels on d4 and d7 (time-points at which growth-inhibition was observed), compared with d2 (when no growth-inhibition was seen). Most of the decreases were statistically significant (Fig. 3D), with the most significant reduction being for MYCN, where transcript levels were lowered by 62% at d4 versus d2 (P < 0.0001; Fig. 3D).

We attempted to deplete LIN28 in 3 other malignant GCT cell lines, assessing the effects at d4 posttransfection, based on our findings in 2102Ep. While we could achieve 87% transcript depletion in TCam2, cell toxicity restricted the levels of depletion achieved in 1411H and GCT44 to 57% and 46%, respectively. There were parallel reductions in protein levels, as measured at d4 following siRNA treatment (Supplementary Fig. S7B), with a significant positive correlation between LIN28 mRNA and protein levels across the 4 cell lines (R2 = 0.88, P < 0.0001; Supplementary Fig. S7C). The LIN28 reductions observed in 1411H and GCT44 were not sufficient to affect cell numbers, compared with NTC-treated cells (Fig. 4A and Supplementary Fig. S7D). However, across all 4 cell lines, there were significant positive correlations between levels of LIN28 and MYCN transcripts (R2 = 0.78, P = 0.0001; Fig. 4B) and between cell proliferation (quantifying cell numbers at d4) and transcript levels of LIN28 (R2 = 0.85, P < 0.0001) and MYCN (R2 = 0.78, P < 0.0001; Fig. 4A).

Figure 4.

Correlations between LIN28, MYCN, and cell numbers following LIN28 depletion. The graphs show data for all 4 malignant GCT cell lines at d4 following LIN28 depletion, compared with NTC-treated cells. A and B, cell numbers versus the levels of LIN28 (red) and MYCN (blue; A), whereas B shows levels of MYCN versus LIN28 (B). NTC, nontargeting control siRNA; kd, knockdown. Correlation P values were determined by linear regression. Error bars, SEM.

Figure 4.

Correlations between LIN28, MYCN, and cell numbers following LIN28 depletion. The graphs show data for all 4 malignant GCT cell lines at d4 following LIN28 depletion, compared with NTC-treated cells. A and B, cell numbers versus the levels of LIN28 (red) and MYCN (blue; A), whereas B shows levels of MYCN versus LIN28 (B). NTC, nontargeting control siRNA; kd, knockdown. Correlation P values were determined by linear regression. Error bars, SEM.

Close modal

We next depleted LIN28B in 2102Ep and TCam2, achieving more than 80% transcript depletion and more than 85% protein depletion by d4 (Fig. 5A and B). In contrast to the effects of LIN28 depletion (Fig. 3D), we observed only modest increases in levels of let-7b, let-7d, and let-7e (1.21–1.96-fold; Fig. 5C), with no effect on MYCN levels or cell proliferation (Fig. 5A).

Figure 5.

LIN28B depletion in malignant GCT cells. A, cell numbers and qRT-PCR expression levels of LIN28B, LIN28, and MYCN on d4 following LIN28B depletion in 2102Ep (left) and TCam2 (right). B, Western blots showing expression of LIN28B on d4 following LIN28B depletion in 2102Ep (left) and TCam2 (right), compared with NTC-treated cells. C, levels of representative let-7 family members (let-7b, let-7d, and let-7e) on d4 following LIN28B depletion in 2102Ep (left) and TCam2 (right). All values are referenced to NTC-treated cells. NTC, nontargeting control siRNA; kd, knockdown; error bars, SEM. *, P < 0.05; **, P < 0.005; ***, P ≤ 0.0001.

Figure 5.

LIN28B depletion in malignant GCT cells. A, cell numbers and qRT-PCR expression levels of LIN28B, LIN28, and MYCN on d4 following LIN28B depletion in 2102Ep (left) and TCam2 (right). B, Western blots showing expression of LIN28B on d4 following LIN28B depletion in 2102Ep (left) and TCam2 (right), compared with NTC-treated cells. C, levels of representative let-7 family members (let-7b, let-7d, and let-7e) on d4 following LIN28B depletion in 2102Ep (left) and TCam2 (right). All values are referenced to NTC-treated cells. NTC, nontargeting control siRNA; kd, knockdown; error bars, SEM. *, P < 0.05; **, P < 0.005; ***, P ≤ 0.0001.

Close modal

Restoration of let-7 levels

Transfection with let-7e mimic produced the greatest increases in let-7e levels in 2102Ep and 1411H (Fig. 6), which were selected for further investigations. In both cell lines, let-7e transfection resulted in significant reductions in mRNA levels of MYCN and LIN28 at d2, when compared with MNC-treated cells (all P ≤ 0.001; Fig. 6A). Over a 3d time-course in 2102Ep, we observed reduced levels of MYCN, AURKB, LIN28, and LIN28B transcripts (Supplementary Fig. S9A), with a significant negative correlation between mean transcript depletion over d1 to d3 and the number of 3′UTR let-7 SCRs (R2 = 0.97, P = 0.0145; Supplementary Fig. S9B). Levels of all 4 proteins were reduced when assessed on d2 and d3 (Fig. 6B and C). Overall, across the 4 malignant GCT cell lines examined, there was a significant negative correlation between let-7e levels obtained following let-7e mimic transfection and cell proliferation (R2 = 0.94; P < 0.0001; Fig. 6D).

Figure 6.

Effects of let-7e mimic in malignant GCT cells. A, cell numbers and expression levels of MYCN and LIN28 in 2102Ep (left) and 1411H (right), at d2 posttransfection of let-7e mimic, relative to cells treated with mimic negative control (MNC) RNA. B, Western blots showing expression of LIN28, AURKB, MYCN, and LIN28B proteins at d2 and d3 following let-7e mimic transfection of 2102Ep cells, corresponding to Supplementary Fig. S9A. The bottom row shows the β-tubulin loading control. C, the graph shows protein levels at d3, as determined by densitometry of the Western blots shown in B, normalized to β-tubulin and referenced to MNC-treated cells. D, cell numbers versus let-7e levels at d2 in 4 different malignant GCT cell lines compared with MNC-treated cells. The P value was determined by linear regression. E, levels of other representative let-7 family members (let-7b and let-7d) and control miR-492, at d2 following let-7e transfection in 2102Ep (left) and 1411H (right), relative to MNC-treated cells.

Figure 6.

Effects of let-7e mimic in malignant GCT cells. A, cell numbers and expression levels of MYCN and LIN28 in 2102Ep (left) and 1411H (right), at d2 posttransfection of let-7e mimic, relative to cells treated with mimic negative control (MNC) RNA. B, Western blots showing expression of LIN28, AURKB, MYCN, and LIN28B proteins at d2 and d3 following let-7e mimic transfection of 2102Ep cells, corresponding to Supplementary Fig. S9A. The bottom row shows the β-tubulin loading control. C, the graph shows protein levels at d3, as determined by densitometry of the Western blots shown in B, normalized to β-tubulin and referenced to MNC-treated cells. D, cell numbers versus let-7e levels at d2 in 4 different malignant GCT cell lines compared with MNC-treated cells. The P value was determined by linear regression. E, levels of other representative let-7 family members (let-7b and let-7d) and control miR-492, at d2 following let-7e transfection in 2102Ep (left) and 1411H (right), relative to MNC-treated cells.

Close modal

The LIN28 and LIN28B depletion (Fig. 6A, Supplementary Fig. S9A) were explained by the presence in 3′UTRs of the “TACCTC” SCR for the common 2 to 7 nt let-7 seed, with one copy in LIN28 (Supplementary Fig. S9C) and 5 copies in LIN28B (data not shown). In keeping with the reduced LIN28 levels, we observed approximately 15- to 30-fold increases in other let-7 family members examined (let-7b and let-7d) in both 2102Ep (P = 0.0001 for both) and 1411H (P = 0.0006 and P = 0.0002, respectively; Fig. 6E). There was no increase in levels of a control microRNA (miR-492) lacking the LIN28 “GGAG” binding site in its stem-loop (Fig. 6E).

We confirmed let-7e effects on LIN28, MYCN, and AURKB using quantitative luciferase reporter assays. Let-7e produced a significant reduction in luminescence relative to nontargeting oligonucleotides, in cells containing the 3′UTR for LIN28 (P = 0.0003), MYCN (P = 0.011) or AURKB (P < 0.0001), whereas there were no reductions with mutant let-7e (Fig. 7). These findings are supported by evidence from other cell types showing direct targeting of MYCN by let-7e (36) and of AURKB by let-7b (37), which has an identical 2 to 7 nt seed to that of let-7e.

Figure 7.

Luciferase assay confirmation of let-7 targets in malignant GCT cells. Luciferase assay data at d2 for 2102Ep cells transfected with a reporter containing the full-length 3′UTR for LIN28 (red), MYCN (blue), or AURKB (orange). Cells were also transfected with either let-7e or let-7e-mutant (let-7e-mut). Luminescence values were normalized to cells treated with nontargeting oligonucleotides (NT2), then referenced to cells containing a no 3′UTR control reporter and treated with let-7e/let-7e-mutant, as appropriate. Error bars, SEM. All correlation P values were determined by linear regression. *, P < 0.05; **, P < 0.005; ***, P ≤ 0.0001.

Figure 7.

Luciferase assay confirmation of let-7 targets in malignant GCT cells. Luciferase assay data at d2 for 2102Ep cells transfected with a reporter containing the full-length 3′UTR for LIN28 (red), MYCN (blue), or AURKB (orange). Cells were also transfected with either let-7e or let-7e-mutant (let-7e-mut). Luminescence values were normalized to cells treated with nontargeting oligonucleotides (NT2), then referenced to cells containing a no 3′UTR control reporter and treated with let-7e/let-7e-mutant, as appropriate. Error bars, SEM. All correlation P values were determined by linear regression. *, P < 0.05; **, P < 0.005; ***, P ≤ 0.0001.

Close modal

Effects of MYCN depletion

We tested whether LIN28/LIN28B levels in malignant GCTs might be regulated by MYCN and the related protein CMYC, similar to findings in other tumor types (38, 39). Our microarray data showed upregulation of MYCN in both pediatric (set 1; n = 20) and adult (set 2; n = 25) malignant GCTs, compared with the controls used. There was a significant positive correlation with LIN28 levels in both sets (P < 0.0001 and P = 0.001, respectively; Supplementary Fig. S10). In contrast, CMYC levels showed no elevation and no positive correlation with LIN28 in either set (Supplementary Fig. S10). As LIN28B was not represented on the microarray used to profile mRNAs in the pediatric malignant GCTs, we used qRT-PCR analysis of set 3 (n = 32) to show significant positive correlations between MYCN and both LIN28 and LIN28B in malignant GCTs (P = 0.0018 and P = 0.0121, respectively). While depleting MYCN in 2102Ep and TCam2 reduced cell numbers, it had no consistent effects on levels of LIN28 or LIN28B (Supplementary Fig. S11). Together, these data supported our evidence that MYCN is an important upregulated let-7 target in malignant GCT cells, but argued against a significant effect of MYCN or CMYC upstream of LIN28/LIN28B.

This study shows that LIN28-homolog A (LIN28) is abundantly expressed in all malignant GCTs, regardless of patient age, histologic type or anatomic site, thereby extending published reports describing predominantly or exclusively tumors of adults (17–20). Importantly, we identify the functional significance of the observed LIN28 expression, which results in let-7 family downregulation (Supplementary Fig. S12). Our qRT-PCR analysis of tissue samples suggested that let-7 underexpression may contribute to increased expression of let-7 protein-coding gene targets, a possibility that was supported by our functional data from LIN28 depletion and let-7e overexpression experiments. The potential let-7 targets in malignant GCTs have known promalignant effects, such as increased proliferation and reduced apoptosis (Supplementary Table S5). While LIN28B is also highly expressed in malignant GCTs, our data do not indicate an important role for the protein in regulating let-7 microRNAs.

A previous study showed that LIN28 depletion in malignant GCT cells led to downregulation of stem-cell markers (e.g., OCT4/POU5F1 and NANOG) and induction of differentiation, although effects on let-7 expression were not assessed (20). In our LIN28 depletion experiments, protein levels fell to less than 10% from d3, a change that coincided with reduced cell growth from d3 and increased let-7 levels from d4. These findings are consistent with the observation that LIN28 depletion in carcinoma cells in vitro was not associated with significant increases in let-7 levels until d4 after transfection (40). In addition, the let-7e targets identified in the present study resonate with those seen in other malignancies, suggesting molecular parallels between disparate tumor types (40, 41). Posttranscriptional effects of LIN28/let-7 deregulation on MYCN levels (36) would explain the observations that MYCN is frequently overexpressed in malignant GCTs (42) but shows copy number gain (at 2p23.4) in only approximately 1/3 of adult tumors (43) and less than 1/5 of pediatric cases (44). Interestingly, we found that LIN28 depletion led to increased levels of mature let-7 without reducing levels of pri-let-7. It is likely that levels of pri-let-7 are low even in the presence of abundant LIN28, for example due to degradation after LIN28 binding.

As well as downregulation of let-7 by LIN28, we observed a reciprocal effect, with downregulation of LIN28 by let-7e, via a let-7 SCR in the LIN28 3′UTR (45, 46). In malignant GCT cells, let-7e–mediated downregulation of LIN28 produced specific effects, by increasing other let-7 family targets of LIN28 rather than producing a more generalized effect on microRNA biogenesis. Other microRNAs known to downregulate LIN28 in embryonic stem-cells and cancer cells through 3′UTR SCRs include miR-9 (47), miR-30 family (47), miR-125 (47, 48), and miR-181 (49). Interestingly, all 4 were identified in our previous profiling study as being universally underexpressed in malignant GCTs, compared with the control tissues used (3). As copy number gain at the LIN28 locus (1p36.11) is not a feature of malignant GCTs (44), downregulation of these microRNAs is likely to be an important further contributor to LIN28 overexpression in vivo.

Our data suggest that LIN28/let-7 interactions are promising targets for novel therapies in malignant GCTs. As well as directly depleting LIN28, it may also be possible to overcome the effects of overexpressed LIN28 on microRNA maturation, for example, by protective small molecule targeting of pre-let-7 stem-loop binding motifs, inhibition of the TUTase ZCCHC11, or induction of the stem-loop binding protein KSRP, which promotes maturation of a subset of microRNAs that includes let-7 (50). These indirect interventions would not counteract LIN28 effects on primary transcript processing and may not restore adequate levels of mature let-7 molecules if used in isolation. An alternative strategy is direct replacement of let-7 using mature let-7 mimics. Our data indicate that administering a single member of the let-7 family should restore levels of other family members in malignant GCTs by targeting LIN28. The other let-7 members would lead to further reinforcement of LIN28 downregulation, providing a molecular “switch” effect that should result in a sustained reversion of cell phenotype.

No potential conflicts of interest were disclosed.

Conception and design: M.J. Murray, C.A. Siegler, J.E. Hanning, I.J. Groves, C.G. Scarpini, A.J. Enright, J.C. Nicholson, N. Coleman

Development of methodology: M.J. Murray, C.A. Siegler, J.E. Hanning, I.J. Groves, C.G. Scarpini, M.R. Pett, J.C. Nicholson, N. Coleman

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): M.J. Murray, C.A. Siegler, J.E. Hanning, D.M. Ward, K.L. Raby, N. Coleman

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): M.J. Murray, H.K. Saini, C.A. Siegler, J.E. Hanning, E.M. Barker, S. van Dongen, D.M. Ward, K.L. Raby, I.J. Groves, C.G. Scarpini, A.J. Enright, J.C. Nicholson, N. Coleman

Writing, review, and/or revision of the manuscript: M.J. Murray, H.K. Saini, J.E. Hanning, I.J. Groves, C.G. Scarpini, A.J. Enright, J.C. Nicholson, N. Coleman

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): M.J. Murray, E.M. Barker, D.M. Ward, K.L. Raby, C.M. Thornton, A.J. Enright

Study supervision: M.J. Murray, J.C. Nicholson, N. Coleman

The authors thank Mr Alex Byford for technical assistance.

This work was supported by Cancer Research-UK programme grant (N. Coleman), Medical Research Council Fellowship (M.J. Murray), and Addenbrooke's Charitable Trust (M.J. Murray).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Murray
MJ
,
Nicholson
JC
. 
Germ cell tumours in children and adolescents. paediatrics and child health
2010
;
20
:
109
16
.
2.
Huyghe
E
,
Matsuda
T
,
Thonneau
P
. 
Increasing incidence of testicular cancer worldwide: a review
.
J Urol
2003
;
170
:
5
11
.
3.
Palmer
RD
,
Murray
MJ
,
Saini
HK
,
van Dongen
S
,
Abreu-Goodger
C
,
Muralidhar
B
, et al
Malignant germ cell tumors display common microRNA profiles resulting in global changes in expression of messenger RNA targets
.
Cancer Res
2010
;
70
:
2911
23
.
4.
Lewis
BP
,
Shih
IH
,
Jones-Rhoades
MW
,
Bartel
DP
,
Burge
CB
. 
Prediction of mammalian microRNA targets
.
Cell
2003
;
115
:
787
98
.
5.
Lewis
BP
,
Burge
CB
,
Bartel
DP
. 
Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets
.
Cell
2005
;
120
:
15
20
.
6.
Takamizawa
J
,
Konishi
H
,
Yanagisawa
K
,
Tomida
S
,
Osada
H
,
Endoh
H
, et al
Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival
.
Cancer Res
2004
;
64
:
3753
6
.
7.
Johnson
CD
,
Esquela-Kerscher
A
,
Stefani
G
,
Byrom
M
,
Kelnar
K
,
Ovcharenko
D
, et al
The let-7 microRNA represses cell proliferation pathways in human cells
.
Cancer Res
2007
;
67
:
7713
22
.
8.
Viswanathan
SR
,
Daley
GQ
,
Gregory
RI
. 
Selective blockade of microRNA processing by Lin28
.
Science
2008
;
320
:
97
100
.
9.
Viswanathan
SR
,
Powers
JT
,
Einhorn
W
,
Hoshida
Y
,
Ng
TL
,
Toffanin
S
, et al
Lin28 promotes transformation and is associated with advanced human malignancies
.
Nat Genet
2009
;
41
:
843
8
.
10.
Hagan
JP
,
Piskounova
E
,
Gregory
RI
. 
Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells
.
Nat Struct Mol Biol
2009
;
16
:
1021
5
.
11.
Viswanathan
SR
,
Daley
GQ
. 
Lin28: A microRNA regulator with a macro role
.
Cell
2010
;
140
:
445
9
.
12.
Heo
I
,
Joo
C
,
Kim
YK
,
Ha
M
,
Yoon
MJ
,
Cho
J
, et al
TUT4 in concert with Lin28 suppresses microRNA biogenesis through pre-microRNA uridylation
.
Cell
2009
;
138
:
696
708
.
13.
Loughlin
FE
,
Gebert
LF
,
Towbin
H
,
Brunschweiger
A
,
Hall
J
,
Allain
FH
. 
Structural basis of pre-let-7 miRNA recognition by the zinc knuckles of pluripotency factor Lin28
.
Nat Struct Mol Biol
2012
;
19
:
84
9
.
14.
Heo
I
,
Joo
C
,
Cho
J
,
Ha
M
,
Han
J
,
Kim
VN
. 
Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA
.
Mol Cell
2008
;
32
:
276
84
.
15.
Peng
S
,
Maihle
NJ
,
Huang
Y
. 
Pluripotency factors Lin28 and Oct4 identify a sub-population of stem cell-like cells in ovarian cancer
.
Oncogene
2010
;
29
:
2153
9
.
16.
West
JA
,
Viswanathan
SR
,
Yabuuchi
A
,
Cunniff
K
,
Takeuchi
A
,
Park
IH
, et al
A role for Lin28 in primordial germ-cell development and germ-cell malignancy
.
Nature
2009
;
460
:
909
13
.
17.
Cao
D
,
Allan
RW
,
Cheng
L
,
Peng
Y
,
Guo
CC
,
Dahiya
N
, et al
RNA-binding protein LIN28 is a marker for testicular germ cell tumors
.
Hum Pathol
2011
;
42
:
710
8
.
18.
Cao
D
,
Liu
A
,
Wang
F
,
Allan
RW
,
Mei
K
,
Peng
Y
, et al
RNA-binding protein LIN28 is a marker for primary extragonadal germ cell tumors: an immunohistochemical study of 131 cases
.
Mod Pathol
2011
;
24
:
288
96
.
19.
Xue
D
,
Peng
Y
,
Wang
F
,
Allan
RW
,
Cao
D
. 
RNA-binding protein LIN28 is a sensitive marker of ovarian primitive germ cell tumours
.
Histopathology
2011
;
59
:
452
9
.
20.
Gillis
AJ
,
Stoop
H
,
Biermann
K
,
van Gurp
RJ
,
Swartzman
E
,
Cribbes
S
, et al
Expression and interdependencies of pluripotency factors LIN28, OCT3/4, NANOG and SOX2 in human testicular germ cells and tumours of the testis
.
Int J Androl
2011
;
34
:
e160
74
.
21.
Mills
SE
. 
Sternbergs histology for pathologists. 3rd ed
.
New York
:
Lippincott, Williams and Wilkins
; 
2006
.
22.
Korkola
JE
,
Houldsworth
J
,
Chadalavada
RS
,
Olshen
AB
,
Dobrzynski
D
,
Reuter
VE
, et al
Down-regulation of stem cell genes, including those in a 200-kb gene cluster at 12p13.31, is associated with in vivo differentiation of human male germ cell tumors
.
Cancer Res
2006
;
66
:
820
7
.
23.
Benjamini
Y HY
. 
Controlling the false discovery rate—a practical and powerful approach to multiple testing
.
J R Stat Soc Ser B
1995
;
57
:
289
300
.
24.
van Dongen
S
,
Abreu-Goodger
C
,
Enright
AJ
. 
Detecting microRNA binding and siRNA off-target effects from expression data
.
Nat Methods
2008
;
5
:
1023
5
.
25.
Primer 3.[cited 26th August 2012]; Available from
: http://frodo.wi.mit.edu/primer3/
26.
Herdman
MT
,
Pett
MR
,
Roberts
I
,
Alazawi
WO
,
Teschendorff
AE
,
Zhang
XY
, et al
Interferon-beta treatment of cervical keratinocytes naturally infected with human papillomavirus 16 episomes promotes rapid reduction in episome numbers and emergence of latent integrants
.
Carcinogenesis
2006
;
27
:
2341
53
.
27.
Vandesompele
J
,
De Preter
K
,
Pattyn
F
,
Poppe
B
,
Van Roy
N
,
De Paepe
A
, et al
Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes
.
Genome Biol
2002
;
3
:
RESEARCH0034
.
28.
Murray
MJ
,
Saini
HK
,
van Dongen
S
,
Palmer
RD
,
Muralidhar
B
,
Pett
MR
, et al
The two most common histological subtypes of malignant germ cell tumour are distinguished by global microRNA profiles, associated with differential transcription factor expression
.
Mol Cancer
2010
;
9
:
290
.
29.
Damjanov
I
,
Andrews
PW
. 
Ultrastructural differentiation of a clonal human embryonal carcinoma cell line in vitro
.
Cancer Res
1983
;
43
:
2190
8
.
30.
de Jong
J
,
Stoop
H
,
Gillis
AJ
,
Hersmus
R
,
van Gurp
RJ
,
van de Geijn
GJ
, et al
Further characterization of the first seminoma cell line TCam-2
.
Genes Chromosomes Cancer
2008
;
47
:
185
96
.
31.
Birmingham
A
,
Anderson
EM
,
Reynolds
A
,
Ilsley-Tyree
D
,
Leake
D
,
Fedorov
Y
, et al
3′ UTR seed matches, but not overall identity, are associated with RNAi off-targets
.
Nat Methods
2006
;
3
:
199
204
.
32.
Muralidhar
B
,
Winder
D
,
Murray
M
,
Palmer
R
,
Barbosa-Morais
N
,
Saini
H
, et al
Functional evidence that Drosha overexpression in cervical squamous cell carcinoma affects cell phenotype and microRNA profiles
.
J Pathol
2011
;
224
:
496
507
.
33.
Li
Z
,
Wu
F
,
Brant
SR
,
Kwon
JH
. 
IL-23 receptor regulation by Let-7f in human CD4 +memory T cells
.
J Immunol
2011
;
186
:
6182
90
.
34.
Pett
MR
,
Alazawi
WO
,
Roberts
I
,
Dowen
S
,
Smith
DI
,
Stanley
MA
, et al
Acquisition of high-level chromosomal instability is associated with integration of human papillomavirus type 16 in cervical keratinocytes
.
Cancer Res
2004
;
64
:
1359
68
.
35.
Boyerinas
B
,
Park
SM
,
Shomron
N
,
Hedegaard
MM
,
Vinther
J
,
Andersen
JS
, et al
Identification of let-7-regulated oncofetal genes
.
Cancer Res
2008
;
68
:
2587
91
.
36.
Buechner
J
,
Tomte
E
,
Haug
BH
,
Henriksen
JR
,
Lokke
C
,
Flaegstad
T
, et al
Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma
.
Br J Cancer
2011
;
105
:
296
303
.
37.
Selbach
M
,
Schwanhausser
B
,
Thierfelder
N
,
Fang
Z
,
Khanin
R
,
Rajewsky
N
. 
Widespread changes in protein synthesis induced by microRNAs
.
Nature
2008
;
455
:
58
63
.
38.
Chang
TC
,
Zeitels
LR
,
Hwang
HW
,
Chivukula
RR
,
Wentzel
EA
,
Dews
M
, et al
Lin-28B transactivation is necessary for Myc-mediated let-7 repression and proliferation
.
Proc Natl Acad Sci U S A
2009
;
106
:
3384
9
.
39.
Cotterman
R
,
Knoepfler
PS
. 
N-Myc regulates expression of pluripotency genes in neuroblastoma including lif, klf2, klf4, and lin28b
.
PLoS ONE
2009
;
4
:
e5799
.
40.
Helland
A
,
Anglesio
MS
,
George
J
,
Cowin
PA
,
Johnstone
CN
,
House
CM
, et al
Deregulation of MYCN, LIN28B and LET7 in a molecular subtype of aggressive high-grade serous ovarian cancers
.
PLoS ONE
2011
;
6
:
e18064
.
41.
Molenaar
JJ
,
Domingo-Fernandez
R
,
Ebus
ME
,
Lindner
S
,
Koster
J
,
Drabek
K
, et al
LIN28B induces neuroblastoma and enhances MYCN levels via let-7 suppression
.
Nat Genet
2012
;
44
:
1199
206
.
42.
Alagaratnam
S
,
Lind
GE
,
Kraggerud
SM
,
Lothe
RA
,
Skotheim
RI
. 
The testicular germ cell tumour transcriptome
.
Int J Androl
2011
;
34
:
e133
50
;
discussion e50-1
.
43.
Kraggerud
SM
,
Skotheim
RI
,
Szymanska
J
,
Eknaes
M
,
Fossa
SD
,
Stenwig
AE
, et al
Genome profiles of familial/bilateral and sporadic testicular germ cell tumors
.
Genes Chromosomes Cancer
2002
;
34
:
168
74
.
44.
Palmer
RD
,
Foster
NA
,
Vowler
SL
,
Roberts
I
,
Thornton
CM
,
Hale
JP
, et al
Malignant germ cell tumours of childhood: new associations of genomic imbalance
.
Br J Cancer
2007
;
96
:
667
76
.
45.
Chen
AX
,
Yu
KD
,
Fan
L
,
Li
JY
,
Yang
C
,
Huang
AJ
, et al
Germline genetic variants disturbing the Let-7/LIN28 double-negative feedback loop alter breast cancer susceptibility
.
PLoS Genet
2011
;
7
:
e1002259
.
46.
Yang
X
,
Lin
X
,
Zhong
X
,
Kaur
S
,
Li
N
,
Liang
S
, et al
Double-negative feedback loop between reprogramming factor LIN28 and microRNA let-7 regulates aldehyde dehydrogenase 1-positive cancer stem cells
.
Cancer Res
2010
;
70
:
9463
72
.
47.
Zhong
X
,
Li
N
,
Liang
S
,
Huang
Q
,
Coukos
G
,
Zhang
L
. 
Identification of microRNAs regulating reprogramming factor LIN28 in embryonic stem cells and cancer cells
.
J Biol Chem
2010
;
285
:
41961
71
.
48.
Wu
L
,
Belasco
JG
. 
Micro-RNA regulation of the mammalian lin-28 gene during neuronal differentiation of embryonal carcinoma cells
.
Mol Cell Biol
2005
;
25
:
9198
208
.
49.
Li
X
,
Zhang
J
,
Gao
L
,
McClellan
S
,
Finan
MA
,
Butler
TW
, et al
MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit
.
Cell Death Differ
2012
;
19
:
378
86
.
50.
Trabucchi
M
,
Briata
P
,
Garcia-Mayoral
M
,
Haase
AD
,
Filipowicz
W
,
Ramos
A
, et al
The RNA-binding protein KSRP promotes the biogenesis of a subset of microRNAs
.
Nature
2009
;
459
:
1010
4
.

Supplementary data