Angiogenesis is a major clinical feature of esophageal squamous cell carcinoma (ESCC), an aggressive disease of increasing incidence in developed countries. In ESCCs, the proangiogenic factor VEGF-C is an independent prognostic factor for ESCC, where understanding the mechanisms of VEGF-C upregulation may cue possible therapeutic insights. Here, we report that expression of the transcription factor Nkx2-8 is downregulated in ESCCs where it inversely correlates with progression and VEGF-C upregulation. Patients with ESCCs with lower Nkx2-8 expression exhibited reduced overall survival. Modulating expression of Nkx2-8 up or down inhibited or enhanced, respectively, proangiogenic activity in vitro and in vivo. Mechanistic investigations showed that Nkx2-8 repressed NF-κB activity by restraining nuclear localization of NF-κB p65 via downregulation of AKIP1, a NF-κB p65 binding partner, and also by directly targeting the AKIP1 promoter. We confirmed evidence for the importance of the Nkx2-8/AKIP1/NF-κB axis identified in ESCC cell models through an immunohistochemical analysis of a large cohort of human ESCC specimens. Taken together, our results showed that Nkx2-8 functions as a tumor suppressor in ESCCs, the downregulation of which contributes to NF-κB activation and ESCC angiogenesis. Cancer Res; 73(12); 3638–48. ©2013 AACR.

Esophageal cancer is one of the most aggressive and lethal gastrointestinal tract malignancies (1, 2). ESCC accounts for more than 90% of esophageal cancer cases in developing countries, and approximately 50% of all new patients with ESCCs are diagnosed in China (3–5). Despite advances in the understanding and treatment of ESCCs over the last several decades, the overall 5-year survival rate for ESCC remains low, at 5% to 40% (6, 7). Angiogenesis is a major clinical feature of aggressive ESCCs and proangiogenic factor VEGF-C has been shown to be independent prognostic factors for ESCCs (8–12). Thus, delineation of the mechanisms that regulate VEGF-C in ESCCs may allow the identification of novel targets for therapeutic intervention.

The transcription factor NF-κB, one of the major regulators of VEGF-C, is constitutively activated in various types of human cancer including ESCCs (13–16). In unstimulated cells, NF-κB p50/p65 is sequestered in the cytoplasm by its inhibitor proteins, IκBs. In response to a variety of stimuli, IκBs can be phosphorylated by IκB kinase (IKK-β), resulting in proteasomal degradation of IκBs and translocation of cytoplasmic NF-κB p50/p65 into the nucleus, thereby activating the transcription of NF-κB target genes (14–16). Recently, A-kinase–interacting protein 1 (AKIP1) was identified as a novel NF-κB p65 binding protein and found to be overexpressed in breast and prostate cancer (17–19). However, the mechanisms by which AKIP1 is upregulated in cancer remain largely unknown.

Human Nkx2-8, a novel NK2-related transcription factor, was originally identified as a developmental regulator of α-fetoprotein (20, 21). Furthermore, Nkx2-8 was reported to be downregulated in bladder, pancreatic, and non–small cell lung cancer, suggesting that Nkx2-8 downregulation might play roles in the development and progression of cancer (22–24). In this study, we show that Nkx2-8 represses AKIP1 expression by directly binding to the AKIP1 promoter, consequently resulting in an inhibition of NF-κB activity by promoting the nuclear–cytoplasmic translocation of NF-κB p65. These results provide new insights into the mechanisms regulating the activation of NF-κB in ESCCs.

Cells

Primary cultures of normal esophageal epithelial cells (NEEC) were established from fresh specimens of the adjacent noncancerous esophageal tissue, which is over 5 cm from the cancerous tissue, according to previous report (25). The esophageal cancer cell lines EC18, Eca109, HKESC1 were kindly provided by Professors S.W. Tsao and G. Srivastava (The University of Hong Kong). ESCC cell lines Kyse30, Kyse140, Kyse180, Kyse410, Kyse510, and Kyse520 were obtained from DSMZ, the German Resource Centre for Biological Material (26). The EC cell lines were grown in the Dulbecco's Modified Eagle Medium (DMEM; Invitrogen) supplemented with 10% FBS (HyClone). All cell lines were authenticated by short tandem repeat (STR) fingerprinting at Medicine Lab of Forensic Medicine Department of Sun Yat-Sen University (Guangzhou, China).

Patient information and tissue specimens

This study was conducted on a total of 324 paraffin-embedded ESCC samples, which were histopathologically and clinically diagnosed at Sun Yat-Sen University Cancer Center from 2001 to 2006. For the use of these clinical materials for research purposes, prior patient consent and approval from the Institutional Research Ethics Committee were obtained. Clinical information on the samples is summarized in Supplementary Table S1. Ten ESCC specimens and the matched adjacent noncancerous esophageal tissues were frozen and stored in liquid nitrogen until further use.

Vectors, retroviral infection, and transfection

pMSCV/Nkx2-8–overexpressing human Nkx2-8 was generated by subcloning the PCR-amplified human Nkx2-8 coding sequence into pMSCV vector (Clontech). To silence endogenous Nkx2-8, 2 siRNA oligonucleotides (RNAi#1: GCGCAGCCTTCTAGATTTACC and RNAi#2: GCTTGGGCCTTATTTGTATAT) were cloned into the pSuper-retro-puro vector to generate pSuper-retro-Nkx2-8-RNAi(s), respectively (24). The different regions of human AKIP1 promoter, including fragments covering nucleotides −1,276 to +119, −806 to +119, −636 to +119, and −1,276 to −783 (relative to the transcription initiation site) were cloned, respectively, into pGL3 luciferase reporter plasmid (Promega). Transfection of siRNA or plasmids was conducted using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instruction. Stable cell lines expressing Nkx2-8 or Nkx2-8 siRNA were selected for 10 days with 0.5 μg/mL puromycin 48 hours after infection.

Western blotting assay

Western blot was conducted as previously described (24), using anti-Nkx2-8 antibody (AvivaSysBio), anti-NF-κB p65 and anti-p84 antibodies (Cell Signaling), and anti-phospho-NF-κB p65 (Ser276) and anti-C11orf17 antibodies (Abcam). Blotting membranes were stripped and re-probed with anti-α-tubulin antibody (Sigma) as a loading control.

Immunohistochemistry

Immunohistochemical (IHC) analysis was conducted to study altered protein expression in 324 human paraffin-embedded ESCC samples. The procedure was carried out similarly to previously described methods (24). The degree of immunostaining of formalin-fixed, paraffin-embedded sections was reviewed and scored independently by 2 observers, based on both the proportion of positively stained tumor cells and the intensity of staining.

Chicken chorioallantoic membrane assay

Chicken chorioallantoic membrane (CAM) assay was conducted at the eighth day of development of fertilized chicken eggs according to a method described previously (27). A 1-cm diameter window was opened in the shell of each egg with 8-day-old chicken embryo (Yueqin Breeding Co. Ltd). The surface of the dermic sheet on the floor of the air sac was removed to expose the CAM. A 0.5-cm diameter filter paper was first placed on top the CAM, and 100 μL conditioned media harvested from ESCC cells were added onto the center of the paper. Then, the eggs were incubated at 37°C under 80% to 90% relative humidity for 48 hours. Following fixation with stationary solution (methanol: acetone = 1:1) for 15 minutes, CAMs were cut and harvested, and gross photos of CAMs were taken under a digital camera (Panasonic). The effect of conditioned media harvested from different cells was evaluated by the number of second- and third-order vessels in comparison with that treated with the media harvested from control group.

Electrophoretic mobility shift assay

Electrophoretic mobility shift assay (EMSA) was conducted by using the LightShift Chemiluminescent EMSA Kit from Pierce Biotechnology according to the manufacturer's standard protocol. EMSA DNA probes: NF-κB: sense, 5′-AGTTGAGGGGACTTTCCCAGGC-3′, antisense, 5′-GCCTGGGAAAGTCCCCTCAAC-3′; OCT-1: sense, 5′-TGTCGAATGCAAATCACTAGAA-3′, antisense, 5′-TTCTAGTGATTTGCATTCGACA-3′.

Human umbilical vein endothelial cells tube formation assay

Matrigel (200 μL) was pipetted into each well of a 24-well plate and polymerized for 30 minutes at 37°C. Human umbilical vein endothelial cells (HUVEC; 2 × 104) in 200 μL of conditioned medium were added to each well and incubated at 37°C in 5% CO2 for 20 hours. Pictures were taken under a ×100 bright-field microscope and the capillary tubes were quantified by counting length.

Chromatin immunoprecipitation

Cells (2 × 106) in a 100-mm culture dish were treated with 1% formaldehyde to cross-link proteins to DNA. The cell lysates were sonicated to shear DNA to sizes of 300 to 1,000 bp. Equal aliquots of chromatin supernatants were incubated with 1 μg of anti-Nkx2-8 antibody (Abcam) or an anti-IgG antibody (Millipore) overnight at 4°C with rotation. After reverse cross-link of protein/DNA complexes to free DNA, PCR was carried out.

Immunofluorescent staining

Cells were treated with TNF-α (10 ng/mL) for the different time and were fixed in 4% (w/v) paraformaldehyde, permeabilized with 0.2% (v/v) Triton X-100 in PBS, and stained with a 1:100 dilution of rabbit anti-p65 polyclonal antibody (Cell Signaling). After washing, the primary antibody was visualized with rhodamine-conjugated goat anti-rabbit IgG and nuclei were visualized with 4′,6-diamidino-2-phenylindole (DAPI). Foci were observed using a laser scanning microscope (Axioskop 2 plus, Carl Zeiss Co. Ltd.).

Luciferase assay

Twenty thousand cells were seeded in triplicate in 48-well plates and allowed to settle for 24 hours. One hundred nanograms of NF-κB luciferase reporter plasmid, or luciferase reporter plasmids containing different fragments of AKIP1 promoter, or the control-luciferase plasmid, plus 1ng of pRL-TK Renilla plasmid (Promega), was transfected into cells using the Lipofectamine 2000 reagent according to the manufacturer's recommendation. Luciferase and Renilla signals were measured 24 hours after transfection using the Dual Luciferase Reporter Assay Kit (Promega) according to a protocol provided by the manufacturer.

Xenografted tumor model, IHC, and hematoxylin and eosin staining

BALB/c-nu mice (4–5 weeks of age, 18–20 g) were purchased from the Center of Experimental Animal of Guangzhou University of Chinese Medicine. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University. The BALB/c nude mice were randomly divided into 2 groups (n = 6/group). One group of mice was inoculated subcutaneously with Kyse30/vector cells (5 × 106) in the left dorsal flank and with Kyse30/Nkx2-8 cells (5 × 106) in the right dorsal flank per mouse. Another group was inoculated subcutaneously with Kyse30/scrambled vector cells (5 × 106) in the left dorsal flank and with Kyse30/Nkx2-8 RNA interference cells (5 × 106) in the right dorsal flank. Tumors were examined twice weekly; length and width measurements were obtained with calipers and tumor volumes were calculated using the equation (L × W2)/2. On day 40, tumors were detected by an IVIS imaging system, and animals were euthanized, tumors were excised, weighed, and paraffin-embedded. Serial 6.0-μm sections were cut and subjected to IHC staining using an anti-CD31 antibody (Dako) or H&E-stained with Mayer's hematoxylin solution. The images were captured using the AxioVision Rel.4.6 Computerized Image Analysis System (Carl Zeiss). The microvessel density (MVD) was quantified by counting the proportion of CD31-positive cells.

Statistical analysis

Statistical tests for data analysis included Fisher exact test, log-rank test, χ2, and Student two-tailed t test. Multivariate statistical analysis was conducted using a Cox regression model. Statistical analyses were conducted using the SPSS 11.0 statistical software package. Data represent mean ± SD. P ≤ 0.05 was considered statistically significant.

Nkx2-8 downregulation correlates with progression and poor prognosis in ESCCs

Western blotting revealed that Nkx2-8 protein was differentially reduced in all 9 tested ESCC cell lines compared with 4 primary cultured NEECs and in 10 primary human ESCC tissues compared to the adjacent non-tumor tissues, indicating that Nkx2-8 is downregulated in ESCC (Fig. 1A and B). Furthermore, IHC analysis showed that Nkx2-8 levels were inversely correlated with the clinical stage (P < 0.001), TNM classification (P < 0.001, P = 0.030, and P = 0.003, respectively), and histologic differentiation (P = 0.027) in patients with ESCCs (n = 324; Fig. 1C and Supplementary Table S2). Importantly, patients with lower Nkx2-8 expression had shorter survival (P < 0.001; Fig. 1D). Moreover, statistical analyses revealed that Nkx2-8 expression and N classification were each recognized as independent prognostic factors in ESCCs (Supplementary Table S3). Collectively, our results suggest a possible link between Nkx2-8 downregulation and ESCC progression.

Figure 1.

Nkx2-8 protein expression is downregulated in ESCC cell lines and primary human ESCC. A and B, Western blotting of Nkx2-8 expression in 4 NEECs and 9 ESCC cell lines (A) and in 10 paired human ESCC tissues (T) and the matched adjacent nontumor tissues (ANT) from the same patient (B). α-Tubulin was used as a loading control. C, IHC staining indicating that Nkx2-8 protein expression is reduced in human ESCCs (clinical stage I–IV) compared with normal esophageal tissues. D, Kaplan–Meier curves of patients with ESCCs with low versus high expression of Nkx2-8 (n = 324; P < 0.001, log-rank test).

Figure 1.

Nkx2-8 protein expression is downregulated in ESCC cell lines and primary human ESCC. A and B, Western blotting of Nkx2-8 expression in 4 NEECs and 9 ESCC cell lines (A) and in 10 paired human ESCC tissues (T) and the matched adjacent nontumor tissues (ANT) from the same patient (B). α-Tubulin was used as a loading control. C, IHC staining indicating that Nkx2-8 protein expression is reduced in human ESCCs (clinical stage I–IV) compared with normal esophageal tissues. D, Kaplan–Meier curves of patients with ESCCs with low versus high expression of Nkx2-8 (n = 324; P < 0.001, log-rank test).

Close modal

Downregulation of Nkx2-8 promotes ESCC angiogenesis in vivo and in vitro

The biologic role of Nkx2-8 in ESCC progression was examined using an in vivo tumor model. As shown in Supplementary Fig. S1 and Fig. 2A and C, the Nkx2-8–overexpressing tumors were smaller, in both size and weight, than the control tumors. Conversely, the tumors formed by Nkx2-8–silenced cells were larger and had higher tumor weights than the tumors formed by control cells (Fig. 2A and C and Supplementary Fig. S2A–2C). Strikingly, the MVD in Nkx2-8–silenced tumors was drastically higher, accompanied by increased CD31-positive cells, whereas the MVD was decreased in Nkx2-8–overexpressing tumors (Supplementary Fig. S2D and Fig. 2D), suggesting that Nkx2-8 downregulation promotes angiogenesis in ESCC.

Figure 2.

Downregulation of Nkx2-8 promotes ESCC angiogenesis in vivo. A, xenograft model in nude mice (n = 6/group). Left, representative images of tumor-bearing mice. Right, images of the tumors from all mice in each group. B, tumor volumes were measured on the indicated days. C, mean tumor weights. D, H&E and IHC staining displayed that overexpressing Nkx2-8 inhibited, whereas silencing Nkx2-8 induced, the ESCC angiogenesis in vivo, as indicated by CD31-positive cells. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05.

Figure 2.

Downregulation of Nkx2-8 promotes ESCC angiogenesis in vivo. A, xenograft model in nude mice (n = 6/group). Left, representative images of tumor-bearing mice. Right, images of the tumors from all mice in each group. B, tumor volumes were measured on the indicated days. C, mean tumor weights. D, H&E and IHC staining displayed that overexpressing Nkx2-8 inhibited, whereas silencing Nkx2-8 induced, the ESCC angiogenesis in vivo, as indicated by CD31-positive cells. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05.

Close modal

In agreement with the in vivo assay, we observed that silencing Nkx2-8 provoked, whereas overexpressing Nkx2-8 strongly inhibited, the abilities of both Kyse30 and Kyse510 ESCC cells to induce tube formation and migration of HUVECs and the formation of second- and third-order vessels in the CAM assay (Fig. 3A and C).

Figure 3.

Silencing Nkx2-8 enhances the ability of ESCC cells to induce angiogenesis in vitro. A, representative images (left) and quantification (right) of HUVECs cultured on Matrigel-coated plates with conditioned media from the indicated ESCC cells. B, cell migration assay was conducted by culturing HUVECs with conditioned media derived from the indicated ESCC cells. C, representative images of the blood vessels formed in the CAM assay after stimulation with conditioned media from the indicated cells. D, ELISA of VEGF-C expression in Nkx2-8–transduced and –silenced ESCC cells. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05.

Figure 3.

Silencing Nkx2-8 enhances the ability of ESCC cells to induce angiogenesis in vitro. A, representative images (left) and quantification (right) of HUVECs cultured on Matrigel-coated plates with conditioned media from the indicated ESCC cells. B, cell migration assay was conducted by culturing HUVECs with conditioned media derived from the indicated ESCC cells. C, representative images of the blood vessels formed in the CAM assay after stimulation with conditioned media from the indicated cells. D, ELISA of VEGF-C expression in Nkx2-8–transduced and –silenced ESCC cells. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05.

Close modal

Multiple studies have reported that expression of VEGF-C, a vital proangiogenic factor, correlates strongly with ESCC progression and acts as an independent prognostic factor for ESCCs (9–11). As shown in Fig. 3D, ELISA assay showed that overexpressing Nkx2-8 significantly decreased, whereas silencing Nkx2-8 increased, the expression of VEGF-C, suggesting that Nkx2-8–mediated angiogenesis might occur via regulation of VEGF-C.

Silencing Nkx2-8 activates NF-κB signaling

As NF-κB is a key transcriptional regulator of VEGF-C (15), we then investigated whether Nkx2-8 is involved in regulation of the NF-κB pathway. As shown in Fig. 4A and C, overexpression of Nkx2-8 decreased, whereas downregulation of Nkx2-8 increased, the NF-κB luciferase activity, NF-κB DNA binding activity, and the expression of numerous well-known NF-κB downstream genes, including VEGF-C, suggesting that Nkx2-8 plays a role in the regulation of NF-κB transcriptional activity. Consistently, we found that the expression of VEGF-C mRNA and NF-κB DNA-binding ability were also dramatically reduced in Nkx2-8–overexpressing tumors and increased in Nkx2-8–silenced tumors, compared with the respective control tumors (Supplementary Figs. S2E and S3). Importantly, the expression of nuclear NF-κB p65 was dramatically decreased in Nkx2-8–transduced cells and increased in Nkx2-8–silenced cells (Fig. 4D and E), suggesting that Nkx2-8 regulates NF-κB transcriptional activity by promoting NF-κB nuclear–cytoplasmic translocation.

Figure 4.

Silencing Nkx2-8 activates NF-κB signaling. A, NF-κB luciferase-reporter activities were analyzed in the indicated cells. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05. B, EMSA indicating that endogenous NF-κB activity decreased in Nkx2-8–transduced cells and increased in Nkx2-8–silenced cells. OCT-1-DNA–binding complex served as a control. C, real-time PCR analysis indicating an apparent overlap between NF-κB–dependent gene expression and Nkx2-8–regulated gene expression. The pseudocolors represent the intensity scale for Nkx2-8 versus the vector or Nkx2-8-siRNA versus the scrambled vector, generated by a log2 transformation. D, Western blotting of nuclear NF-κB p65, cytoplasmic NF-κB p65, and total NF-κB p65 expression in the indicated cells. p84 was used as a nuclear loading control. β-Actin was used as a cytoplasm loading control. E, immunofluorescence staining of NF-κB p65 in the indicated cells treated with TNF-α (10 ng/mL) for different times.

Figure 4.

Silencing Nkx2-8 activates NF-κB signaling. A, NF-κB luciferase-reporter activities were analyzed in the indicated cells. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05. B, EMSA indicating that endogenous NF-κB activity decreased in Nkx2-8–transduced cells and increased in Nkx2-8–silenced cells. OCT-1-DNA–binding complex served as a control. C, real-time PCR analysis indicating an apparent overlap between NF-κB–dependent gene expression and Nkx2-8–regulated gene expression. The pseudocolors represent the intensity scale for Nkx2-8 versus the vector or Nkx2-8-siRNA versus the scrambled vector, generated by a log2 transformation. D, Western blotting of nuclear NF-κB p65, cytoplasmic NF-κB p65, and total NF-κB p65 expression in the indicated cells. p84 was used as a nuclear loading control. β-Actin was used as a cytoplasm loading control. E, immunofluorescence staining of NF-κB p65 in the indicated cells treated with TNF-α (10 ng/mL) for different times.

Close modal

Nkx2-8 directly downregulates AKIP1

It has been reported that AKIP1, a newly identified binding partner of NF-κB p65, enhances NF-κB–dependent gene expression via retention of nuclear NF-κB and induction of phosphorylated-p65 (p-p65) (S276; refs. 18, 19). Interestingly, analysis of the AKIP1 promoter region predicted the presence of 2 Nkx2-8–specific binding sites (NBS), suggesting that Nkx2-8 might regulate AKIP1. Indeed, the expression of AKIP1, at both protein and mRNA levels, and p-p65 (S276) were increased in Nkx2-8–silenced cells but decreased in Nkx2-8–transduced cells (Fig. 5A and B). Furthermore, we found that overexpressing Nkx2-8 decreased, but silencing Nkx2-8 increased, the luciferase activity driven by the first NBS of the AKIP1 promoter. However, neither overexpression nor knockdown of Nkx2-8 had any effect on the luciferase activities of the AKIP1 promoters that contained deleted or mutated first NBS (Fig. 5C). Moreover, ChIP assay revealed that endogenous Nkx2-8 protein bound to the first NBS in the AKIP1 promoter (Fig. 5D), indicating that Nkx2-8 regulates AKIP1 by directly targeting the AKIP1 promoter.

Figure 5.

Nkx2-8 directly downregulates AKIP1. A, Western blotting of AKIP1 and p-p65 (Ser 276) expression in the indicated cells. α-Tubulin served as a loading control. B, real-time PCR analysis of AKIP1 mRNA expression in the indicated cells. Transcript levels were normalized to GAPDH. C, transactivities of Nkx2-8 on serial AKIP1 promoter fragments as indicated in Kyse30 ESCC cells. D, ChIP assay showing that Nkx2-8 physically associated with the first NBS of the AKIP1 promoter. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05.

Figure 5.

Nkx2-8 directly downregulates AKIP1. A, Western blotting of AKIP1 and p-p65 (Ser 276) expression in the indicated cells. α-Tubulin served as a loading control. B, real-time PCR analysis of AKIP1 mRNA expression in the indicated cells. Transcript levels were normalized to GAPDH. C, transactivities of Nkx2-8 on serial AKIP1 promoter fragments as indicated in Kyse30 ESCC cells. D, ChIP assay showing that Nkx2-8 physically associated with the first NBS of the AKIP1 promoter. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05.

Close modal

AKIP1 abrogates the inhibitory effects of Nkx2-8 on NF-κB activity and angiogenesis

Overexpression of AKIP1 significantly enhanced NF-κB luciferase activity in Nkx2-8–transduced cells, whereas downregulation of AKIP1 decreased the NF-κB luciferase activity in Nkx2-8–silenced cells (Fig. 6A). However, the Nkx2-8-induced nuclear–cytoplasmic translocation of NF-κB p65 and the inhibitory effect of Nkx2-8 on HUVEC tube formation were dramatically abrogated by AKIP1 overexpression (Fig. 6B and D). Importantly, the MVD of tumors formed by Kyse30/Nkx2-8/AKIP1 cells was significantly higher than that of tumors formed by Kyse30/Nkx2-8/vector cells (Fig. 6E). Taken together, these results indicate that AKIP1 abrogates the inhibitory effect of Nkx2-8 on ESCC angiogenesis.

Figure 6.

AKIP1 abrogates the inhibitory effects of Nkx2-8 on NF-κB activity and angiogenesis. A, top, NF-κB luciferase reporter activities were analyzed in Nkx2-8–transduced ESCC cells transfected with vector or AKIP1 and in Nkx2-8–silenced ESCC cells transfected with scramble or AKIP1 siRNA(s). Bottom, Western blotting of AKIP1 expression in the indicated cells. α-Tubulin was used as a loading control. B, Western blotting of nuclear NF-κB p65 and total NF-κB p65 expression in the indicated cells. p84 was used as nuclear loading control. C, immunofluorescent staining of NF-κB p65 in the indicated cells treated with TNF-α (10 ng/mL) for different times. D, quantification of HUVEC tube formation cultured on Matrigel-coated plates with conditioned media from the indicated cells. E, overexpressing AKIP1 abrogated the inhibitory effect of Nkx2-8 on angiogenesis as shown by a xenograft model. Left, representative images of the tumor-bearing mice. Middle, tumor volumes were measured on the indicated days. Left, the MVD was evaluated by CD31-positive cells. Error bars represent mean ± SD of 3 independent experiments. *, P < 0.05.

Figure 6.

AKIP1 abrogates the inhibitory effects of Nkx2-8 on NF-κB activity and angiogenesis. A, top, NF-κB luciferase reporter activities were analyzed in Nkx2-8–transduced ESCC cells transfected with vector or AKIP1 and in Nkx2-8–silenced ESCC cells transfected with scramble or AKIP1 siRNA(s). Bottom, Western blotting of AKIP1 expression in the indicated cells. α-Tubulin was used as a loading control. B, Western blotting of nuclear NF-κB p65 and total NF-κB p65 expression in the indicated cells. p84 was used as nuclear loading control. C, immunofluorescent staining of NF-κB p65 in the indicated cells treated with TNF-α (10 ng/mL) for different times. D, quantification of HUVEC tube formation cultured on Matrigel-coated plates with conditioned media from the indicated cells. E, overexpressing AKIP1 abrogated the inhibitory effect of Nkx2-8 on angiogenesis as shown by a xenograft model. Left, representative images of the tumor-bearing mice. Middle, tumor volumes were measured on the indicated days. Left, the MVD was evaluated by CD31-positive cells. Error bars represent mean ± SD of 3 independent experiments. *, P < 0.05.

Close modal

Clinical relevance of Nkx2-8–induced NF-κB activation in human ESCC

Analysis of 324 ESCC tissue specimens using IHC analysis showed that Nkx2-8 expression was inversely correlated with the expression levels of AKIP1, p-p65 (S276) and CD31 (P < 0.001, P < 0.001, and P = 0.002, respectively; Fig. 7A and B). Consistently, Nkx2-8 expression in 10 freshly collected clinical ESCC samples also negatively correlated with the mRNA levels of AKIP1 and VEGF-C (P = 0.004; P = 0.013), as well as the NF-κB DNA–binding activity (r = −0.753, P = 0.007; Fig. 7C). These data further supported the notion that Nkx2-8 downregulation in ESCCs induces AKIP1 expression and activates NF-κB signaling, ultimately leading to angiogenesis and poor clinical outcomes for human ESCCs (Fig. 7D).

Figure 7.

Clinical relevance of the Nkx2-8/AKIP1/NF-κB axis in human ESCCs. A, Nkx2-8 levels were negatively associated with AKIP1, p-p65 (Ser276), or CD31 expression in 324 primary human ESCC specimens. Two representative cases are shown. Original magnification, ×200. B, percentage of ESCC specimens showing low or high Nkx2-8 expression relative to the level of AKIP1, p-p65 (Ser276), or CD31. C, expression analysis (left) and correlation (right) between Nkx2-8 expression and AKIP1 or VEGF-C mRNA expression and NF-κB DNA–binding activity in 10 freshly collected human ESCC samples. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05. D, model: Nkx2-8 downregulation induces AKIP1 expression and activates the NF-κB signaling pathway, ultimately leading to angiogenesis and poorer clinical outcomes for human ESCCs.

Figure 7.

Clinical relevance of the Nkx2-8/AKIP1/NF-κB axis in human ESCCs. A, Nkx2-8 levels were negatively associated with AKIP1, p-p65 (Ser276), or CD31 expression in 324 primary human ESCC specimens. Two representative cases are shown. Original magnification, ×200. B, percentage of ESCC specimens showing low or high Nkx2-8 expression relative to the level of AKIP1, p-p65 (Ser276), or CD31. C, expression analysis (left) and correlation (right) between Nkx2-8 expression and AKIP1 or VEGF-C mRNA expression and NF-κB DNA–binding activity in 10 freshly collected human ESCC samples. Each bar represents the mean ± SD of 3 independent experiments. *, P < 0.05. D, model: Nkx2-8 downregulation induces AKIP1 expression and activates the NF-κB signaling pathway, ultimately leading to angiogenesis and poorer clinical outcomes for human ESCCs.

Close modal

Compelling evidence has indicated that activated NF-κB is associated with the initiation and progression of ESCCs (28–35). Activation of NF-κB has been reported to be associated with acid-induced esophageal epithelial cell transformation (28). Multiple downstream targets of NF-κB, such as COX-2 and interleukin-8, and NF-κB nuclear expression/NF-κB activity, were shown to be significantly increased in ESCC tissues, compared with normal esophageal tissues (29–31). Importantly, ESCCs with high activated NF-κB display aggressive pathologic features and have poor treatment outcomes (32). However, blockade of the NF-κB pathway not only inhibits ESCC proliferation and increases the sensitivity of ESCCs to chemotherapeutic drugs but also suppresses metastasis and angiogenesis in ESCCs (33–35). These studies show that NF-κB activation plays important roles in ESCC progression. Accordingly, further understanding of the pathways regulating NF-κB pathway may provide novel therapeutic targets for ESCCs. Herein, we found that Nkx2-8 inhibited NF-κB activity by repressing AKIP1, a NF-κB p65-binding partner. Overexpressing Nkx2-8 dramatically reduced, whereas silencing Nkx2-8 promoted, the NF-κB luciferase activity and NF-κB DNA binding activity. Thus, our results represent a novel mechanism of NF-κB activation in ESCCs.

It has been reported that Nkx2-8−/− mice exhibit generalized tracheobronchial hyperplasia at birth, which gradually progresses to dysplasia and eventually develops into lung cancer (36). Yu and colleagues reported that Nkx2-8 is downregulated in bladder cancer, and silencing Nkx2-8 promotes bladder cancer cell proliferation in vitro and in vivo (24). Interestingly, Kendall and colleagues found that co-expression of Nkx2-8 with either TTF1 or PAX8, 2 related genes adjacent to Nkx2-8, could promote the tumorigenicity of immortalized human lung epithelial cells (37), but Harris and colleagues reported that overexpression of Nkx2-8 reduces colony formation in TTF1-negative lung cancer cells, indicating that the precise function of Nkx2-8 in lung cancer may be highly context-dependent (23). Herein, we found that Nkx2-8 protein was reduced in both ESCC cell lines and primary ESCC tissues and inversely correlated with progression and patient survival in ESCCs. Silencing Nkx2-8 promoted, but overexpressing Nkx2-8 reduced, ESCC angiogenesis both in vivo and in vitro. Thus, our results suggest that Nkx2-8 functions as a tumor suppressor in ESCCs and Nkx2-8 downregulation contributes to ESCC pathogenesis.

Several mechanisms have been proposed to mediate Nkx2-8 downregulation in cancer. Harris and colleagues reported that downregulation of Nkx2-8 mRNA in lung cancer is partially due to genetic deletion (23). Hagihara and colleagues showed that treatment of pancreatic cancer cells with a demethylating agent restores the expression of Nkx2-8, indicating that downregulation of Nkx2-8 in pancreatic cancer is caused by hypermethylation of the CpG islands in the promoter region of Nkx2-8 (22). Herein, we found that Nkx2-8 expression was lower at both the mRNA and protein levels in 6 of 10 cases of ESCCs, compared with the matched normal tissues. However, the Nkx2-8 gene is located in the 14q13.3 region, which is frequently amplified in ESCCs (38). Thus, it would be interesting to further investigate whether Nkx2-8 downregulation in ESCCs is associated with hypermethylation of the Nkx2-8 promoter.

It is particularly noteworthy that Nkx2-8 mRNA expression is elevated in hepatocellular carcinoma, compared with normal adult liver (20). Previously, Hamamoto and colleagues found that the histone methyltransferase SMYD3 could upregulate Nkx2-8 by binding to its promoter region to induce K4-dimethylation of histone H3 (39). We also observed that 4 of 10 cases of ESCC tissues expressed higher levels of Nkx2-8 mRNA but lower levels of Nkx2-8 protein, compared with the matched adjacent nontumor tissues (Supplementary Fig. S4). These results suggest that downregulation of Nkx2-8 protein in some ESCC tumors may be mediated via other unknown posttranscriptional mechanisms such as translational repression or ubiquitin-dependent protein degradation. In this respect, further investigation of the mechanisms by which Nkx2-8 protein is reduced in ESCCs will provide valuable data toward a better understanding of the development and progression of ESCCs, which might eventually lead to the development of a new therapeutic strategy for the treatment of ESCCs.

No potential conflicts of interest were disclosed.

Conception and design: L. Song, J. Li

Development of methodology: H. Gong, J. Wu

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): C. Lin, A. Liu

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): C. Lin, H. Gong, A. Liu, X. Lin, J. Wu, M. Li

Writing, review, and/or revision of the manuscript: L. Song, J. Li

Study supervision: L. Song, M. Li, J. Li

The study was supported by Guangdong Province Universities and Colleges Pearl River Scholar Funded Scheme (GDUPS, 2012), Natural Science Foundation of China (81071780, 81030048, 91229101, U1201121, 81272196 and 81272198), and the Science and Technology Department of Guangdong Province (S2011020002757 and S2012020010946).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Parkin
DM
,
Bray
F
,
Ferlay
J
,
Pisani
P
. 
Global cancer statistics, 2002
.
CA Cancer J Clin
2005
;
55
:
74
108
.
2.
Blot
WJ
,
McLaughlin
JK
,
Fraumeni
JF
 Jr
. 
Esophageal cancer
. In:
Schottenfeld
D
,
Fraumeni
JF
 Jr
,
editors
.
Cancer epidemiology and prevention
. 3rd ed.
New York, NY
:
Oxford University Press
; 
2006
. p.
697
706
.
3.
Ke
L
. 
Mortality and incidence trends from esophagus cancer in selected geographic areas of China circa 1970–90
.
Int J Cancer
2002
;
102
:
271
4
.
4.
Xing
D
,
Tan
W
,
Lin
D
. 
Genetic polymorphisms and susceptibility to esophageal cancer among Chinese population
.
Oncol Rep
2003
;
10
:
1615
23
.
5.
Hiyama
T
,
Yoshihara
M
,
Tanaka
S
,
Chayama
K
. 
Genetic polymorphisms and esophageal cancer risk
.
Int J Cancer
2007
;
121
:
1643
58
.
6.
Enzinger
PC
,
Mayer
RJ
. 
Esophageal cancer
.
N Engl J Med
2003
;
349
:
2241
52
.
7.
Mariette
C
,
Balon
JM
,
Piessen
G
,
Fabre
S
,
Van Seuningen
I
,
Triboulet
JP
. 
Pattern of recurrence following complete resection of esophageal carcinoma and factors predictive of recurrent disease
.
Cancer
2003
;
97
:
1616
23
.
8.
Tanigawa
N
,
Matsumura
M
,
Amaya
H
,
Kitaoka
A
,
Shimomatsuya
T
,
Lu
C
, et al
Tumor vascularity correlates with the prognosis of patients with esophageal squamous cell carcinoma
.
Cancer
1997
;
79
:
220
5
.
9.
Kitadai
Y
,
Amioka
T
,
Haruma
K
,
Tanaka
S
,
Yoshihara
M
,
Sumii
K
, et al
Clinicopathological significance of vascular endothelial growth factor (VEGF)-C in human esophageal squamous cell carcinomas
.
Int J Cancer
2001
;
93
:
662
6
.
10.
Byeon
JS
,
Jung
HY
,
Lee
YJ
,
Lee
D
,
Lee
GH
,
Myung
SJ
, et al
Clinicopathological significance of vascular endothelial growth factor-C and cyclooxygenase-2 in esophageal squamous cell carcinoma
.
J Gastroenterol Hepatol
2004
;
19
:
648
54
.
11.
Choi
JY
,
Jang
KT
,
Shim
YM
,
Kim
K
,
Ahn
G
,
Lee
KH
, et al
Prognostic significance of vascular endothelial growth factor expression and microvessel density in esophageal squamous cell carcinoma: comparison with positron emission tomography
.
Ann Surg Oncol
2006
;
13
:
1054
62
.
12.
Noma
K
,
Smalley
KS
,
Lioni
M
,
Naomoto
Y
,
Tanaka
N
,
El-Deiry
W
, et al
The essential role of fibroblasts in esophageal squamous cell carcinoma-induced angiogenesis
.
Gastroenterology
2008
;
134
:
1981
93
.
13.
Tsai
PW
,
Shiah
SG
,
Lin
MT
,
Wu
CW
,
Kuo
ML
. 
Up-regulation of vascular endothelial growth factor C in breast cancer cells by heregulin-beta 1. A critical role of p38/nuclear factor-kappa B signaling pathway
.
J Biol Chem
2003
;
278
:
5750
9
.
14.
Pikarsky
E
,
Porat
RM
,
Stein
I
,
Abramovitch
R
,
Amit
S
,
Kasem
S
, et al
NF-kappaB functions as a tumour promoter in inflammation-associated cancer
.
Nature
2004
;
431
:
461
6
.
15.
Karin
M
,
Greten
FR
. 
NF-kappaB: linking inflammation and immunity to cancer development and progression
.
Nat Rev Immunol
2005
;
5
:
749
59
.
16.
Karin
M
. 
Nuclear factor-kappaB in cancer development and progression
.
Nature
2006
;
441
:
431
6
.
17.
Kitching
R
,
Li
H
,
Wong
MJ
,
Kanaganayakam
S
,
Kahn
H
,
Seth
A
. 
Characterization of a novel human breast cancer associated gene (BCA3) encoding an alternatively spliced proline-rich protein
.
Biochim Biophys Acta
2003
;
1625
:
116
21
.
18.
Gao
N
,
Asamitsu
K
,
Hibi
Y
,
Ueno
T
,
Okamoto
T
. 
AKIP1 enhances NF-kappaB-dependent gene expression by promoting the nuclear retention and phosphorylation of p65
.
J Biol Chem
2008
;
283
:
7834
43
.
19.
Gao
N
,
Hibi
Y
,
Cueno
M
,
Asamitsu
K
,
Okamoto
T
. 
A-kinase-interacting protein 1 (AKIP1) acts as a molecular determinant of PKA in NF-kappaB signaling
.
J Biol Chem
2010
;
285
:
28097
104
.
20.
Apergis
GA
,
Crawford
N
,
Ghosh
D
,
Steppan
CM
,
Vorachek
WR
,
Wen
P
, et al
A novel nk-2-related transcription factor associated with human fetal liver and hepatocellular carcinoma
.
J Biol Chem
1998
;
273
:
2917
25
.
21.
Kajiyama
Y
,
Tian
J
,
Locker
J
. 
Regulation of alpha-fetoprotein expression by Nkx2.8
.
Mol Cell Biol
2002
;
22
:
6122
30
.
22.
Hagihara
A
,
Miyamoto
K
,
Furuta
J
,
Hiraoka
N
,
Wakazono
K
,
Seki
S
, et al
Identification of 27 5′ CpG islands aberrantly methylated and 13 genes silenced in human pancreatic cancers
.
Oncogene
2004
;
23
:
8705
10
.
23.
Harris
T
,
Pan
Q
,
Sironi
J
,
Lutz
D
,
Tian
J
,
Sapkar
J
, et al
Both gene amplification and allelic loss occur at 14q13.3 in lung cancer
.
Clin Cancer Res
2011
;
17
:
690
9
.
24.
Yu
C
,
Zhang
Z
,
Liao
W
,
Zhao
X
,
Liu
L
,
Wu
Y
, et al
The tumor-suppressor gene Nkx2.8 suppresses bladder cancer proliferation through upregulation of FOXO3a and inhibition of the MEK/ERK signaling pathway
.
Carcinogenesis
2012
;
33
:
678
86
.
25.
Andl
CD
,
Mizushima
T
,
Nakagawa
H
,
Oyama
K
,
Harada
H
,
Chruma
K
, et al
Epidermal growth factor receptor mediates increased cell proliferation, migration, and aggregation in esophageal keratinocytes in vitro and in vivo
.
J Biol Chem
2003
;
278
:
1824
30
.
26.
Shimada
Y
,
Imamura
M
,
Wagata
T
,
Yamaguchi
N
,
Tobe
T
. 
Characterization of 21 newly established esophageal cancer cell lines
.
Cancer
1992
;
69
:
277
84
.
27.
Célérier
J
,
Cruz
A
,
Lamandé
N
,
Gasc
JM
,
Corvol
P
. 
Angiotensinogen and its cleaved derivatives inhibit angiogenesis
.
Hypertension
2002
;
39
:
224
8
.
28.
Debruyne
PR
,
Witek
M
,
Gong
L
,
Birbe
R
,
Chervoneva
I
,
Jin
T
. 
Bile acids induce ectopic expression of intestinal guanylyl cyclase C through nuclear factor-kappaB and Cdx2 in human esophageal cells
.
Gastroenterology
2006
;
130
:
1191
206
.
29.
Konturek
PC
,
Nikiforuk
A
,
Kania
J
,
Raithel
M
,
Hahn
EG
,
Mühldorfer
S
. 
Activation of NFkappaB represents the central event in the neoplastic progression associated with Barrett's esophagus: a possible link to the inflammation and overexpression of COX-2, PPARgamma and growth factors
.
Dig Dis Sci
2004
;
49
:
1075
83
.
30.
Kang
MR
,
Kim
MS
,
Kim
SS
,
Ahn
CH
,
Yoo
NJ
,
Lee
SH
. 
NF-kappaB signaling proteins p50/p105, p52/p100, RelA, and IKKepsilon are over-expressed in oesophageal squamous cell carcinomas
.
Pathology
2009
;
41
:
622
5
.
31.
Kausar
T
,
Sharma
R
,
Hasan
MR
,
Tripathi
SC
,
Saraya
A
,
Chattopadhyay
TK
, et al
Clinical significance of GPR56, transglutaminase 2, and NF-κB in esophageal squamous cell carcinoma
.
Cancer Invest
2011
;
29
:
42
8
.
32.
Izzo
JG
,
Malhotra
U
,
Wu
TT
,
Ensor
J
,
Luthra
R
,
Lee
JH
, et al
Association of activated transcription factor nuclear factor kappab with chemoradiation resistance and poor outcome in esophageal carcinoma
.
J Clin Oncol
2006
;
24
:
748
54
.
33.
Li
B
,
Li
YY
,
Tsao
SW
,
Cheung
AL
. 
Targeting NF-kappaB signaling pathway suppresses tumor growth, angiogenesis, and metastasis of human esophageal cancer
.
Mol Cancer Ther
2009
;
8
:
2635
44
.
34.
Song
L
,
Gong
H
,
Lin
C
,
Wang
C
,
Liu
L
,
Wu
J
, et al
Flotillin-1 promotes tumor necrosis factor-α receptor signaling and activation of NF-κB in esophageal squamous cell carcinoma cells
.
Gastroenterology
2012
;
143
:
995
1005
.
35.
Tian
F
,
Zhang
C
,
Tian
W
,
Jiang
Y
,
Zhang
X
. 
Comparison of the effect of p65 siRNA and curcumin in promoting apoptosis in esophageal squamous cell carcinoma cells and in nude mice
.
Oncol Rep
2012
;
28
:
232
40
.
36.
Tian
J
,
Mahmood
R
,
Hnasko
R
,
Locker
J
. 
Loss of Nkx2.8 deregulates progenitor cells in the large airways and leads to dysplasia
.
Cancer Res
2006
;
66
:
10399
407
.
37.
Kendall
J
,
Liu
Q
,
Bakleh
A
,
Krasnitz
A
,
Nguyen
KC
,
Lakshmi
B
, et al
Oncogenic cooperation and coamplification of developmental transcription factor genes in lung cancer
.
Proc Natl Acad Sci U S A
2007
;
104
:
16663
8
.
38.
Bellini
MF
,
Silva
AE
,
Varella-Garcia
M
. 
Genomic imbalances in esophageal squamous cell carcinoma identified by molecular cytogenetic techniques
.
Genet Mol Biol
2010
;
33
:
205
13
.
39.
Hamamoto
R
,
Furukawa
Y
,
Morita
M
,
Iimura
Y
,
Silva
FP
,
Li
M
, et al
SMYD3 encodes a histone methyltransferase involved in the proliferation of cancer cells
.
Nat Cell Biol
2004
;
6
:
731
40
.