TRPM7 encodes a Ca2+-permeable nonselective cation channel with kinase activity. TRPM7 has been implicated in control of cell adhesion and migration, but whether TRPM7 activity contributes to cancer progression has not been established. Here we report that high levels of TRPM7 expression independently predict poor outcome in breast cancer patients and that it is functionally required for metastasis formation in a mouse xenograft model of human breast cancer. Mechanistic investigation revealed that TRPM7 regulated myosin II–based cellular tension, thereby modifying focal adhesion number, cell–cell adhesion and polarized cell movement. Our findings therefore suggest that TRPM7 is part of a mechanosensory complex adopted by cancer cells to drive metastasis formation. Cancer Res; 72(16); 4250–61. ©2012 AACR.

Metastasis formation is a complicated multistep process involving tumor cell dissemination from the primary tumor, matrix invasion, entry into the circulatory system, extravasation through capillary endothelium, and, finally, the outgrowth of secondary tumors in distant organs. Each of these events requires extensive and continuous Ca2+-dependent remodeling of the actomyosin cytoskeleton as well as close interactions with the surroundings of a cell, mediated by dynamic adhesive structures, such as focal adhesions and adherens junctions. These specialized cell adhesion sites convey mechanical cues across the plasma membrane, affecting both the physical properties of their surroundings as well as intracellular cytoskeletal dynamics. As the formation and maturation of focal adhesions and adherens junctions is dependent on the applied mechanical forces, these structures are considered to function as mechanosensors that integrate mechanical cues from inside and outside the cell (1–5). The complex protein–protein interactions within these adhesion sites significantly contribute to tumor progression and metastasis formation. Hence, proteins that regulate adhesion formation or turnover represent interesting therapeutic targets to limit the metastatic potential of cancer cells (6).

Members of the mammalian transient receptor potential (TRP) cation channel family are considered key players in mechanosensory signaling (7–11). TRP channels organize into large macromolecular complexes linked to the actomyosin cytoskeleton, which may serve to localize signal transduction pathways and/or enhance the rate of signal transmission (7, 12, 13). Tethered to the cytoskeleton, their ion conducting properties can be modulated by different stimuli, including mechanical cues, resulting in a variety of cellular responses. In earlier work, we and others identified TRPM7, a Ca2+-permeable nonselective cation channel with kinase activity, as a regulator of actomyosin contractility, cell adhesion, and directed cell migration (14–16). However, a role for this bifunctional channel in cancer progression has not been examined. Here we show that high TRPM7 expression, at the time of diagnosis, predicts poor therapy outcome in a large cohort of breast cancer patients. Moreover, TRPM7 is a critical determinant of breast cancer cell migration in vitro and metastasis formation in vivo.

TRPM7 protein expression in primary breast cancer tissue samples detected by immunohistochemistry

Formalin-fixed, paraffin-embedded breast tumor tissue, derived from the tumor bank of the Department of Laboratory Medicine of the Radboud University Medical Centre, was probed for TRPM7 (1:400; Cayman Chemical Company), followed by biotin-conjugated donkey anti-mouse IgG and DAB and counterstained with hematoxylin.

TRPM7 expression measurements in patient samples

Our discovery cohort consisted of 368 early-stage breast cancer samples, described in a previous study (17). The validation cohort consisted of 144 patients with unilateral breast cancer who had undergone resection of their primary tumor between November 1987 and December 1997 (18). TRPM7 expression levels in tumor samples derived from the discovery cohort were determined by microarray analysis using Affymetrix U133B Genechips (Affymetrix). Raw data are available at the Gene Expression Omnibus repository database (GEO accession number: GSE6532). TRPM7 expression levels in the validation cohort were determined by quantitative PCR reactions on cDNA samples derived from primary tumors, using power SYBR-green reagent (Applied Biosystems) in combination with TRPM7-specific primers (forward: TAGCCTTTAGCCACTGGAC; reverse: GCATCTTCTCCTAGATTTGC) according to manufacturer's recommendations. TRPM7 gene expression levels were normalized to the HPRT housekeeping gene (forward: GGTCCTTTTCACCAGCAAGCT; reverse: TGACACTGGCAAAACAATGCA) and calculated according to the cycling threshold method (19). Statistical analyses were carried out using SPSS software (version 16.0; SPSS). Discovery and validation cohorts were dichotomized using median TRPM7 expression as cut-off. Survival curves were visualized by Kaplan–Meier plots, using recurrence-free and distant metastasis-free survival as endpoints and compared using log-rank tests. HRs were estimated by univariate Cox regression analysis. The independent prognostic value of TRPM7 was assessed by univariate and multivariate Cox regression analysis on combined discovery and validation cohorts.

Generation and validation of cell lines

Human TRPM7 short hairpin RNAs (shRNA; #1: 5-GCGCTTTCCTTATCCACTTAA-3; #2: 5-CAGCAGAGCCCGATATTATTT-3) were introduced in MDA-MB-231 [HTB-26, American Type Culture Collection (ATCC)] and human TRPM7 shRNA#1 was introduced in MCF7 human breast cancer cells (HTB-22, ATCC), using the pLKO lentiviral expression vector according to manufacturer's instructions (Sigma Aldrich). A nonfunctional shRNA (5-GCTACAAGAGAAACCAAATCT-3) was used as negative control. Transduced cells were selected with 1 μg/mL puromycin. For bioluminescent imaging, control and TRPM7 knockdown MDA-MB-231 cells were cotransduced with a retroviral pLZRS luciferase reporter construct and selected with 0.5 mg/mL Zeocin. For rescue of TRPM7 expression levels, HA-tagged mouse TRPM7, containing one mismatch with respect to the human-specific shRNA (14), was introduced in MDA-MB-231 TRPM7 shRNA cells. Transduced cells were selected with 1 mg/mL G418. TRPM7 mRNA expression levels were determined by quantitative reverse transcriptase PCR with the additional use of mouse-specific TRPM7 primers (forward: TAGCCTTTAGCCACTGGACC; reverse: GCATCTTCTCCTAGATTGGCAG). TRPM7 protein levels were determined by radioactively labeling the TRPM7 kinase domain as described previously (14).

Cell viability and proliferation measurements

The effect of TRPM7 knockdown on cell viability and proliferation was assessed by MTS assays according to manufacturer's instructions (Promega). Cell-cycle distribution of the different cell lines was determined by fluorescence-activated cell sorting (FACS) analysis on cells stained with propidium iodide. Cells were harvested and the cell pellet was incubated in staining solution (1 mg/mL sodium citrate, 0.1 mg/mL RNAseA, 20 μg/mL propidium iodide, and 0.1% Triton X-100). Cells were washed and subjected to FACS analysis. Cell-cycle distribution was quantified using FlowJo analysis software.

Mouse xenograft experiments

All animal work was carried out in accordance with protocols approved by the Animal Welfare Committee (DEC-NKI-10.034). Immunodeficient Rag2−/−IL2rg−/− mice were used for metastasis experiments. MDA-MB-231-Luc control and TRPM7 knockdown cells were collected and washed with PBS. Subsequently, 0.2 mL PBS containing 5 × 105 cells was injected into a tail vein. Tumor growth was monitored by bioluminescence imaging from day 7 onwards. Beetle luciferin (Promega) was dissolved at 15 mg/mL in PBS and stored at −20°C. Animals were anaesthetized with 2% to 3% isoflurane. Luciferin solution was injected intraperitonially (0.01 mL/g body weight). Light emission was measured 15 minutes later, using a cooled CCD camera (IVIS; Xenogen), coupled to Living Image acquisition and analysis software over an integration time of 1 minute. Signal intensity was expressed as flux (photons/sec) integrated over the lung region. Lung tissue was collected at day 30 after injection. Tissues were fixed in EAF (ethanol–acetic acid–formol saline fixative, 40:5:10:45% v/v) and processed for histology. Paraffin sections were stained with hematoxylin and eosin. All microscopic images were acquired using IP-Lab software (Scanalytics Inc.) in combination with a monochrome CCD camera (Retiga SRV, 1,392 × 1,040 pixels) and a RGB filter (Slikder Module; QImaging) attached to a motorized microscope (Leica DM6000). Quantification of tumor size and number was carried out by ImageJ image analysis software.

Cell migration, elongation, and scatter experiments

Following overnight serum starvation, cells were harvested and resuspended in Dulbecco's Modified Eagle's Medium (DMEM) containing 0.1% FBS. Subsequently, 50,000 cells were applied to a transwell insert with 8-μm pore size (Corning Life Sciences), which was incubated in DMEM supplemented with 10% FBS. Cells were allowed to migrate for 8 hours at 37°C. Migrated cells were fixed (75% methanol and 25% acetic acid) and stained (0.25% Coomassie blue, 45% methanol, and 10% acetic acid in H2O). Single cell migration on vitronectin-coated (500 ng/mL) culture dishes was followed for 24 hours by time-lapse microscopy and analyzed using ImageJ image analysis software. Cell elongation was determined based on length and width ratios, measured after 24 hours. A cell was considered elongated when the ratio length/width was larger than 2. MCF7 cell scattering on vitronectin-coated (500 ng/mL) culture dishes was visualized by time-lapse microscopy in DMEM supplemented with 0.1% FBS. Gap closure assays were carried out according to manufacturer's recommendations (Applied Biophysics). In short, 40,000 MCF7 cells were seeded per insert and cultured overnight. After removal of the insert, cells were allowed to migrate for 24 hours, and migration was followed by time-lapse microscopy. Where indicated, cells were incubated in the presence of different concentrations Y27632 (Sigma-Aldrich) and GSK429286 (Seleckbio) Rho-kinase inhibitors.

Fluorescent staining of focal adhesions, E-cadherin, and F-actin

Images were taken with a Leica TCS SP5 confocal (Leica Microsystems) equipped with a 63× water-immersion objective and LAS-AF acquisition software (Leica Microsystems). Cells were cultured overnight on vitronectin-coated (500 ng/mL) glass coverslips in DMEM containing 0.1% FBS. Where indicated, cells were next incubated for 2 hours in the presence of 5 μmol/L Y27632 Rho-kinase inhibitor (Sigma-Aldrich). Cells were fixed in 3.7% formaldehyde, permeabilized in 0.1% Triton X-100, and stained for pTyr118 paxillin (1:100; Life Technologies), E-cadherin (1:200; BD Biosciences) and F-actin, using Alexa-568–conjugated Phalloidin (1:100; Life Technologies). The average number of focal adhesions per cell was quantified using an ImageJ analysis routine (macro). Series of paxillin images (pixel size, 0.11 × 0.11 μm2) were normalized with respect to intensity/contrast, background was subtracted and cell boundaries were detected by manually setting the appropriate threshold. The original image was subjected to a rolling ball filter of radius 10 pixels, which effectively suppresses staining irregularities while retaining contrast in the focal adhesions. Further thresholding and the “Analyze Particles” plugin (settings: particle size 30–500 pixels; circularity 0.1–1.0) were used to determine the number of focal adhesions. Photomicrographs of at least 60 cells were analyzed for each condition.

Detection of pSer19 myosin light chain and focal adhesion–associated pTyr118 paxillin on Western blot

For detection of pSer19 myosin light chain in control and TRPM7 shRNA–transduced MDA-MB-231 cells, cells were lysed in Laemmli buffer supplemented with 1 μmol/L MgCl2 and 1:200 Benzoase Nuclease (Merck) and left on ice for 30 minutes. Focal adhesion–associated proteins were extracted from MDA-MB-231 cells, as described previously (20). Proteins were separated by SDS-PAGE and blotted onto a polyvinylidene difluoride membrane. Blots were incubated with rabbit polyclonal anti-pTyr118 paxillin antibody (1:750; Life Technologies) or anti-pSer19 myosin light chain antibody (1:1,000; Life Technologies) and mouse monoclonal γ-tubulin (1:10,000; Sigma Aldrich) antibodies, followed by horseradish peroxidase–conjugated secondary antibodies (1:5,000; Dako). Proteins were detected using ECL Western blot reagent (GE Healthcare) and exposing the blots to film.

Statistical analysis

Statistical data are expressed as mean ± SD or ± SEM, as indicated in the text. Statistical differences were tested with 2-sided, unpaired Student t tests, and P less than 0.05 was considered statistically significant.

TRPM7 mRNA expression levels in primary tumors are associated with breast cancer progression and metastasis formation, independent from standard clinical parameters

Immunohistochemistry on primary breast cancer tissue samples showed that TRPM7 protein is expressed by epithelial cells that align mammary glands and by breast tumor cells. Perinuclear staining of breast carcinoma cells was observed with accentuation of the nuclear membrane, with or without diffuse staining of the cytoplasm (Fig. 1A). We explored the prognostic value of TRPM7 mRNA levels in breast cancer, using microarray-based gene expression data from breast cancer specimens, obtained by resection of the primary tumor at diagnosis (discovery cohort; n = 368) (Supplementary Table S1; ref. 17). After dichotomization based on the median TRPM7 expression level, the TRPM7-high group (n = 184) was found to exhibit a significantly shorter recurrence-free survival as compared with the TRPM7-low group (n = 184; HR, 1.42; 95% CI, 1.01–2.01, P = 0.042; Fig. 1B). Even stronger was the association of TRPM7 with distant metastasis-free survival interval (HR, 1.85; 95% CI, 1.22–2.81, P = 0.003; Fig. 1B).

Figure 1.

TRPM7 is a strong and independent prognostic marker for breast cancer progression and metastasis. A, TRPM7 protein expression in a breast tumor section (brown). Nuclei are counterstained with hematoxylin (blue). Left, scale bar, 500 μm. Right, scale bar, 100 μm. Indicated are breast tumor cells and stroma. B, Kaplan–Meier analysis of recurrence-free survival (left) and distant metastasis-free survival (right) according to TRPM7 mRNA expression obtained from microarray analysis on 368 breast cancer patients (discovery cohort). TRPM7-low, n = 184; TRPM7-high, n = 184. P values are based on Log rank test. C, Kaplan–Meier analysis of recurrence-free survival (left) and distant metastasis-free survival (right) according to TRPM7 mRNA expression determined by quantitative real-time PCR measurements on 144 breast cancer patients (validation cohort). TRPM7-low, n = 72; TRPM7-high, n = 72. P values are based on Log rank test.

Figure 1.

TRPM7 is a strong and independent prognostic marker for breast cancer progression and metastasis. A, TRPM7 protein expression in a breast tumor section (brown). Nuclei are counterstained with hematoxylin (blue). Left, scale bar, 500 μm. Right, scale bar, 100 μm. Indicated are breast tumor cells and stroma. B, Kaplan–Meier analysis of recurrence-free survival (left) and distant metastasis-free survival (right) according to TRPM7 mRNA expression obtained from microarray analysis on 368 breast cancer patients (discovery cohort). TRPM7-low, n = 184; TRPM7-high, n = 184. P values are based on Log rank test. C, Kaplan–Meier analysis of recurrence-free survival (left) and distant metastasis-free survival (right) according to TRPM7 mRNA expression determined by quantitative real-time PCR measurements on 144 breast cancer patients (validation cohort). TRPM7-low, n = 72; TRPM7-high, n = 72. P values are based on Log rank test.

Close modal

In 3 additional breast cancer cohorts (n = 190, 244, and n = 216), we did not detect a significant association of TRPM7 with disease outcome. Discordances between microarray-based datasets remain a serious problem, often reflecting differences in patient populations, probe selection, and mRNA abundance. We therefore sought for independent validation by carrying out quantitative real-time PCR (qPCR) experiments in a highly similar, independent breast cancer patient cohort (validation cohort; n = 144; Supplementary Table S1). TRPM7 mRNA expression was associated with disease recurrence (HR, 1.88; 95% CI, 1.06–3.33, P = 0.029) and occurrence of distant metastases. Although the HR was similar as in the discovery cohort, the latter association did not reach statistical significance (HR, 1.84; 95% CI, 0.91–3.71, P = 0.085), possibly because of a lower number of events (Fig. 1C).

We next assessed the association between TRPM7 expression and standard clinical parameters using the combined discovery and validation cohorts (n = 512). In support of its association with disease progression, TRPM7 was found enriched in high-grade primary tumors (P = 0.02; Supplementary Table S2A). Other prognostic parameters, including tumor size and ER status, were not associated with TRPM7 expression levels and TRPM7 expression was similar between breast cancer subtypes (P = 0.28; Supplementary Table S2B and C). However, because the dominant prognostic feature in all microarray studies of ER-positive breast cancer is proliferation, we cannot exclude that TRPM7 is an indirect indicator of proliferation in the ER-positive subgroup of tumors.

Univariate Cox regression analysis indicated that histologic grade, tumor size, and TRPM7 expression levels are strong predictors of both disease recurrence and the occurrence of distant metastases (Table 1; P < 0.01). Importantly, multivariate analysis revealed that TRPM7 mRNA expression is an independent prognostic marker for both disease recurrence (P = 0.02) and occurrence of metastases at distant sites (P = 0.01; Table 1), after correction for standard clinical parameters. Whereas future research must address to what extent TRPM7 levels indeed have prognostic value, our results indicated a strong and independent association between TRPM7 expression levels and breast cancer progression.

Table 1.

TRPM7 is a predictor of breast cancer recurrence and metastasis, independent of standard clinical parameters

Univariate analysisMultivariate analysis
FactorsCategoriesHR (95% CI)PHR (95% CI)P
A. Recurrence-free survival 
Age >50 vs. <50 y 0.74 (0.53–1.03) 0.07 0.82 (0.54–1.24) 0.34 
Histologic grade 2 & 3 vs. 1 2.23 (1.37–3.76) <0.01 1.85 (1.10–3.11) 0.02 
Lymph node status Positive vs. negative 1.24 (0.93–1.66) 0.15 1.24 (0.79–1.94) 0.34 
Tumor size >2 cm vs. <2 cm 1.93 (1.41–2.63) <0.01 1.71 (1.19–2.47) <0.01 
Syst. Adj. treatment Yes vs. no 1.02 (0.75–1.37) 0.92 0.85 (0.52–1.41) 0.53 
Estrogen receptor Positive vs. negative 0.65 (0.45–0.93) 0.02 0.80 (0.51–1.26) 0.34 
TRPM7 High vs. low 1.52 (1.13–2.03) <0.01 1.52 (1.08–2.12) 0.02 
B. Distant metastasis free survival 
Age >50 vs. <50 y 1.28 (0.80–2.05) 0.30 1.19 (0.68–2.08) 0.54 
Histologic grade 2 & 3 vs. 1 2.50 (1.34–4.67) <0.01 2.11 (1.12–4.00) 0.02 
Lymph node status Positive vs. negative 1.72 (1.21–2.43) <0.01 1.45 (0.86–2.43) 0.16 
Tumor size >2 cm vs. <2 cm 2.03 (1.40–2.96) <0.01 1.70 (1.10–2.64) 0.02 
Syst. adj. treatment Yes vs. no 1.39 (0.95–2.04) 0.90 0.86 (0.47–1.57) 0.62 
Estrogen receptor Positive vs. negative 0.91 (0.57–1.47) 0.70 0.98 (0.54–1.77) 0.94 
TRPM7 High vs. low 1.75 (1.19–2.58) <0.01 1.69 (1.13–2.54) 0.01 
Univariate analysisMultivariate analysis
FactorsCategoriesHR (95% CI)PHR (95% CI)P
A. Recurrence-free survival 
Age >50 vs. <50 y 0.74 (0.53–1.03) 0.07 0.82 (0.54–1.24) 0.34 
Histologic grade 2 & 3 vs. 1 2.23 (1.37–3.76) <0.01 1.85 (1.10–3.11) 0.02 
Lymph node status Positive vs. negative 1.24 (0.93–1.66) 0.15 1.24 (0.79–1.94) 0.34 
Tumor size >2 cm vs. <2 cm 1.93 (1.41–2.63) <0.01 1.71 (1.19–2.47) <0.01 
Syst. Adj. treatment Yes vs. no 1.02 (0.75–1.37) 0.92 0.85 (0.52–1.41) 0.53 
Estrogen receptor Positive vs. negative 0.65 (0.45–0.93) 0.02 0.80 (0.51–1.26) 0.34 
TRPM7 High vs. low 1.52 (1.13–2.03) <0.01 1.52 (1.08–2.12) 0.02 
B. Distant metastasis free survival 
Age >50 vs. <50 y 1.28 (0.80–2.05) 0.30 1.19 (0.68–2.08) 0.54 
Histologic grade 2 & 3 vs. 1 2.50 (1.34–4.67) <0.01 2.11 (1.12–4.00) 0.02 
Lymph node status Positive vs. negative 1.72 (1.21–2.43) <0.01 1.45 (0.86–2.43) 0.16 
Tumor size >2 cm vs. <2 cm 2.03 (1.40–2.96) <0.01 1.70 (1.10–2.64) 0.02 
Syst. adj. treatment Yes vs. no 1.39 (0.95–2.04) 0.90 0.86 (0.47–1.57) 0.62 
Estrogen receptor Positive vs. negative 0.91 (0.57–1.47) 0.70 0.98 (0.54–1.77) 0.94 
TRPM7 High vs. low 1.75 (1.19–2.58) <0.01 1.69 (1.13–2.54) 0.01 

NOTE: Univariate and multivariate Cox proportional hazards modeling of factors associated with recurrence-free survival (A) and distant metastasis-free survival (B) in the combined discovery and validation cohorts (n = 512). TRPM7-low, n = 256; TRPM7-high, n = 256. Bold numbers, P < 0.05, statistically significant. Abbreviation: CI, confidence interval.

TRPM7 knockdown interferes with the metastatic potential, but not proliferation, of invasive, triple-negative breast cancer cells in vivo

To establish a causal relation between TRPM7 expression levels and metastasis formation, shRNA-mediated knockdown was carried out by lentiviral transduction of invasive, triple-negative MDA-MB-231 breast cancer cells. Knockdown efficiency was about 80%, as determined both by qPCR and by measuring TRPM7 autophosphorylation using an in vitro kinase assay (Supplementary Fig. S1A and B). A number of studies has shown that TRPM7 knockdown can affect cell viability and proliferation in vitro (21, 22). However, we observed that MDA-MB-231 TRPM7 shRNA cells proliferated normally and showed no loss in cell viability (Fig. 2A and Supplementary Fig. S2A). We next compared in vivo metastasis formation of MDA-MB-231 control and TRPM7 shRNA cells that were made to express a luciferase reporter gene. Following injection of cells in the tail vein of immunodeficient Rag2−/−IL2rg−/− mice, luciferase-based noninvasive bioluminescence imaging was used to monitor dissemination and growth of tumor cells in vivo. Consistent with earlier reports describing this experimental metastasis model (23), tumor cells were initially trapped in the lungs, probably because of size restrictions of the mouse lung capillaries (Fig. 2B). The progressive increase of the bioluminescent signal in mice injected with control cells indicates that these cells effectively developed into pulmonary metastases (Fig. 2C). At day 30 after injection, metastatic spread of tumor cells throughout the body was observed in all of the control mice. One mouse had to be taken out of the experiment 22 days after injection because of a large tumor mass in the head of the animal (Fig. 2D). TRPM7 knockdown led to a strong reduction in bioluminescent signal intensity from day 7 onwards, which remained mostly restricted to the lungs (Fig. 2C and D). Similar results were obtained from an independent experiment in which an additional TRPM7 knockdown cell line, derived using a second shRNA, was included (Supplementary Fig. S1A and B and Supplementary Fig. S2B and C). These observations suggested that TRPM7 knockdown impairs the initial establishment of tumors in the lung and dissemination to other parts of the body. Quantitative analysis of tumor size in HE-stained lung sections confirmed that TRPM7 knockdown did not affect proliferation [mean tumor size, control: 0.045 mm2 ± 0.0047 (n = 474) vs. TRPM7 shRNA: 0.037 mm2 ± 0.0054 (n = 131), 3 mice per group, P = 0.29; Fig 2E and G and Supplementary Fig. S2D]. However, TRPM7 knockdown significantly reduced the number of lung tumors per mouse (control: 158.33 ± 11.7 vs. TRPM7 shRNA: 43.67 ± 5.33, 3 mice per group, P < 0.001; Fig. 2F and G). Overall, these experiments showed that a reduction of TRPM7 protein expression effectively interferes with the metastatic potential of invasive human breast cancer cells in vivo.

Figure 2.

Reduced TRPM7 expression interferes with the metastatic potential of MDA-MB-231 human breast cancer cells in vivo. A, proliferation and overall viability of control and TRPM7 knockdown MDA-MB-231 cells, determined by MTS assays. Measurements were carried out at different time points, indicated on the x-axis. Metabolic activity is expressed as the amount of produced Formazan, determined by photospectrometry and normalized to initial metabolic activity. Data are presented as mean ± SEM of 2 independent experiments that were carried out in triplicate. B, representative bioluminescence images of mice 7 days after intravenous injections with MDA-MB-231 control or TRPM7 shRNA cells. C, quantification of bioluminescence in the lung region of mice for up to 30 days after injection. Data are presented as mean ± SEM of n = 5 mice in each group. D, bioluminescence images of mice taken 30 days after injection. Photon fluxes are to the same scale. Dagger in C and D indicates a mouse that had to be euthanized 22 days after injection with control MDA-MB-231 cells, because of a large tumor in the head region. Bioluminescence image in D was taken at day 21. Subsequent quantifications were carried out on the 9 remaining mice. E, quantification of mean lung tumor size in mice injected with MDA-MB-231 control or TRPM7 shRNA cells. Error bars represent SEM for n = 3 mice in each group. F, quantification of the number of lung tumors per mouse measured in resected lung tissue from mice injected with MDA-MB-231 control or TRPM7 shRNA cells. Error bars represent SEM for n = 3 in each group. ***, P < 0.001. For size distribution, see Supplementary Fig. S2B. G, representative hematoxylin and eosin staining on lung tissue collected 30 days after injection with MDA-MB-231 control or TRPM7 shRNA cells. Prominent tumors in lung tissue from mice injected with TRPM7 shRNA cells (bottom) are indicated by arrows. Scale bar, 1 mm.

Figure 2.

Reduced TRPM7 expression interferes with the metastatic potential of MDA-MB-231 human breast cancer cells in vivo. A, proliferation and overall viability of control and TRPM7 knockdown MDA-MB-231 cells, determined by MTS assays. Measurements were carried out at different time points, indicated on the x-axis. Metabolic activity is expressed as the amount of produced Formazan, determined by photospectrometry and normalized to initial metabolic activity. Data are presented as mean ± SEM of 2 independent experiments that were carried out in triplicate. B, representative bioluminescence images of mice 7 days after intravenous injections with MDA-MB-231 control or TRPM7 shRNA cells. C, quantification of bioluminescence in the lung region of mice for up to 30 days after injection. Data are presented as mean ± SEM of n = 5 mice in each group. D, bioluminescence images of mice taken 30 days after injection. Photon fluxes are to the same scale. Dagger in C and D indicates a mouse that had to be euthanized 22 days after injection with control MDA-MB-231 cells, because of a large tumor in the head region. Bioluminescence image in D was taken at day 21. Subsequent quantifications were carried out on the 9 remaining mice. E, quantification of mean lung tumor size in mice injected with MDA-MB-231 control or TRPM7 shRNA cells. Error bars represent SEM for n = 3 mice in each group. F, quantification of the number of lung tumors per mouse measured in resected lung tissue from mice injected with MDA-MB-231 control or TRPM7 shRNA cells. Error bars represent SEM for n = 3 in each group. ***, P < 0.001. For size distribution, see Supplementary Fig. S2B. G, representative hematoxylin and eosin staining on lung tissue collected 30 days after injection with MDA-MB-231 control or TRPM7 shRNA cells. Prominent tumors in lung tissue from mice injected with TRPM7 shRNA cells (bottom) are indicated by arrows. Scale bar, 1 mm.

Close modal

TRPM7 knockdown impairs migratory properties of invasive, triple-negative breast cancer cells in vitro

To examine how TRPM7 may affect the ability of tumor cells to spread to distant sites, we studied the consequences of TRPM7 knockdown on cytoskeletal organization and cell behavior. Whereas control MDA-MB-231 cells exhibited a characteristic spindle-shaped (mesenchymal) morphology with actin-rich protrusions at the leading edge, this elongated morphology was lost upon TRPM7 knockdown (percentage elongated control cells: 63.3% ± 2.8% vs. TRPM7 shRNA: 30.0% ± 2.5%, n > 400, 4 independent experiments, P < 0.001; Fig. 3A and B). Moreover, loss of TRPM7 expression effectively interfered with the ability of these cells to migrate toward a serum gradient, as determined in a transwell migration assay (control: 100% vs. TRPM7 shRNA: 50.56% ± 9.15%, 5 exp, P < 0.01; Fig. 3C). By time-lapse microscopy, we observed that TRPM7 knockdown affected cell migration speed, resulting in significantly shorter migration trajectories (control: 29.7 ± 2.2 μm/h vs. TRPM7 shRNA: 17.2 ± 1.1 μm/h, n > 200, 4 exp, P < 0.01; Fig. 3D and E).

Figure 3.

TRPM7 contributes to the malignant phenotype of MDA-MB-231 breast cancer cells in vitro. A, representative phase-contrast images of control and TRPM7 shRNA MDA-MB-231 cells. Scale bar, 50 μm. B, quantification of elongated MDA-MB-231 cells, TRPM7 shRNA cells, and TRPM7 shRNA cells made to reexpress a mouse TRPM7 cDNA (rescued cells). Elongation is presented as percentage (± SEM; 4 independent experiments, n > 400) of cells that have a length of more than twice the width. ***, P < 0.001; ** P, < 0.01. C, quantification of serum-induced transwell migration by MDA-MB-231 cells, TRPM7 shRNA cells, and the rescued cell line. Data, normalized to the number of control MDA-MB-231 cells, are from 5 independent experiments carried out in duplicate in which the rescued cell line was included twice, and represent mean ± SEM. Migration was scored after 8 hours. **, P < 0.01; *, P < 0.05. D, representative trajectories of migrating control (n = 10) and TRPM7 shRNA (n = 10) MDA-MB-231 cells followed for 24 hours. E, quantification of single cell migration speed. Shown is migration speed (μm/h, mean ± SEM) of 4 independent experiments, each carried out in duplicate (n > 200 per cell line). **, P < 0.01.

Figure 3.

TRPM7 contributes to the malignant phenotype of MDA-MB-231 breast cancer cells in vitro. A, representative phase-contrast images of control and TRPM7 shRNA MDA-MB-231 cells. Scale bar, 50 μm. B, quantification of elongated MDA-MB-231 cells, TRPM7 shRNA cells, and TRPM7 shRNA cells made to reexpress a mouse TRPM7 cDNA (rescued cells). Elongation is presented as percentage (± SEM; 4 independent experiments, n > 400) of cells that have a length of more than twice the width. ***, P < 0.001; ** P, < 0.01. C, quantification of serum-induced transwell migration by MDA-MB-231 cells, TRPM7 shRNA cells, and the rescued cell line. Data, normalized to the number of control MDA-MB-231 cells, are from 5 independent experiments carried out in duplicate in which the rescued cell line was included twice, and represent mean ± SEM. Migration was scored after 8 hours. **, P < 0.01; *, P < 0.05. D, representative trajectories of migrating control (n = 10) and TRPM7 shRNA (n = 10) MDA-MB-231 cells followed for 24 hours. E, quantification of single cell migration speed. Shown is migration speed (μm/h, mean ± SEM) of 4 independent experiments, each carried out in duplicate (n > 200 per cell line). **, P < 0.01.

Close modal

Similar results were obtained with the second TRPM7 knockdown cell line (Supplementary Fig. S1A and B, Supplementary Fig. S3). We additionally reexpressed a mouse TRPM7 cDNA into the TRPM7 knockdown cells, which contained one mismatch with respect to the (human specific) shRNA. We confirmed by qPCR analysis as well as by in vitro kinase assays that expression of TRPM7 was restored to about 70% of that in the control cells (Supplementary Fig. S1C and D). Reexpression of TRPM7 was sufficient to rescue the elongated morphology (percentage of elongated cells: 56.2% ± 4.7%, n = 400, 4 exp, P < 0.01) and restore the migratory properties of MDA-MB-231 TRPM7 knockdown cells (transwell: 95.3% ± 1.2%, 2 exp, P < 0.05; single-cell migration: 25.3 ± 1.6 μm/h, n > 200, 4 exp, P < 0.01; Fig. 3).

Reduced TRPM7 expression levels confer a contractile phenotype onto triple-negative breast tumor cells and induce cell-substrate adhesion assembly

In addition to the functional changes, immunofluorescent staining of MDA-MB-231 cells revealed the redistribution of filamentous actin to the cell cortex and a strong increase in the number of focal adhesions, especially in the periphery of TRPM7 knockdown MDA-MB-231 cells, relative to mock-transduced control cells (control: 13.8 ± 0.62, TRPM7 shRNA: 29.9 ± 0.85, n > 100, P < 0.001; Fig. 4A and B). Focal adhesions are mechanosensitive adhesion structures whose assembly and disassembly need to be tightly regulated by a combination of myosin II–based cellular tension and local Ca2+ signaling events to allow optimal cell migration (24–29). Increased focal adhesion assembly is generally associated with high cytoskeletal tension, accompanied by tyrosine phosphorylation of focal adhesion components such as paxillin as well as increased myosin light chain (MLC) phosphorylation (24). Indeed, the increase in focal adhesions observed in the TRPM7 knockdown cells was reflected by a rise in Tyr118-phosphorylated paxillin and Ser19-phosphorylated MLC on a Western blot (Fig. 4C and Supplementary Fig. S4A). Reexpression of TRPM7 reduced focal adhesion content (18.2 ± 0.89, n = 45, P < 0.001) and reverted paxillin phosphorylation (Fig. 4).

Figure 4.

Reduced TRPM7 expression increases cytoskeletal contractility and affects focal adhesion dynamics of MDA-MB-231 cells. A, immunofluorescence staining of MDA-MB-231 cells with pTyr118 paxillin antibodies to reveal focal adhesions and Alexa-568 phalloidin to visualize the actin cytoskeleton. Arrows indicate enrichment of filamentous actin at the cell cortex. Scale bar, 10 μm. B, quantification of the number of focal adhesions per cell carried out by automated image analyses as detailed in Material and Methods. Data are mean ± SEM (n > 100 for control and TRPM7 knockdown cells, n = 45 for rescue cell line). ***, P < 0.001. C, immunoblot of Triton X-100 insoluble fractions derived from MDA-MB-231 control, TRPM7 shRNA, and rescued cells. Antibodies against pTyr118 paxillin were used to determine the amount of tyrosine phosphorylated paxillin as a measure of cytoskeletal contractility and focal adhesion content. Antibodies against γ-tubulin were used to control for loading. For uncropped immunoblots, see Supplementary Fig. S5A.

Figure 4.

Reduced TRPM7 expression increases cytoskeletal contractility and affects focal adhesion dynamics of MDA-MB-231 cells. A, immunofluorescence staining of MDA-MB-231 cells with pTyr118 paxillin antibodies to reveal focal adhesions and Alexa-568 phalloidin to visualize the actin cytoskeleton. Arrows indicate enrichment of filamentous actin at the cell cortex. Scale bar, 10 μm. B, quantification of the number of focal adhesions per cell carried out by automated image analyses as detailed in Material and Methods. Data are mean ± SEM (n > 100 for control and TRPM7 knockdown cells, n = 45 for rescue cell line). ***, P < 0.001. C, immunoblot of Triton X-100 insoluble fractions derived from MDA-MB-231 control, TRPM7 shRNA, and rescued cells. Antibodies against pTyr118 paxillin were used to determine the amount of tyrosine phosphorylated paxillin as a measure of cytoskeletal contractility and focal adhesion content. Antibodies against γ-tubulin were used to control for loading. For uncropped immunoblots, see Supplementary Fig. S5A.

Close modal

ER-positive breast cancer cells exhibit reduced cell migration speed and enforced cell–cell adhesions upon TRPM7 knockdown

In addition to basal-like tumors, represented by the triple-negative MDA-MB-231 breast cancer model, a large part of the patient dataset consisted of ER-positive, luminal type breast cancer patients. To validate our observations in these tumors, we knocked down TRPM7 in noninvasive, ER-positive MCF7 human breast cancer cells (Supplementary Fig. S1E). This significantly reduced migration of MCF7 cells in gap-closure assays (control: 11.5 ± 0.5% vs. TRPM7 shRNA: 21.2 ± 1.7% gap remaining after 24 hours, 3 exp, P < 0.01; Fig. 5A and B). In these epithelial-like cells, TRPM7 knockdown predominantly affected cell–cell adhesion rather than cell-substrate adhesion. Unlike the control shRNA-transduced cells, the TRPM7 knockdown cells were able to maintain cell–cell contacts upon serum deprivation, a condition known to induce scattering of epithelial cells (ref. 30; Fig. 5C). Although increased MLC and paxillin phosphorylation were not observed in MCF7 TRPM7 shRNA cells (data not shown), confocal microscopy revealed profound effects on cytoskeletal organization and cell–cell contacts (Fig. 5D). Similar to our observations in MDA-MB-231 cells, TRPM7 knockdown induced the redistribution of filamentous actin to the cell cortex. Moreover, cell–cell interactions seemed to be enforced in MCF7 TRPM7 shRNA cells, evident from increased cell–cell contact area and enrichment of E-cadherin at these interfaces. Cadherin-containing cell–cell adhesions, known as adherens junctions, show functional and structural similarities to focal adhesions (4). Like focal adhesions, adherens junctions are highly dynamic multiprotein complexes that act in close association with the actomyosin cytoskeleton to translate mechanical signals into cellular responses. Moreover, their formation and size are directly associated with myosin II–based cellular tension (5).

Figure 5.

TRPM7 knockdown reduces migratory properties and increases cell–cell interactions of MCF7 cells. A, representative images of gap closure assay at time points 0, 12, 18, and 24 hours. Scale bar, 100 μm. B, quantification of percentage gap remaining after 12, 18, and 24 hours. Data are from 3 independent experiments, each carried out in duplicate and represent mean ± SEM. *, P < 0.05; **, P < 0.01. C, representative images from MCF7 control and TRPM7 knockdown cells after 0, 2, and 4 hours of serum deprivation. Scale bar, 100 μm. D, immunofluorescence detection of E-cadherin in MCF7 cells to reveal adherens junctions and Alexa-568 phalloidin to visualize the actin cytoskeleton. Arrows indicate enrichment of E-cadherin at cell–cell interfaces. Scale bar, 10 μm.

Figure 5.

TRPM7 knockdown reduces migratory properties and increases cell–cell interactions of MCF7 cells. A, representative images of gap closure assay at time points 0, 12, 18, and 24 hours. Scale bar, 100 μm. B, quantification of percentage gap remaining after 12, 18, and 24 hours. Data are from 3 independent experiments, each carried out in duplicate and represent mean ± SEM. *, P < 0.05; **, P < 0.01. C, representative images from MCF7 control and TRPM7 knockdown cells after 0, 2, and 4 hours of serum deprivation. Scale bar, 100 μm. D, immunofluorescence detection of E-cadherin in MCF7 cells to reveal adherens junctions and Alexa-568 phalloidin to visualize the actin cytoskeleton. Arrows indicate enrichment of E-cadherin at cell–cell interfaces. Scale bar, 10 μm.

Close modal

Pharmacologic inhibition of cytoskeletal tension rescues the TRPM7 knockdown phenotype

Our results indicated that TRPM7 knockdown confers a contractile phenotype onto breast cancer cells and consequently, impairs their migratory and metastatic properties. Consistent with this notion, inhibition of myosin II–based cytoskeletal tension using the Y27632 Rho-kinase inhibitor (31) was sufficient to revert the phenotype of TRPM7 knockdown in MDA-MB-231 cells to the characteristic elongated morphology of control cells (elongated cells: 54.5% ± 3.0%, n > 100, 2 exp, P < 0.05; Fig. 6A), while reducing MLC- and paxillin phosphorylation, and the number of focal adhesions back to control levels (15.7 ± 0.26, n > 100, P < 0.001; Fig. 6B and C, Supplementary Fig. S4A and B). A similar effect was observed with the structurally unrelated Rho-kinase inhibitor GSK429286 (ref. 32; Supplementary Fig. S4A and B). Strikingly, Rho-kinase inhibition restored serum-induced transwell migration of TRPM7 knockdown cells [TRPM7 shRNA: 63.9% ± 7.0% vs. TRPM7 shRNA + Y27632 (5 μmol/L): 116.6% ± 17.9%, 3 exp, P < 0.05] without affecting MDA-MB-231 control cell migration (Fig. 6D and Supplementary Fig. S4C). Likewise, gap-closure speed of MFC7 TRPM7 shRNA cells was rescued by Rho-kinase inhibition (Fig. 6E and Supplementary Fig. S4D). In contrast to MDA-MB-231 cells, low concentrations of Rho-kinase inhibitors already significantly increased gap-closure speed of MCF7 control cells. However, much higher concentrations of these compounds were required to maximize gap-closure speed of MCF7 TRPM7 shRNA cells, supporting the notion that TRPM7 knockdown increases cellular tension.

Figure 6.

Inhibition of cytoskeletal contractility recovers TRPM7 knockdown phenotype in both MDA-MB-231 and MCF7 cells. A, quantification of elongated MDA-MB-231 TRPM7 shRNA cells with or without pretreatment with 5 μmol/L Rho-kinase inhibitor Y27632. Elongation is presented as percentage (± SEM; 2 independent experiments, n > 100) of cells that have a length of more than twice the width. *, P < 0.05. B, quantification of focal adhesion content in MDA-MB-231 TRPM7 shRNA cells with or without pretreatment for 2 hours with 5 μmol/L Rho-kinase inhibitor Y27632. Data are mean ± SEM (n > 100 cells per cell line). ***, P < 0.001. C, immunofluorescence staining of MDA-MB-231 cells with pTyr118 paxillin antibodies to reveal focal adhesions and Alexa-568 phalloidin to visualize the actin cytoskeleton. Scale bar, 10 μm. D, quantification of serum-induced transwell migration of MDA-MB-231 control and TRPM7 shRNA cells treated with indicated concentrations Y27632 Rho-kinase inhibitor. Data, normalized to the number of migrated MDA-MB-231 control cells that were untreated, are from 3 independent experiments carried out in duplicate and represent mean ± SEM. Migration was scored after 8 hours. *, P < 0.05. For data on GSK429286 treated cells, see Supplementary Fig. S4C. E, quantification of percentage gap remaining by MCF7 control and TRPM7 shRNA cells, treated with indicated concentrations Y27632 Rho-kinase inhibitor. Data represent percentage gap remaining after 18 hours (mean ± SEM, 3 independent experiments, each conducted in duplicate). **, P < 0.01; ***, P < 0.0001. For data on GSK429286 treated cells, see Supplementary Fig. S4D.

Figure 6.

Inhibition of cytoskeletal contractility recovers TRPM7 knockdown phenotype in both MDA-MB-231 and MCF7 cells. A, quantification of elongated MDA-MB-231 TRPM7 shRNA cells with or without pretreatment with 5 μmol/L Rho-kinase inhibitor Y27632. Elongation is presented as percentage (± SEM; 2 independent experiments, n > 100) of cells that have a length of more than twice the width. *, P < 0.05. B, quantification of focal adhesion content in MDA-MB-231 TRPM7 shRNA cells with or without pretreatment for 2 hours with 5 μmol/L Rho-kinase inhibitor Y27632. Data are mean ± SEM (n > 100 cells per cell line). ***, P < 0.001. C, immunofluorescence staining of MDA-MB-231 cells with pTyr118 paxillin antibodies to reveal focal adhesions and Alexa-568 phalloidin to visualize the actin cytoskeleton. Scale bar, 10 μm. D, quantification of serum-induced transwell migration of MDA-MB-231 control and TRPM7 shRNA cells treated with indicated concentrations Y27632 Rho-kinase inhibitor. Data, normalized to the number of migrated MDA-MB-231 control cells that were untreated, are from 3 independent experiments carried out in duplicate and represent mean ± SEM. Migration was scored after 8 hours. *, P < 0.05. For data on GSK429286 treated cells, see Supplementary Fig. S4C. E, quantification of percentage gap remaining by MCF7 control and TRPM7 shRNA cells, treated with indicated concentrations Y27632 Rho-kinase inhibitor. Data represent percentage gap remaining after 18 hours (mean ± SEM, 3 independent experiments, each conducted in duplicate). **, P < 0.01; ***, P < 0.0001. For data on GSK429286 treated cells, see Supplementary Fig. S4D.

Close modal

Although our observations are not in agreement with the general notion that increases in Rho-ROCK signaling positively correlate with cell migration and metastasis formation (6, 33, 34), it is well known that actomyosin contractility, adhesion dynamics, and the mechanical properties of the substrate have to be tightly balanced to maximize migration velocity (26, 27, 35, 36). Hence, overassembly of either focal adhesions or adherens junctions in the TRPM7 knockdown cells, both a consequence of increased cytoskeletal tension, likely interferes with optimal cell migration (Supplementary Fig. S4E). Altogether, our results indicated that TRPM7 is part of the mechanosensory machinery that regulates cellular tension and steers adhesion dynamics to allow cell migration and metastasis formation.

TRP channels play a prominent role in translating mechanical forces into biochemical signals, although in most cases it remains to be established whether they are directly activated by mechanical stimulation. Activation of these proteins not only leads to changes in local Ca2+ concentrations but also triggers other signaling mechanisms that influence cell behavior and differentiation (37). Mice deficient in TRPM7 show widespread defects in early embryonic development, pointing at a nonredundant role for this channel kinase in organ development (38). Defects in mechanotransduction, especially those that affect cellular tension, are known to contribute to disease progression (39, 40). Hence, we propose that TRPM7-guided cell adhesion and migration are normal attributes of epithelial and mesenchymal cells, required during organ development, but when spuriously activated in cancer cells contribute to metastasis formation.

No potential conflicts of interest were disclosed.

Conception and design: J. Middelbeek, A.J. Kuipers, L. Henneman, D. Visser, W. Zwart, F.N. van Leeuwen, K. Jalink

Development of methodology: J. Middelbeek, A.J. Kuipers, D. Visser, I. Eidhof, F.N. van Leeuwen, K. Jalink

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): J. Middelbeek, A.J. Kuipers, L. Henneman, D. Visser, I. Eidhof, R. van Horssen, F.C.G.J. Sweep, P. Bult, P.N Span, K. Jalink

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): J. Middelbeek, A.J. Kuipers, L. Henneman, I. Eidhof, R. van Horssen, S.V. Canisius, L.F. Wessels, P.N Span, F.N. van Leeuwen, K. Jalink

Writing, review, and/or revision of the manuscript: J. Middelbeek, A.J. Kuipers, L. Henneman, D. Visser, S.V. Canisius, W. Zwart, L.F. Wessels, F.C.G.J. Sweep, P. Bult, P.N Span, F.N. van Leeuwen, K. Jalink

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): L. Henneman, P.N Span, K. Jalink

Study supervision: B. Wieringa, P.N Span, F.N. van Leeuwen, K. Jalink

The authors thank J.J.T.M. Heuvel and W.J.M. Peeters for technical assistance and members of the Division of Experimental Therapy as well as their laboratory members for support, critical discussions, and critical reading of the manuscript.

This work was supported by KWF grants to F.N. van Leeuwen and K. Jalink (KUN2007-3733 and NKI 2010-4626).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Bidwell
JP
,
Pavalko
FM
. 
Mechanosomes carry a loaded message.
Science Signaling
2010
;
3
:
pe51
.
2.
Geiger
B
,
Bershadsky
A
. 
Exploring the neighborhood: adhesion-coupled cell mechanosensors
.
Cell
2002
;
110
:
139
42
.
3.
Parsons
JT
,
Horwitz
AR
,
Schwartz
MA
. 
Cell adhesion: integrating cytoskeletal dynamics and cellular tension
.
Nat Rev
2010
;
11
:
633
43
.
4.
Chen
CS
,
Tan
J
,
Tien
J
. 
Mechanotransduction at cell-matrix and cell-cell contacts
.
Annu Rev Biomed Eng
2004
;
6
:
275
302
.
5.
Liu
Z
,
Tan
JL
,
Cohen
DM
,
Yang
MT
,
Sniadecki
NJ
,
Ruiz
SA
, et al
Mechanical tugging force regulates the size of cell-cell junctions
.
Proc Natl Acad Sci U S A
2010
;
107
:
9944
9
.
6.
Paszek
MJ
,
Zahir
N
,
Johnson
KR
,
Lakins
JN
,
Rozenberg
GI
,
Gefen
A
, et al
Tensional homeostasis and the malignant phenotype
.
Cancer Cell
2005
;
8
:
241
54
.
7.
Clark
K
,
Middelbeek
J
,
van Leeuwen
FN
. 
Interplay between TRP channels and the cytoskeleton in health and disease
.
Eur J Cell Biol
2008
;
87
:
631
40
.
8.
Lin
SY
,
Corey
DP
. 
TRP channels in mechanosensation
.
Curr Opin Neurobiol
2005
;
15
:
350
7
.
9.
Orr
AW
,
Helmke
BP
,
Blackman
BR
,
Schwartz
MA
. 
Mechanisms of mechanotransduction
.
Dev Cell
2006
;
10
:
11
20
.
10.
Numata
T
,
Shimizu
T
,
Okada
Y
. 
Direct mechano-stress sensitivity of TRPM7 channel
.
Cell Physiol Biochem
2007
;
19
:
1
8
.
11.
Oancea
E
,
Wolfe
JT
,
Clapham
DE
. 
Functional TRPM7 channels accumulate at the plasma membrane in response to fluid flow
.
Circ Res
2006
;
98
:
245
53
.
12.
Clark
K
,
Middelbeek
J
,
Lasonder
E
,
Dulyaninova
NG
,
Morrice
NA
,
Ryazanov
AG
, et al
TRPM7 regulates myosin IIA filament stability and protein localization by heavy chain phosphorylation
.
J Mol Biol
2008
;
378
:
790
803
.
13.
Goswami
C
,
Kuhn
J
,
Heppenstall
PA
,
Hucho
T
. 
Importance of non-selective cation channel TRPV4 interaction with cytoskeleton and their reciprocal regulations in cultured cells
.
PLoS One
2010
;
5
:
e11654
.
14.
Clark
K
,
Langeslag
M
,
van Leeuwen
B
,
Ran
L
,
Ryazanov
AG
,
Figdor
CG
, et al
TRPM7, a novel regulator of actomyosin contractility and cell adhesion
.
EMBO J
2006
;
25
:
290
301
.
15.
Wei
C
,
Wang
X
,
Chen
M
,
Ouyang
K
,
Song
LS
,
Cheng
H
. 
Calcium flickers steer cell migration
.
Nature
2009
;
457
:
901
5
.
16.
Su
LT
,
Agapito
MA
,
Li
M
,
Simonson
WT
,
Huttenlocher
A
,
Habas
R
, et al
TRPM7 regulates cell adhesion by controlling the calcium-dependent protease calpain
.
J Biol Chem
2006
;
281
:
11260
70
.
17.
Loi
S
,
Haibe-Kains
B
,
Desmedt
C
,
Lallemand
F
,
Tutt
AM
,
Gillet
C
, et al
Definition of clinically distinct molecular subtypes in estrogen receptor-positive breast carcinomas through genomic grade
.
J Clin Oncol
2007
;
25
:
1239
46
.
18.
Span
PN
,
Waanders
E
,
Manders
P
,
Heuvel
JJ
,
Foekens
JA
,
Watson
MA
, et al
Mammaglobin is associated with low-grade, steroid receptor-positive breast tumors from postmenopausal patients, and has independent prognostic value for relapse-free survival time
.
J Clin Oncol
2004
;
22
:
691
8
.
19.
Livak
KJ
,
Schmittgen
TD
. 
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method
.
Methods
2001
;
25
:
402
8
.
20.
Putnam
AJ
,
Cunningham
JJ
,
Pillemer
BB
,
Mooney
DJ
. 
External mechanical strain regulates membrane targeting of Rho GTPases by controlling microtubule assembly
.
Am J Physiol
2003
;
284
:
C627
39
.
21.
Guilbert
A
,
Gautier
M
,
Dhennin-Duthille
I
,
Haren
N
,
Sevestre
H
,
Ouadid-Ahidouch
H
. 
Evidence that TRPM7 is required for breast cancer cell proliferation
.
Am J Physiol
2009
;
297
:
C493
502
.
22.
Jiang
J
,
Li
MH
,
Inoue
K
,
Chu
XP
,
Seeds
J
,
Xiong
ZG
. 
Transient receptor potential melastatin 7-like current in human head and neck carcinoma cells: role in cell proliferation
.
Cancer Res
2007
;
67
:
10929
38
.
23.
Yang
S
,
Zhang
JJ
,
Huang
XY
. 
Orai1 and STIM1 are critical for breast tumor cell migration and metastasis
.
Cancer Cell
2009
;
15
:
124
34
.
24.
Chrzanowska-Wodnicka
M
,
Burridge
K
. 
Rho-stimulated contractility drives the formation of stress fibers and focal adhesions
.
J Cell Biol
1996
;
133
:
1403
15
.
25.
Giannone
G
,
Ronde
P
,
Gaire
M
,
Haiech
J
,
Takeda
K
. 
Calcium oscillations trigger focal adhesion disassembly in human U87 astrocytoma cells
.
J Biol Chem
2002
;
277
:
26364
71
.
26.
Gupton
SL
,
Waterman-Storer
CM
. 
Spatiotemporal feedback between actomyosin and focal-adhesion systems optimizes rapid cell migration
.
Cell
2006
;
125
:
1361
74
.
27.
Barnhart
EL
,
Lee
KC
,
Keren
K
,
Mogilner
A
,
Theriot
JA
. 
An adhesion-dependent switch between mechanisms that determine motile cell shape
.
PLoS Biol
2011
;
9
:
e1001059
.
28.
Wolfenson
H
,
Bershadsky
A
,
Henis
YI
,
Geiger
B
. 
Actomyosin-generated tension controls the molecular kinetics of focal adhesions
.
J Cell Sci
2011
;
124
:
1425
32
.
29.
Aratyn-Schaus
Y
,
Gardel
ML
. 
Transient frictional slip between integrin and the ECM in focal adhesions under myosin II tension
.
Curr Biol
2010
;
20
:
1145
53
.
30.
Chen
CL
,
Chan
PC
,
Wang
SH
,
Pan
YR
,
Chen
HC
. 
Elevated expression of protein kinase C delta induces cell scattering upon serum deprivation
.
J Cell Sci
2010
;
123
:
2901
13
.
31.
Uehata
M
,
Ishizaki
T
,
Satoh
H
,
Ono
T
,
Kawahara
T
,
Morishita
T
, et al
Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension
.
Nature
1997
;
389
:
990
4
.
32.
Goodman
KB
,
Cui
H
,
Dowdell
SE
,
Gaitanopoulos
DE
,
Ivy
RL
,
Sehon
CA
, et al
Development of dihydropyridone indazole amides as selective Rho-kinase inhibitors
.
J Med Chem
2007
;
50
:
6
9
.
33.
Croft
DR
,
Sahai
E
,
Mavria
G
,
Li
S
,
Tsai
J
,
Lee
WM
, et al
Conditional ROCK activation in vivo induces tumor cell dissemination and angiogenesis
.
Cancer Res
2004
;
64
:
8994
9001
.
34.
Jiang
P
,
Enomoto
A
,
Takahashi
M
. 
Cell biology of the movement of breast cancer cells: intracellular signalling and the actin cytoskeleton
.
Cancer Lett
2009
;
284
:
122
30
.
35.
DiMilla
PA
,
Barbee
K
,
Lauffenburger
DA
. 
Mathematical model for the effects of adhesion and mechanics on cell migration speed
.
Biophys J
1991
;
60
:
15
37
.
36.
DiMilla
PA
,
Stone
JA
,
Quinn
JA
,
Albelda
SM
,
Lauffenburger
DA
. 
Maximal migration of human smooth muscle cells on fibronectin and type IV collagen occurs at an intermediate attachment strength
.
J Cell Biol
1993
;
122
:
729
37
.
37.
Pedersen
SF
,
Nilius
B
. 
Transient receptor potential channels in mechanosensing and cell volume regulation
.
Methods Enzymol
2007
;
428
:
183
207
.
38.
Jin
J
,
Desai
BN
,
Navarro
B
,
Donovan
A
,
Andrews
NC
,
Clapham
DE
. 
Deletion of Trpm7 disrupts embryonic development and thymopoiesis without altering Mg2 +homeostasis
.
Science
2008
;
322
:
756
60
.
39.
Clark
K
,
Langeslag
M
,
Figdor
CG
,
van Leeuwen
FN
. 
Myosin II and mechanotransduction: a balancing act
.
Trends Cell Biol
2007
;
17
:
178
86
.
40.
Jaalouk
DE
,
Lammerding
J
. 
Mechanotransduction gone awry
.
Nat Rev
2009
;
10
:
63
73
.