Cell survival after DNA damage relies on DNA repair, the abrogation of which causes genomic instability. The DNA repair protein RAD51 and the trans-lesion synthesis DNA polymerase REV1 are required for resistance to DNA interstrand cross-linking agents such as cisplatin. In this study, we show that overexpression of miR-96 in human cancer cells reduces the levels of RAD51 and REV1 and impacts the cellular response to agents that cause DNA damage. MiR-96 directly targeted the coding region of RAD51 and the 3′-untranslated region of REV1. Overexpression of miR-96 decreased the efficiency of homologous recombination and enhanced sensitivity to the PARP inhibitor AZD2281 in vitro and to cisplatin both in vitro and in vivo. Taken together, our findings indicate that miR-96 regulates DNA repair and chemosensitivity by repressing RAD51 and REV1. As a therapeutic candidate, miR-96 may improve chemotherapeutic efficacy by increasing the sensitivity of cancer cells to DNA damage. Cancer Res; 72(16); 4037–46. ©2012 AACR.

To preserve genomic stability, cells have developed an elaborate DNA damage response and repair network to fix DNA lesions that continuously arise due to exposure to endogenous or exogenous genotoxins (1). DNA repair plays a critical role in preventing the development of cancer, whereas defective DNA repair in cancer cells can be exploited for cancer therapy using DNA-damaging agents.

Interstrand DNA crosslink (ICL)-inducing agents, such as cisplatin, carboplatin, melphalan, cyclophosphamide, and mitomycin C are widely used for the treatment of cancer. Repair of ICLs requires the coordination of multiple DNA repair pathways including the Fanconi anemia pathway (2), translesion synthesis (TLS), homologous recombination (HR), and endonuclease-mediated DNA processing (3).

HR is the critical pathway for the repair of DNA double-strand breaks (DSBs) in S- and G2 phases of the cell cycle (4), and requires numerous factors including the recombinase RAD51 and the breast/ovarian cancer susceptibility gene products, BRCA1 and BRCA2. Tumors defective in HR, such as breast/ovarian cancers with BRCA1 or BRCA2 deficiency, are responsive to treatment with ICL-inducing agents as well as PARP inhibitors (5). TLS, carried out by a multitude of mutagenic DNA polymerases such as REV1 (6), protects the genome from large deletions by replicating across ICLs and other occluding lesions (3). Thus, targeting these DNA repair pathways involved in ICL repair is a logical strategy for overcoming cellular resistance to ICL-inducing agents (5, 7, 8). In addition, REV1-mediated TLS is an error prone process, which contributes to the mutagenic effects of many antitumor DNA-damaging agents and may play a critical role in the development of acquired chemoresistance (9). Therefore, inhibiting REV1-mediated TLS may prevent the emergence of chemoresistance.

MicroRNAs (miRNAs) are small noncoding RNAs that act as important regulators of gene expression. Aberrant expression of miRNAs is often seen in cancer (10). These cancer-related miRNAs can function as tumor suppressors or oncogenes and modulate many aspects of carcinogenesis, such as cell proliferation, cell-cycle control, apoptosis, metastasis, and angiogenesis (11). Some of these miRNAs can play important roles in the regulation of DNA repair and cellular sensitivity to DNA-damaging chemotherapeutics. For example, miR-210 and miR-373 target RAD52 and RAD23B, respectively, and may regulate nucleotide excision repair and HR in hypoxia (12). MiR-24 and miR-138 downregulate histone H2AX (13, 14), and miR-421 targets ATM kinase (15) to modulate cellular response to multiple DNA-damaging agents. Thus, these miRNAs may potentially be used as putative therapeutic agents that benefit cancer treatment.

The miR-183-96-182 polycistronic miRNA cluster is located at chromosome 7q32.2. Expression of miRNAs in this cluster is often increased in many common cancers, such as colon (16), lung (17), melanoma (18), breast (19), ovarian (20, 21), glioblastoma (22), prostate (23), liver (24), endometrial (25), bladder (26, 27), and germ cell (28) cancers, and may serve as potential tumor markers in multiple cancers (22, 23, 27). They are involved in the regulation of a wide range of cellular processes including cell proliferation (18, 19, 25, 29), senescence (30), cell migration (31, 32), and metastasis (18).

By conducting a cell-based miRNA library screen that uses ionizing radiation (IR)-induced RAD51 foci formation as a readout in U2OS cells (Huang and colleagues, manuscript in preparation), we have recently identified several miRNAs, including miR-96, as putative negative regulators of RAD51-mediated HR repair. Here, we show the functional roles of miR-96 in the regulation of DNA repair and chemosensitivity.

Cell lines

U2OS, HeLa, HCC1937, and MDA-MB-231 were purchased from the American Type Culture Collection. HCT116 was obtained from Clurman Lab [Fred Hutchinson Cancer Research Center (FHCRC), Seattle, WA]. BRCA2-deificient ovarian cancer cell line PEO1 and its BRCA2-proficient revertant PEO1 C4-2 were previously described (33). These cell lines have been tested and authenticated by short tandem repeat (STR) DNA profiling (Bio-Synthesis, Inc.) in May, 2012. HCC1937 cells were cultured in RPMI supplemented with 15% FBS, 2 mmol/L l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. All other cell lines were grown in Dulbecco's Modified Eagle's Medium supplemented with 10% FBS, 2 mmol/L l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells were all maintained in a humidified 5% CO2-containing atmosphere at 37°C.

Plasmids, siRNAs, miRNA mimics, miRNA inhibitors, and lentivirus production

3′-UTR (untranslated region) of human RAD51 (position 1–980 bp) and human REV1 (position 14–783 bp) was amplified by PCR and cloned into pGL3-control (Promega) to obtain pGL3-RAD51 3′UTR and pGL3-REV1 3′UTR plasmids. RAD51 MRE2 of miR-96 (position 1259–1346 bp of RAD51 mRNA) was amplified by PCR and cloned into pGl3-control vector. Putative-binding sites of miR-96 in RAD51 MRE2 and REV1 3′-UTR were mutated using the QuikChange Site-Direct Mutagenesis Kit (Stratagene). Plasmids were delivered into cells using TransIT-LT-1 reagent (Mirus). The coding sequence of RAD51 was PCR amplifed and cloned into pMMPpuro retroviral vector with a N-termimus DsRed signal to obtain pMMP-DsRed-RAD51 plasmid. The pLLEV-EGFP-REV1 lentiviral plasmid was kindly provided by Dr. Canman (University of Michigan Medical School, Ann Arbor, MI; ref. 7). MiR-96 and the spanning sequences (150 bp on each end) were amplified by PCR and inserted into pLemiR lentivrial vector (Open Biosystems) for generating miR-96 precursor. The plko1-shREV1 (5′- CCGGGCTGTTCGTATGGAAATCAAACTCGAGTTTGATTTCCATACGAACAGCTTTTTTG-3′) and shBRCA1 (5′-CCGGTATAAGACCTCTGGCATGAATCTCGAGATTCATGCCAGAGGTCTTATATTTTTG-3′) lentiviral vectors were purchased from Sigma. Retrovirus and lentivirus were produced as described (14).

Specific siRNAs were used to knock down REV1 (5′-ATCGGTGGAATCGGTTTGGAA-3′; ref. 7) and BRCA2 (5′-AACAACAATTACGAACCAAAC-3′; ref. 34; Qiagen). Transfection of siRNAs, miRNA mimics (Dharmacon) was done at 10 nmol/L using HiPerFect reagent (Qiagen). Transfection of miR-96 power inhibitor (Exiqon) was done at 25 nmol/L using Lipofectamine RNAiMax (Invitrogen). MiRNA mimic negative 2 control (miR-neg, Dharmacon), miRNA negative power inhibitor B (miR-neg inhibitor, Exiqon), or luciferase siRNA (siLuc, 5′-AACGTACGCGGAATACTTCGA-3′; Qiagen) served as negative controls.

Immunofluorescence microscopy

Cells treated with IR were fixed for immunofluorescent staining as described (14). Mouse anti-BRCA1 (D-9, 1:200; Santa Cruz) and RPA2 (NA18, 1:1,000; Calbiochem) and rabbit anti-RAD51 (H-92, 1:200; Santa Cruz) and FANCD2 (NB100-182, 1:2,000; Novus) were used as primary antibodies. Images were acquired with a microscope (TE2000, Nikon) and analyzed using MetaVue (Universal Imaging). About 200 cells per experimental point were scored for presence of foci.

Western blot analysis

SDS-PAGE was done with whole-cell extracts as described (14). Primary antibodies included mouse anti-BRCA1 (D-9, 1:200; Santa Cruz), Vinculin (V9131, 1:20,000; Sigma) and rabbit anti-RAD51 (H-92, 1:2,000; Santa Cruz), REV1 (sc-48806, 1:400; Santa Cruz), RAD51D (NB100-166, 1:2,000; Novus), RAD51C (NB100-177C2, 1:2,000; Novus), and Actin (Sc-1616-R, 1:10,000; Santa Cruz).

Real-time PCR

Total RNAs were extracted using Trizol reagent (Invitrogen) and reverse-transcribed using the Taqman microRNA Reverse Transcription Kit or the Taqman cDNA Reverse Transcription Kit (Applied Biosystems). The Taqman MiRNA Assay Kit or Gene Expression Kit was used for quantitative PCR (qPCR) reaction. The comparative Ct value was used for quantification of transcripts. RNU24 and 18S rRNA served as controls for miRNA and gene expression, respectively.

Cell-cycle analysis

Cells were pulse labeled with 30 μmol/L 5-bromo-2′-deoxyuridine (BrdU, Sigma) for 15 minutes and then fixed with 70% ice-cold ethanol. Cells were then stained for DNA content (propidium iodide) and BrdUrd incorporation with anti-BrdUrd rat monoclonal antibody (MAS250, Harlan Sera-Lab) followed by fluorescein isothiocynate-conjugated goat anti-rat antibody (Jackson ImmunoResearch). Flow cytometry analysis was then done to determine the distribution of cell cycle.

Homologous recombination assay

A U2OS cell clone stably expressing HR reporter direct repeat of GFP (U2OS DR-GFP) was a gift from Drs. Maria Jasin and Koji Nakanishi (35). U2OS DR-GFP cells were sequentially transfected with siRNAs or miRNA mimics and pCBASce vector. Two days later, cells were harvested and fixed for flow cytometry analysis as previously described (14). The percentages of GFP-positive cells in hemagluttinin (HA)-positive population were resulted from HR repair induced by DSBs.

Crystal violet assay

Cells were seeded onto 12-well plates at 1 × 104 cells/well and treated with cisplatin, paclitaxel (Sigma), or AZD2281 (Axon Medchem). After incubation for 5 to 7 days, monolayers were fixed and stained for determination of chemosensitivity as previously described (14). Cell survival was calculated by normalizing the absorbance to that of nontreated controls.

Clonogenic survival assay

Chemosensitivity was also determined by a standard clonogenic survival assay (36). Briefly, HeLa cells transfected with microRNA mimics were seeded in 6-well plates, treated with cisplatin for 24 hours, and then allowed to recover for 11 days. Cells were fixed and stained with crystal violet. Colonies with 50 cells or more were counted.

Luciferase assay

U2OS cells were cotransfected with miRNA mimics/inhibitors, pRL-TK Renilla plasmid, and pGL3-control firefly luciferase vectors containing empty, wild-type, or mutant RAD51 or REV1 3′-UTR sequence. Two days after transfection, cells were lysed for measurement of luciferase activities using the Dual-Luciferase Assay Kit (Promega). Relative luciferase activity was calculated by normalizing the ratio of Firefly/Renilla luciferase to that of negative control-transfected cells.

Xenograft mice study

MDA-MB-231 cells (1 × 106) stably infected with lentivirus producing control or pLemiR-96 were subcutaneously injected into the flank of 6 to 7 week old female nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice (NOD.Cg-Prkdc⁁(scid)il2rg⁁(tm1Wjl)/SzJ, FHCRC CCEMH). Mice were randomized into 2 groups (9 mice each) and injected with 20 mg/kg of cisplatin or PBS once the tumor was established (about 40 mm3). Tumor sizes were measured every 3 or 4 days after cisplatin treatment, and the volume was calculated using the formula: Volume = length × width2 × 0.52. TTV200 was the time of tumor volume reaching 200 mm3. The tumor growth delay was defined as: median of TTV200(treatment) − median of TTV200(PBS). All the animal work was approved by the FHCRC Institutional Animal Care and Use Committee.

Statistical analysis

All the statistic analyses were done with student t test (paired, 2-tail). All results were expressed as mean ± SD except for survival results (mean ± SE). P value < 0.05 was considered significant.

MiR-96 is a negative regulator of RAD51 foci formation

The 3 miRNAs of miR-183-96-182 cluster have similar but slightly different seed sequences (Supplementary Fig. S1A). We first evaluated the effect of these miRNAs on RAD51 foci formation following DNA damage individually. Ectopic expression of the miRNAs was confirmed by real-time (RT-PCR) in U2OS cells (Supplementary Fig. S1B). Overexpression of miR-96, but not miR-182 or miR-183, significantly reduced the percentage of cells with at least 10 RAD51 foci (Fig. 1A and B, 47% reduction, P < 0.05) and the average number of RAD51 foci per cell (Fig. 1C, P < 0.01) after treatment with IR. In contrast, none of the 3 miRNAs significantly affected IR-induced FANCD2, BRCA1, or RPA2 foci formation (Fig. 1B). Overexpression of miR-96 also modestly, but significantly, inhibited cisplatin-induced RAD51 foci formation (Supplementary Fig. S2). Overexpression of miR-96 had no significant effect on cell-cycle distribution (Fig. 1D), indicating that inhibition of RAD51 foci formation by miR-96 is not due to block of cell-cycle progression. Furthermore, overexpression of miR-96 significantly reduced the expression of RAD51 both at protein and mRNA levels in U2OS cells, whereas it had no effect on protein expression of BRCA1, BRCA2, RAD51C, and RAD51D (Fig. 1E and F). These findings suggest that inhibition of RAD51 foci by miR-96 is due to repression of RAD51 itself.

Figure 1.

MiR-96 inhibits DNA damage-induced RAD51 foci formation. A-C, U2OS cells were transfected with negative control (miR-neg) or miR-96 mimics (10 nmol/L), treated with ionizing radiation (IR; 10 Gy) and then fixed for immunofluorescent staining of RAD51, RPA2, FANCD2, or BRCA1 6 hours after IR. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). The representative images of RAD51 immunostaining were shown in A. Quantitation of relative percentage of cells with at least 10 foci (normalized to miR-neg-transfected cells) and average number of foci per cell were shown in B and C, respectively. Scale bar, 20 μm (mean ± SD, n = 3). D, U2OS cells were transfected with miR-neg, miR-96, or miR-16, a known cell-cycle regulator (49). After 48 hours, cells were processed for FACS analysis of cell-cycle profile. E and F, U2OS cells were transfected with miR-neg or miR-96 and cells were harvested 48 hours following transfection for Western blot analysis (E) or real-time RT-PCR.

Figure 1.

MiR-96 inhibits DNA damage-induced RAD51 foci formation. A-C, U2OS cells were transfected with negative control (miR-neg) or miR-96 mimics (10 nmol/L), treated with ionizing radiation (IR; 10 Gy) and then fixed for immunofluorescent staining of RAD51, RPA2, FANCD2, or BRCA1 6 hours after IR. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). The representative images of RAD51 immunostaining were shown in A. Quantitation of relative percentage of cells with at least 10 foci (normalized to miR-neg-transfected cells) and average number of foci per cell were shown in B and C, respectively. Scale bar, 20 μm (mean ± SD, n = 3). D, U2OS cells were transfected with miR-neg, miR-96, or miR-16, a known cell-cycle regulator (49). After 48 hours, cells were processed for FACS analysis of cell-cycle profile. E and F, U2OS cells were transfected with miR-neg or miR-96 and cells were harvested 48 hours following transfection for Western blot analysis (E) or real-time RT-PCR.

Close modal

MiR-96 inhibits HR and enhances cellular sensitivity to cisplatin and a PARP inhibitor

RAD51 plays a critical role in HR (37). Therefore, we examined the effect of miR-96 on HR by monitoring the population of GFP-positive cells in U2OS DR-GFP cells (35). As expected, depletion of BRCA2, a critical protein for loading RAD51 onto single-stranded DNA (ssDNA) at DSB sites (37), significantly reduced HR efficiency by 3.2 fold (Fig. 2A and B; 15.3% vs. 4.7%; P < 0.001). Overexpression of miR-96 led to a 2-fold reduction of HR activity (Fig. 2A and B; 15.7% vs. 7.4%; P < 0.001), indicating that miR-96 is a negative regulator of HR repair.

Figure 2.

MiR-96 inhibits HR and sensitizes U2OS cells to cisplatin and AZD2281. A and B, U2OS DR-GFP cells were sequentially transfected with miRNA mimics or siRNAs and HA-tagged pBASceI plasmid. Cells were incubated for 48 hours and then processed for FACS analysis of GFP-positive cells in HA-positive population (mean ± SD, n = 5). ***, P < 0.001. U2OS cells were transfected with miRNA mimics and reseeded 48 hours after transfection for cisplatin (C), and AZD2281 (D) sensitivity assays (mean ± SEM, n = 3). *, P < 0.05, **, P < 0.01, ***, P < 0.001.

Figure 2.

MiR-96 inhibits HR and sensitizes U2OS cells to cisplatin and AZD2281. A and B, U2OS DR-GFP cells were sequentially transfected with miRNA mimics or siRNAs and HA-tagged pBASceI plasmid. Cells were incubated for 48 hours and then processed for FACS analysis of GFP-positive cells in HA-positive population (mean ± SD, n = 5). ***, P < 0.001. U2OS cells were transfected with miRNA mimics and reseeded 48 hours after transfection for cisplatin (C), and AZD2281 (D) sensitivity assays (mean ± SEM, n = 3). *, P < 0.05, **, P < 0.01, ***, P < 0.001.

Close modal

HR-deficient cells are sensitive to cisplatin and PARP inhibitors (5, 38, 39). Consistent with the notion that miR-96 acts to suppress HR, miR-96-transfected U2OS cells were more sensitive to cisplatin (Fig. 2C) and a PARP inhibitor, AZD2281 (Fig. 2D), than control cells. Overexpression of miR-96 also reduced the expression of RAD51 in HeLa (cervical cancer cell) and BRCA2-proficient ovarian cancer cell line, PEO1 C4-2 (ref. 33; Supplementary Fig. S3C), and sensitized them to both cisplatin and AZD2281 (Supplementary Figs. S3A and S3B). Sensitization of HeLa cells to cisplatin by miR-96 overexpression was also confirmed in clonogenic survival assays (Supplementary Fig. S3D). Furthermore, delivery of miR-96 primary sequence using lentivirus (pLemiR-96) efficiently produced miR-96 in U2OS cells (Supplementary Fig. S3E) and rendered cells more sensitive to both cisplatin and AZD2281 compared to cells infected with control virus (pLemiR-NSC; Supplementary Figs. S3F and S3G). In contrast, overexpression of miR-96 did not sensitize U2OS cells to paclitaxel (Fig. S3H), a widely used chemotherapeutic agent that disrupts microtubule dynamics (40). Therefore, miR-96–mediated sensitization to cisplatin and a PARP inhibitor was not a result of general cellular toxicity.

Downregulation of RAD51 is critical for miR-96–mediated sensitization to a PARP inhibitor, but not to cisplatin

Next, we examined whether reduction of RAD51 expression by miR-96 is critical for cellular sensitivity to cisplatin and AZD2281 in U2OS cells. Overexpression of DsRed-tagged RAD51 (Fig. 3A) prevented miR-96–mediated sensitization to AZD2281 (Fig. 3B), suggesting that miR-96–mediated AZD2281 sensitivity is primarily a result of RAD51 reduction. However, to our surprise, overexpression of RAD51 had only a mild effect on cisplatin sensitivity in miR-96-overexpressing cells (Fig. 3C). This observation led us to hypothesize that miR-96–mediated cisplatin sensitivity is not simply due to defective HR repair mediated by RAD51 reduction. To test this hypothesis, we evaluated the effect of miR-96 on chemosensitivity in HR-deficient cells. ShRNA-mediated depletion of BRCA1, an important regulator of HR (41), significantly sensitized U2OS cells to both AZD2281 and cisplatin (Fig. 3D–3F). Overexpression of miR-96 further sensitized BRCA1-depleted U2OS cells to cisplatin (Fig. 3F), but not to AZD2281 (Fig. 3E). Furthermore, overexpression of miR-96 sensitized BRCA1-deficient breast cancer cell line HCC1937 (ref. 42; Supplementary Fig. S4A) and BRCA2-deficient ovarian cancer cell line PEO1 (ref. 33; Supplementary Fig. S4D) to cisplatin, but not to AZD2281 (Supplementary Fig. S4B and S4E). These findings support the notion that miR-96 overexpression sensitizes cells to cisplatin by inhibiting another mechanism of chemoresistance in addition to HR.

Figure 3.

Downregulation of RAD51 is critical for miR-96-mediated AZD2281 sensitivity, but not for cisplatin sensitivity. U2OS cells were infected with retrovirus expressing control (ctrl) or RAD51. After 72 hours, cells were reseeded and transfected with miR-neg or miR-96 mimics. After another 48 hours, cells were either reseeded for AZD2281 (B) and cisplatin (C) sensitivity assays (mean ± SEM, n = 3) or harvested for Western blot analysis (A). U2OS cells were infected with retrovirus producing shRNAs against control (ctrl) or BRCA1. After 72 hours, cells were reseeded and transfected with miR-neg or miR-96 mimics. After another 48 hours, cells were plated for AZD2281 (E) and cisplatin (F) sensitivity assays (mean ± SEM, n = 3) or harvested for Western blot analysis (D).

Figure 3.

Downregulation of RAD51 is critical for miR-96-mediated AZD2281 sensitivity, but not for cisplatin sensitivity. U2OS cells were infected with retrovirus expressing control (ctrl) or RAD51. After 72 hours, cells were reseeded and transfected with miR-neg or miR-96 mimics. After another 48 hours, cells were either reseeded for AZD2281 (B) and cisplatin (C) sensitivity assays (mean ± SEM, n = 3) or harvested for Western blot analysis (A). U2OS cells were infected with retrovirus producing shRNAs against control (ctrl) or BRCA1. After 72 hours, cells were reseeded and transfected with miR-neg or miR-96 mimics. After another 48 hours, cells were plated for AZD2281 (E) and cisplatin (F) sensitivity assays (mean ± SEM, n = 3) or harvested for Western blot analysis (D).

Close modal

Downregulation of REV1 is critical for miR-96–mediated cisplatin sensitization

To further explore the molecular mechanism responsible for miR-96–mediated cisplatin sensitization, we analyzed the predicted targets of miR-96 from 3 algorithms (MiRanda, TargetScan, and PicTar; Supplementary Table S1). Among the top 100 predicted targets by each algorithm, 55 genes were predicted by at least 2 algorithms (Supplementary Table S2). We focused on REV1, an error-prone Y-family DNA polymerase that is required for cellular resistance to cisplatin (7, 8). During ICL repair, REV1 initiates TLS across the unhooked ICLs followed by either HR-mediated repair or HR-independent repair (7, 8). As expected, REV1 expression was significantly reduced in miR-96-overexpressing U2OS cells as shown by both Western blot analysis and quantitative RT-PCR (qRT-PCR; Fig. 4A, B, and D, 3A and 3D). Overexpression of miR-96 also reduced the expression of REV1 in several other cancer cell lines [(HeLa, PEO1 C4-2 (Supplementary Fig. S3C), HCC1937 and PEO1 cells (Supplementary Fig. S4C and S4F)].

Figure 4.

Downregulation of REV1 is critical for miR-96-mediated cisplatin sensitivity. U2OS cells were transfected with miRNA mimics or infected with retrovirus producing shRNAs as indicated. After 72 hours, cells were harvested for Western blot analysis (A) and RT-PCR (B). C, U2OS cells expressing control or REV1 shRNAs were plated for cisplatin sensitivity assay (mean ± SEM, n = 3). U2OS cells were infected with lentivirus expressing control (ctrl) or RAD51 and REV1. After 72 hours, cells were reseeded and transfected with miR-neg or miR-96 mimics. After another 48 hours, cells were plated for cisplatin sensitivity assays (E; mean ± SEM, n = 3) or harvested for Western blot analysis (D). *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 4.

Downregulation of REV1 is critical for miR-96-mediated cisplatin sensitivity. U2OS cells were transfected with miRNA mimics or infected with retrovirus producing shRNAs as indicated. After 72 hours, cells were harvested for Western blot analysis (A) and RT-PCR (B). C, U2OS cells expressing control or REV1 shRNAs were plated for cisplatin sensitivity assay (mean ± SEM, n = 3). U2OS cells were infected with lentivirus expressing control (ctrl) or RAD51 and REV1. After 72 hours, cells were reseeded and transfected with miR-neg or miR-96 mimics. After another 48 hours, cells were plated for cisplatin sensitivity assays (E; mean ± SEM, n = 3) or harvested for Western blot analysis (D). *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

Depletion of REV1 significantly sensitized HR-proficient U2OS cells to cisplatin (Fig. 4C). It also increased cisplatin sensitivity in HR-deficient HCC1937 and PEO1 cells (Fig. S4A and S4D), implying that downregulation of REV1 may contribute to miR-96–mediated cisplatin sensitivity in HR-deficient background. Indeed, miR-96 had only very mild effect on cisplatin sensitivity in U2OS cells when both RAD51 and REV1 were ectopically overexpressed (Fig. 4D and E), suggesting that miR-96 regulates cisplatin sensitivity mainly by repressing RAD51 and REV1.

RAD51 and REV1 are direct targets of miR-96

The 3′UTR of RAD51 transcript contains a putative miR-96-binding site (RAD51 MRE1, Fig. 5A) predicted by prediction algorithms MiRanda and TargetScan (Supplementary Table S1), whereas the 3′UTR of REV1 transcript contains a putative miR-96-binding site (REV1 MRE, Fig. 5A) predicted by all 3 prediction algorithms (Supplementary Table S1). In addition, the coding region of RAD51 contains another putative miR-96-binding site (RAD51 MRE2, Fig. 5A). To show whether they are direct targets of miR-96, we cloned the 3′-UTR of either RAD51 or REV1 mRNA and the RAD51 MRE2 site with the surrounding sequences downstream of the open-reading frame of the luciferase gene of pGL3 vector (RAD51 3′UTR, REV1 3′UTR, and RAD51 MRE2; Fig. 5A and B) and cotransfected either of them with miR-96 or negative mimics into U2OS cells. Overexpression of miR-96 significantly downregulated luciferase activity of the construct fused with REV1 3′UTR without affecting that of the empty vector (Fig. 5C). Mutation of the potential miR-96-binding site in REV1 3′UTR (REV1 3′UTR mutant, Fig. 5B) completely abolished the inhibitory effect of miR-96 on luciferase activity (Fig. 5C), implying that REV1 mRNA is a direct target of miR-96.

Figure 5.

RAD51 and REV1 are direct targets of miR-96. A and B, putative miR-96 binding sites (wild-type and mutants) in the transcripts of RAD51 or REV1. C, wild-type or mutant RAD51 3′-UTR, RAD51 MRE2, or REV1 3′-UTR were cloned into the pGL3 vector, as 3′ fusions to the luciferase gene. U2OS were cotransfected with the indicated miRNA mimics and luciferase vectors. Luciferase activity was assayed 48 hours later and normalized to that of negative control-transfected cells (mean ± SD, n = 4). D, U2OS cells were cotransfected with plasmids and miRNA inhibitors (25 nmol/L) as indicated. Cells were lysed for luciferase assay 48 hours later. E, HCT116 cells were transfected with miRNA mimics or inhibitors. Cells were harvested for Western blot 72 hours after transfection. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

Figure 5.

RAD51 and REV1 are direct targets of miR-96. A and B, putative miR-96 binding sites (wild-type and mutants) in the transcripts of RAD51 or REV1. C, wild-type or mutant RAD51 3′-UTR, RAD51 MRE2, or REV1 3′-UTR were cloned into the pGL3 vector, as 3′ fusions to the luciferase gene. U2OS were cotransfected with the indicated miRNA mimics and luciferase vectors. Luciferase activity was assayed 48 hours later and normalized to that of negative control-transfected cells (mean ± SD, n = 4). D, U2OS cells were cotransfected with plasmids and miRNA inhibitors (25 nmol/L) as indicated. Cells were lysed for luciferase assay 48 hours later. E, HCT116 cells were transfected with miRNA mimics or inhibitors. Cells were harvested for Western blot 72 hours after transfection. *, P < 0.05, **, P < 0.01, ***, P < 0.001.

Close modal

Interestingly, miR-96 failed to affect luciferase activity of the construct containing RAD51 3′UTR (Fig. 5C), but significantly reduced that of the construct containing MRE2 (a potential miR-96-binding site in the coding region of RAD51; Fig. 5A and C). Mutation of the MRE2 abrogated the inhibitory effect of miR-96 on luciferase activity (Fig. 5C). Accordingly, overexpression of miR-96 caused a mild reduction of the ectopically expressed DsRed-tagged RAD51 (Fig. 3A, lane 3 vs. lane 4 and Fig. 4D, lane 1 vs. lane 2), which does not carry the 3′-UTR. These data suggest that RAD51 mRNA is also a direct target of miR-96.

MiR-96 is broadly conserved across many species (Supplementary Fig. S5) as are the miR-96-binding sites in RAD51 and REV1 transcripts (Supplementary Fig. S6), suggesting conservation of the trans-regulatory interactions between miR-96 and its targets, RAD51 and REV1.

Lastly, we examined whether REV1 and RAD51 are regulated by miR-96 at physiologic levels of miR-96 expression. Transfection of a miR-96-specific inhibitor eliminated miR-96–mediated reduction of luciferase activity of REV1-3′UTR reporter (Fig. 5D), suggesting that miR-96 was efficiently suppressed by this inhibitor. However, transfection of the miR-96 inhibitor only mildly upregulated the expression of REV1 and RAD51 in HCT116 cells (Fig. 5E). These results suggest that endogenous levels of miR-96 downregulate REV1 and RAD51 very mildly and that miR-96–mediated regulation is only one of the mechanisms that regulate REV1 and RAD51 expression.

MiR-96 enhances chemosensitivity in a xenograft model

To further show the role of miR-96 in chemosensitization, we tested the role of miR-96 on cisplatin sensitivity in a mice xenograft model. Tumorigenic MDA-MB-231 human breast cancer cells (43) were stably infected with lentivirus encoding either non-targeting control or miR-96 (Fig. 6A). Overexpression of miR-96 reduced the expression of REV1 and RAD51 in MDA-MB-231 cells (Fig. 6B), and mildly, but significantly, sensitized MDA-MB-231 cells to cisplatin in vitro (Fig. 6C). While cisplatin treatment or overexpression of miR-96 alone only modestly prevented the tumor growth of xenografted MDA-MB-231 cells (P > 0.05), overexpression of miR-96 strongly reduced tumor growth after cisplatin treatment during the 3-week observation period (Fig. 6D). Furthermore, combinational treatment with cisplatin and miR-96 also caused a 7-day growth delay of tumor volume reaching 200 mm3 (about 4 times of the volume before cisplatin treatment), whereas cisplatin or miR-96 alone elicited no and 3-day delay, respectively (Supplementary Fig. S7). These data support the notion that miR-96 is a potent cisplatin sensitizer in vivo.

Figure 6.

MiR-96 enhances cisplatin sensitivity in vivo. A, overexpression of miR-96 in MDA-MB-231 cells by lentiviral delivery of pLemiR-96. B, reduction of REV1 and RAD51 expression in MDA-MB-231 cells stably expressing miR-96. C, overexpression of miR-96 mildly sensitizes MDA-MB-231 cells to cisplatin during the 5-day in vitro survival assay (mean ± SEM, n = 3). D, MDA-MB-231 cells stably expressing miR-96 were injected into mice subcutaneously. After the tumor was established, mice were i.p. injected with 20 mg/kg cisplatin followed by monitoring of tumor size for 3 weeks (mean ± SEM, n = 9). *, P < 0.05; **, P < 0.01.

Figure 6.

MiR-96 enhances cisplatin sensitivity in vivo. A, overexpression of miR-96 in MDA-MB-231 cells by lentiviral delivery of pLemiR-96. B, reduction of REV1 and RAD51 expression in MDA-MB-231 cells stably expressing miR-96. C, overexpression of miR-96 mildly sensitizes MDA-MB-231 cells to cisplatin during the 5-day in vitro survival assay (mean ± SEM, n = 3). D, MDA-MB-231 cells stably expressing miR-96 were injected into mice subcutaneously. After the tumor was established, mice were i.p. injected with 20 mg/kg cisplatin followed by monitoring of tumor size for 3 weeks (mean ± SEM, n = 9). *, P < 0.05; **, P < 0.01.

Close modal

DNA-damaging agents are important therapeutic interventions for cancer therapy. However, their clinical use is sometimes limited due to acquired chemoresistance. In this study, we showed that miR-96 regulates DNA repair and chemosensitivity by suppressing the expression of two important DNA repair genes, RAD51 and REV1. The RAD51 recombinase promotes HR repair of DSBs and ICLs (37, 44). REV1-mediated TLS plays a critical role both in cellular resistance to ICL-inducing agents and in the development of acquired chemoresistance (9). Therefore, simultaneous inhibition of RAD51 and REV1 is a theoretically valid strategy to sensitize tumor cells to DNA-damaging agents and to prevent the development of chemoresistance, although there is a concern that this combination may also lead to toxicity in some normal tissues. Thus, miR-96, which downregulates both RAD51 and REV1, can be a potentially powerful therapeutic agent for improving the efficacy of conventional chemotherapy.

The miRNAs of the miR-183-96-182 cluster share similar seed sequences and have been reported to share the same targets such as Foxo1 (25, 29). However, we did not observe significant effects of miR-182 or miR-183 on either RAD51 foci formation (Fig. 1B and Supplementary Fig. S2) or cellular sensitivity to cisplatin or AZD2281 (Supplementary Fig. S8). These observations suggest that miR-96 is the critical miRNA of this cluster responsible for inhibition of DNA repair and chemosensitivity. During the preparation of this manuscript, Moskwa and colleagues reported that the miR-183-96-182 cluster miRNAs are rapidly reduced after IR treatment in HL-60 cells and MCF-7 cells and that overexpression of miR-182 inhibits HR by reducing BRCA1 expression (43). Consistent with this, we also found that expression of miR-96 was rapidly, but modestly, reduced in U2OS cells after IR (Supplementary Fig. S9). This in turn may allow efficient recruitment of DNA repair proteins (such as RAD51) to DNA-damage sites. However, we did not see a significant effect of miR-182 on BRCA1 expression in U2OS cells (Supplementary Fig. S10). This discrepancy may be due to different cell lines used in these studies, as function and targets of miRNAs can be context dependent (45). Nevertheless, both studies highlight the important roles of the miR-183-96-182 cluster in DNA repair and chemosensitivity.

The miR-183-96-182 cluster is located at chromosome 7q32, a region surrounded by multiple important oncogenes such as Met, CDK6, and BRAF (18). This region is often amplified in cancer and the miR-183-96-182 cluster miRNAs are upregulated in many cancers and can promote cell proliferation, migration, and metastasis by targeting multiple transcriptional factors (18, 19, 25, 29, 31, 32). Cooperation between miR-96–mediated DNA repair deficiency and the oncogenic properties of Met, CDK6, and BRAF may promote tumorigenesis. Inhibition of miR-96 mildly upregulated the expression of RAD51 and REV1 in some cancer cell lines (Fig. 5E), but the physiologic role of miR-96 in the regulation of DNA repair remains unclear and will require further investigation. Whether miR-96 expression levels can serve as a prognostic marker to predict the chemosensitivity of tumor is another important question to be addressed in the near future.

Importantly, multiple studies suggest that ectopic expression of the miR-183-96-182 cluster may have therapeutic potential, despite their oncogenic potential. Overexpression of miR-96 inhibits pancreatic cancer tumorigenesis by decreasing the expression of KRAS (46). Overexpression of miR-183 inhibits migration of breast cancer cells (31, 32), whereas overexpression of miR-182 suppresses the proliferation, migration, and invasion of lung cancer cells (47, 48). Our current study showed that overexpression of miR-96 caused a mild growth defect in multiple cell lines, such as U2OS (Supplementary Fig. S11) and in a xenograft model (Fig. 6D). Importantly, overexpression of miR-96 strongly potentiated the ability of cisplatin to inhibit tumor growth in vivo (Fig. 6D). All these studies support the idea that overexpression of miR-183-96-182 can shift their oncogenic roles towards tumor-suppressive functions, and that combining their expression with DNA-damaging agents may lead to substantial benefit for tumor management.

Taken together, miR-96 is an important regulator of DNA repair and a potential therapeutic agent (chemosensitizer) for cancer. Future studies will address whether miR-96 mimic may be useful as a chemosensitizer in therapy for certain types of cancer.

No potential conflicts of interest were disclosed.

Conception and design: Y. Wang, J.-W. Huang, P. Calses, T. Taniguchi

Development of methodology: Y. Wang, J.-W. Huang, P. Calses

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): Y. Wang, P. Calses, C.J. Kemp,

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): Y. Wang, T. Taniguchi

Writing, review, and/or revision of the manuscript: Y. Wang, J.-W. Huang, P. Calses, T. Taniguchi

Study supervision: P. Calses, T. Taniguchi

The authors thank Drs. Maria Jasin, Koji Nakanishi, Christine Canman, and Muneesh Tewari for reagents and Dr. Dipanjan Chowdhury for sharing the data. The authors also thank Drs. Muneesh Tewari and Ronald Cheung for critical reading of the manuscript, and the members of the FHCRC animal facility, Kemp Lab, Porter lab, and Swisher lab for materials and/or technical assistance, and all the members of Taniguchi lab for technical support and discussions.

This work was supported by Howard Hughes Medical Institute, the National Institutes of Health (NIH)/NHLBI (R21 HL092978 to T. Taniguchi), the NIH/NCI [R01 CA125636 to T. Taniguchi], Fanconi Anemia Research Fund (to T. Taniguchi), and NIH (P30 DK56465 to Y. Wang and T. Taniguchi). J.-W. Huang and P. Calses. are supported by PHS NRSA 2T32 GM007270 from NIGMS. Y. Wang is a research fellow supported by Canadian Institute of Health Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Ciccia
A
,
Elledge
SJ
. 
The DNA damage response: making it safe to play with knives
.
Mol Cell
2010
;
40
:
179
204
.
2.
Kee
Y
,
D'Andrea
AD
. 
Expanded roles of the Fanconi anemia pathway in preserving genomic stability
.
Genes Dev
2010
;
24
:
1680
94
.
3.
Muniandy
PA
,
Liu
J
,
Majumdar
A
,
Liu
ST
,
Seidman
MM
. 
DNA interstrand crosslink repair in mammalian cells: step by step
.
Crit Rev Biochem Mol Biol
2010
;
45
:
23
49
.
4.
Mao
Z
,
Bozzella
M
,
Seluanov
A
,
Gorbunova
V
. 
DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells
.
Cell Cycle
2008
;
7
:
2902
6
.
5.
Farmer
H
,
McCabe
N
,
Lord
CJ
,
Tutt
AN
,
Johnson
DA
,
Richardson
TB
, et al
Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy
.
Nature
2005
;
434
:
917
21
.
6.
Livneh
Z
,
Ziv
O
,
Shachar
S
. 
Multiple two-polymerase mechanisms in mammalian translesion DNA synthesis
.
Cell Cycle
2010
;
9
:
729
35
.
7.
Hicks
JK
,
Chute
CL
,
Paulsen
MT
,
Ragland
RL
,
Howlett
NG
,
Gueranger
Q
, et al
Differential roles for DNA polymerases eta, zeta, and REV1 in lesion bypass of intrastrand versus interstrand DNA cross-links
.
Mol Cell Biol
2010
;
30
:
1217
30
.
8.
Ho
TV
,
Scharer
OD
. 
Translesion DNA synthesis polymerases in DNA interstrand crosslink repair
.
Environ Mol Mutagen
2010
;
51
:
552
66
.
9.
Xie
K
,
Doles
J
,
Hemann
MT
,
Walker
GC
. 
Error-prone translesion synthesis mediates acquired chemoresistance
.
Proc Natl Acad Sci U S A
2010
;
107
:
20792
7
.
10.
Trang
P
,
Weidhaas
JB
,
Slack
FJ
. 
MicroRNAs as potential cancer therapeutics
.
Oncogene
2008
;
27
Suppl 2
:
S52
7
.
11.
Shenouda
SK
,
Alahari
SK
. 
MicroRNA function in cancer: oncogene or a tumor suppressor?
Cancer Metastasis Rev
2009
;
28
:
369
78
.
12.
Crosby
ME
,
Kulshreshtha
R
,
Ivan
M
,
Glazer
PM
. 
MicroRNA regulation of DNA repair gene expression in hypoxic stress
.
Cancer Res
2009
;
69
:
1221
9
.
13.
Lal
A
,
Pan
Y
,
Navarro
F
,
Dykxhoorn
DM
,
Moreau
L
,
Meire
E
, et al
miR-24-mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells
.
Nat Struct Mol Biol
2009
;
16
:
492
8
.
14.
Wang
Y
,
Huang
JW
,
Li
M
,
Cavenee
WK
,
Mitchell
PS
,
Zhou
X
, et al
MicroRNA-138 modulates DNA damage response by repressing histone H2AX expression
.
Mol Cancer Res
2011
;
9
:
1100
11
.
15.
Hu
H
,
Du
L
,
Nagabayashi
G
,
Seeger
RC
,
Gatti
RA
. 
ATM is down-regulated by N-Myc-regulated microRNA-421
.
Proc Natl Acad Sci U S A
2010
;
107
:
1506
11
.
16.
Sarver
AL
,
French
AJ
,
Borralho
PM
,
Thayanithy
V
,
Oberg
AL
,
Silverstein
KA
, et al
Human colon cancer profiles show differential microRNA expression depending on mismatch repair status and are characteristic of undifferentiated proliferative states
.
BMC Cancer
2009
;
9
:
401
.
17.
Nymark
P
,
Guled
M
,
Borze
I
,
Faisal
A
,
Lahti
L
,
Salmenkivi
K
, et al
Integrative analysis of microRNA, mRNA and aCGH data reveals asbestos- and histology-related changes in lung cancer
.
Genes Chromosomes Cancer
2011
;
50
:
585
97
.
18.
Segura
MF
,
Hanniford
D
,
Menendez
S
,
Reavie
L
,
Zou
X
,
Alvarez-Diaz
S
, et al
Aberrant miR-182 expression promotes melanoma metastasis by repressing FOXO3 and microphthalmia-associated transcription factor
.
Proc Natl Acad Sci U S A
2009
;
106
:
1814
9
.
19.
Lin
H
,
Dai
T
,
Xiong
H
,
Zhao
X
,
Chen
X
,
Yu
C
, et al
Unregulated miR-96 induces cell proliferation in human breast cancer by downregulating transcriptional factor FOXO3a
.
PLoS One
2011
;
5
:
e15797
.
20.
Zhang
L
,
Volinia
S
,
Bonome
T
,
Calin
GA
,
Greshock
J
,
Yang
N
, et al
Genomic and epigenetic alterations deregulate microRNA expression in human epithelial ovarian cancer
.
Proc Natl Acad Sci U S A
2008
;
105
:
7004
9
.
21.
Vaksman
O
,
Stavnes
HT
,
Kaern
J
,
Trope
CG
,
Davidson
B
,
Reich
R
. 
miRNA profiling along tumour progression in ovarian carcinoma
.
J Cell Mol Med
2011
;
15
:
1593
602
.
22.
Jiang
L
,
Mao
P
,
Song
L
,
Wu
J
,
Huang
J
,
Lin
C
, et al
miR-182 as a prognostic marker for glioma progression and patient survival
.
Am J Pathol
2010
;
177
:
29
38
.
23.
Schaefer
A
,
Jung
M
,
Mollenkopf
HJ
,
Wagner
I
,
Stephan
C
,
Jentzmik
F
, et al
Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma
.
Int J Cancer
2010
;
126
:
1166
76
.
24.
Pineau
P
,
Volinia
S
,
McJunkin
K
,
Marchio
A
,
Battiston
C
,
Terris
B
, et al
miR-221 overexpression contributes to liver tumorigenesis
.
Proc Natl Acad Sci U S A
2010
;
107
:
264
9
.
25.
Myatt
SS
,
Wang
J
,
Monteiro
LJ
,
Christian
M
,
Ho
KK
,
Fusi
L
, et al
Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer
.
Cancer Res
2010
;
70
:
367
77
.
26.
Han
Y
,
Chen
J
,
Zhao
X
,
Liang
C
,
Wang
Y
,
Sun
L
, et al
MicroRNA expression signatures of bladder cancer revealed by deep sequencing
.
PLoS One
2011
;
6
:
e18286
.
27.
Yamada
Y
,
Enokida
H
,
Kojima
S
,
Kawakami
K
,
Chiyomaru
T
,
Tatarano
S
, et al
MiR-96 and miR-183 detection in urine serve as potential tumor markers of urothelial carcinoma: correlation with stage and grade, and comparison with urinary cytology
.
Cancer Sci
2011
;
102
:
522
9
.
28.
Palmer
RD
,
Murray
MJ
,
Saini
HK
,
van Dongen
S
,
Abreu-Goodger
C
,
Muralidhar
B
, et al
Malignant germ cell tumors display common microRNA profiles resulting in global changes in expression of messenger RNA targets
.
Cancer Res
2010
;
70
:
2911
23
.
29.
Guttilla
IK
,
White
BA
. 
Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells
.
J Biol Chem
2009
;
284
:
23204
16
.
30.
Li
G
,
Luna
C
,
Qiu
J
,
Epstein
DL
,
Gonzalez
P
. 
Alterations in microRNA expression in stress-induced cellular senescence
.
Mech Ageing Dev
2009
;
130
:
731
41
.
31.
Lowery
AJ
,
Miller
N
,
Dwyer
RM
,
Kerin
MJ
. 
Dysregulated miR-183 inhibits migration in breast cancer cells
.
BMC Cancer
2010
;
10
:
502
.
32.
Sarver
AL
,
Li
L
,
Subramanian
S
. 
MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration
.
Cancer Res
2010
;
70
:
9570
80
.
33.
Sakai
W
,
Swisher
EM
,
Jacquemont
C
,
Chandramohan
KV
,
Couch
FJ
,
Langdon
SP
, et al
Functional restoration of BRCA2 protein by secondary BRCA2 mutations in BRCA2-mutated ovarian carcinoma
.
Cancer Res
2009
;
69
:
6381
6
.
34.
Sakai
W
,
Swisher
EM
,
Karlan
BY
,
Agarwal
MK
,
Higgins
J
,
Friedman
C
, et al
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
.
Nature
2008
;
451
:
1116
20
.
35.
Weinstock
DM
,
Nakanishi
K
,
Helgadottir
HR
,
Jasin
M
. 
Assaying double-strand break repair pathway choice in mammalian cells using a targeted endonuclease or the RAG recombinase
.
Methods Enzymol
2006
;
409
:
524
40
.
36.
Franken
NA
,
Rodermond
HM
,
Stap
J
,
Haveman
J
,
van Bree
C
. 
Clonogenic assay of cells in vitro
.
Nat Protoc
2006
;
1
:
2315
9
.
37.
Holloman
WK
. 
Unraveling the mechanism of BRCA2 in homologous recombination
.
Nat Struct Mol Biol
2011
;
18
:
748
54
.
38.
Raschle
M
,
Knipscheer
P
,
Enoiu
M
,
Angelov
T
,
Sun
J
,
Griffith
JD
, et al
Mechanism of replication-coupled DNA interstrand crosslink repair
.
Cell
2008
;
134
:
969
80
.
39.
Lord
CJ
,
McDonald
S
,
Swift
S
,
Turner
NC
,
Ashworth
A
. 
A high-throughput RNA interference screen for DNA repair determinants of PARP inhibitor sensitivity
.
DNA Repair (Amst)
2008
;
7
:
2010
9
.
40.
Jordan
A
,
Hadfield
JA
,
Lawrence
NJ
,
McGown
AT
. 
Tubulin as a target for anticancer drugs: agents which interact with the mitotic spindle
.
Med Res Rev
1998
;
18
:
259
96
.
41.
Moynahan
ME
,
Chiu
JW
,
Koller
BH
,
Jasin
M
. 
Brca1 controls homology-directed DNA repair
.
Mol Cell
1999
;
4
:
511
8
.
42.
Scully
R
,
Ganesan
S
,
Vlasakova
K
,
Chen
J
,
Socolovsky
M
,
Livingston
DM
. 
Genetic analysis of BRCA1 function in a defined tumor cell line
.
Mol Cell
1999
;
4
:
1093
9
.
43.
Moskwa
P
,
Buffa
FM
,
Pan
Y
,
Panchakshari
R
,
Gottipati
P
,
Muschel
RJ
, et al
miR-182-mediated downregulation of BRCA1 impacts DNA repair and sensitivity to PARP inhibitors
.
Mol Cell
2011
;
41
:
210
20
.
44.
Long
DT
,
Raschle
M
,
Joukov
V
,
Walter
JC
. 
Mechanism of RAD51-dependent DNA interstrand cross-link repair
.
Science
2011
;
333
:
84
7
.
45.
Liu
H
,
Kohane
IS
. 
Tissue and process specific microRNA-mRNA co-expression in mammalian development and malignancy
.
PLoS One
2009
;
4
:
e5436
.
46.
Yu
S
,
Lu
Z
,
Liu
C
,
Meng
Y
,
Ma
Y
,
Zhao
W
, et al
miRNA-96 suppresses KRAS and functions as a tumor suppressor gene in pancreatic cancer
.
Cancer Res
2010
;
70
:
6015
25
.
47.
Zhang
L
,
Liu
T
,
Huang
Y
,
Liu
J
. 
microRNA-182 inhibits the proliferation and invasion of human lung adenocarcinoma cells through its effect on human cortical actin-associated protein
.
Int J Mol Med
2011
;
28
:
381
8
.
48.
Sun
Y
,
Fang
R
,
Li
C
,
Li
L
,
Li
F
,
Ye
X
, et al
Hsa-mir-182 suppresses lung tumorigenesis through down regulation of RGS17 expression in vitro
.
Biochem Biophys Res Commun
2010
;
396
:
501
7
.
49.
Takeshita
F
,
Patrawala
L
,
Osaki
M
,
Takahashi
RU
,
Yamamoto
Y
,
Kosaka
N
, et al
Systemic delivery of synthetic microRNA-16 inhibits the growth of metastatic prostate tumors via downregulation of multiple cell-cycle genes
.
Mol Ther
2010
;
18
:
181
7
.