The importance of microenvironmental factors for driving progression in leukemia has been debated. Previous evidence has pointed to interleukin-7 (IL-7), a fundamental cytokine to normal T-cell development and homeostasis, as an important determinant of the viability and proliferation of T-cell acute lymphoblastic leukemia (T-ALL) cells in vitro. In this study, we report that IL-7 is also a critical determinant of T-ALL progression. T-ALL cell lines and primary T-ALL samples initiated leukemia more slowly when engrafted to immunocompromised Rag2−/−IL2rg−/− mice lacking IL-7. This effect was not related to reduced engraftment or homing of transplanted cells to the bone marrow. Instead, IL-7 deficiency diminished expansion of leukemia cells in the bone marrow and delayed leukemia-associated death of transplanted mice. Moreover, infiltration of different organs by T-ALL cells, which characterizes patients with advanced disease, was more heterogeneous and generally less efficient in IL-7–deficient mice. Leukemia progression was associated with increased Bcl-2 expression and cell viability, reduced p27Kip1 expression, and decreased cell-cycle progression. Clinical measurements of IL-7 plasma levels and IL-7 receptor (IL-7R) expression in T-ALL patients versus healthy controls confirmed that IL-7 stimulates human leukemia cells. Our results establish that IL-7 contributes to the progression of human T-cell leukemia, and they offer preclinical validation of the concept that targeting IL-7/IL-7R signaling in the tumor microenvironment could elicit therapeutic effects in T-ALL. Cancer Res; 71(14); 4780–9. ©2011 AACR.

Interleukin-7 (IL-7) is essential for normal T-cell development and homeostasis. Paradoxically, several lines of evidence indicate that the IL-7/IL-7 receptor (IL-7R) axis may also play a significant role in promoting leukemogenesis. IL-7 can act as an oncogene in vivo, as IL-7 transgenic mice develop B- and T-cell lymphomas (1, 2), and murine thymocytes spontaneously overexpressing IL-7R have a selective advantage that contributes to proliferation and leukemogenesis (3). IL-7 is produced by bone marrow and thymic stroma (4–7), suggesting that IL-7 is present in the microenvironments where leukemia cells develop, thus having the potential to directly modulate leukemia growth. In vitro studies have shown that thymic epithelium and bone marrow stromal cells promote survival of T-cell acute lymphoblastic leukemia (T-ALL) cells via production of IL-7 (8, 9). Importantly, IL-7 induces in vitro proliferation of the majority (>70%) of primary T-ALL samples (10, 11). IL-7 promotes cell-cycle progression and viability of T-ALL cells via activation of the phosphoinositide-3-kinase (PI3K)/protein kinase B (PKB)/Akt signaling pathway (12), resulting in downregulation of the cdk inhibitor p27Kip1 and upregulation of Bcl-2 (13). Remarkably, IL-7 may contribute to resistance to treatment with rapamycin in ALL in general (14) and to imatinib in Bcr/Abl+Arf ALL (15, 16). However, these observations are counterweighted by the understanding that most malignant cells proliferate independently of external cues. Furthermore, although IL-7 may have a significant impact on some primary T-ALL cells cultured in vitro under conditions of growth factor paucity, it is possible that IL-7 has only a redundant effect on leukemia expansion in vivo, given the diversity of other survival and proliferative signals present in the tumor milieu.

In the present study, we sought to clarify the importance of IL-7 for the progression of human T-ALL in vivo, using a combination of xenotransplant mouse models of human leukemia and analysis of primary T-ALL specimens collected directly from patients. Our results indicate that IL-7 is consumed by and stimulates human T-ALL cells in vivo. IL-7 induces p27Kip1 downregulation and Bcl-2 upregulation in T-ALL cells, promotes their viability and proliferation, and contributes to leukemia progression. Our data support the notion that microenvironmental cues, produced in a nonautocrine fashion, can partake in leukemia development.

Cells

Primary T-ALL cells were collected from peripheral blood or bone marrow of patients at diagnosis as described previously (17). Normal thymocytes were isolated from thymic tissue obtained from children undergoing cardiac surgery. Informed consent and Institutional Review Board approval were obtained for all primary leukemia and thymic sample collections. The IL-7–dependent T-ALL cell line TAIL7 was established by our group, and it is regularly tested by flow cytometry and PCR (18). TAIL7 cells share significant similarities with primary leukemic samples (18). The growth factor–independent T-ALL cell line HPB-ALL expresses the IL-7R and responds to IL-7. P12-ICHIKAWA is a growth factor–independent IL-7R–negative T-ALL cell line. Both cell lines were from a cell bank and characterized as specified (19). HPB-ALL cells were stably transduced with lentiviral vectors, kindly provided by Dr. Luigi Naldini (San Raffaele Scientific Institute, Milan, Italy; 20), driving the expression of luciferase and GFP (HPB-ALL.Luc.GFP). Primary T-ALL samples and cell lines were immunophenotyped using standard techniques (21) and their maturation stage was classified according to the European Group for the Immunological Classification of Leukemias (EGIL) criteria (ref. 22; Table 1).

Table 1.

Immunophenotype and maturation stage of primary T-ALL samples and cell lines

CD1aCD2CD3cCD3CD5CD7CD4CD8IL-7RαMaturation stage
Pt#1 − III (cortical) 
Pt#2 − − − IV (mature) 
TAIL7 − − II (pre-T) 
HPB-ALL III (cortical) 
P12 − − − III (cortical) 
CD1aCD2CD3cCD3CD5CD7CD4CD8IL-7RαMaturation stage
Pt#1 − III (cortical) 
Pt#2 − − − IV (mature) 
TAIL7 − − II (pre-T) 
HPB-ALL III (cortical) 
P12 − − − III (cortical) 

NOTE: Maturation stages were defined according to the EGIL criteria (see Materials and Methods). Plus sign indicates >30% positive cells; minus sign indicates <30% positive cells, except for IL-7Rα, where minus sign indicates <3% positive cells.

Abbreviations: cCD3, cytoplasmic CD3; Pt, patient.

Xenotransplantation

Protocols and studies involving animals were conducted in accordance with the UK Home Office regulation and local guidelines. Rag2−/−, Il2rg−/−, and Il7−/− strains were obtained from The Jackson Laboratory and intercrossed to generate compound knockouts required for this study. Il7−/−Il2rg−/−Rag2−/− and Il2rg−/−Rag2−/− strains were both on C57Bl6/j background. Strains were bred in specific pathogen-free facilities at the National Institute for Medical Research (London, UK), Instituto Gulbenkian de Ciência (Oeiras, Portugal), and Instituto de Medicina Molecular (Lisbon, Portugal). HPB-ALL.Luc.GFP, TAIL7, P12, and primary T-ALL cells (5 × 106 to 2 × 107 cells) were injected i.v. in a final volume of 250 μL per injection. Mice were sacrificed when moribund or at the indicated time points. Organs were collected for postmortem analysis. Mice were classified as leukemic when T-ALL cells represented more than 20% of the bone marrow cellularity, according to the clinical definition of human leukemia (23). We further classified mice as preleukemic (<20% and >0.1% malignant cells in the bone marrow) and nonleukemic (>0.1%).

In vivo bioluminescence imaging

Mice were intraperitoneally (i.p.) injected with 150 μg luciferin/g, anaesthetized, and scanned with an IVIS Lumina bioimaging device (Caliper Life Sciences). Mice were imaged after 7 minutes and total flux (photons per second) was calculated using Living Image software (Caliper Life Sciences).

Blood and organ analysis

For flow cytometric analysis, collected blood was depleted of erythrocytes by using red blood cell lysis buffer (BD Pharmingen). Bone marrow was extracted by flushing off bones. Spleen, liver, and kidneys were mechanically disintegrated into single-cell suspensions, which were then washed in PBS, stained for 45 minutes at 4°C with monoclonal antibody for human CD2 or CD5 (Becton Dickson), and analyzed using a FACSCalibur flow cytometer (Becton Dickinson) and FlowJo software (Tree Star). For histology analysis, small representative portions of the collected organs (spleen, liver, and kidneys) and at least 1 complete femur were preserved in formalin at 4°C for 24 to 48 hours with hematoxylin/eosin staining.

CFSE labeling for analysis of engraftment efficiency

TAIL7 cells (10 × 106 cells/mL) were incubated for 10 minutes at 37°C with 2 μmol/L of carboxyfluorescein succinimidyl ester (CFSE; Sigma-Aldrich). Cells were washed 3 times in culture medium, resuspended as 107 cells/250 μL in Iscove's modified Dulbecco's medium/bovine serum albumin, and injected i.v. into mice.

Intracellular staining

Bone marrow cells were stained with anti-human CD2-PE- or CD5-fluorescein isothiocyanate (FITC)-conjugated antibodies, fixed in 1× Fix/Perm solution (eBioscience) for 30 minutes at 4°C, washed in PBS, and resuspended in 1× Permeabilization Buffer (eBioscience) for 10 minutes at 4°C. Samples were stained for 30 minutes at 4°C with anti-Bcl-2-FITC antibody (Dako), anti-Ki-67-PE antibody (Becton-Dickinson), or with irrelevant isotype-matched antibody. For viability analysis, bone marrow cells were surface stained for human CD5-FITC, washed and resuspended in 1× binding buffer, and stained with Annexin V–phycoerythrin (PE). Samples were washed and analyzed by flow cytometry. Results were expressed as the percentage of positive cells in comparison with the negative control and as specific mean intensity of fluorescence (MIF).

Immunoblotting

Cell lysates were resolved by 10% SDS-PAGE, transferred onto nitrocellulose membranes, and immunoblotted with antibodies against ZAP-70 (Upstate) or p27Kip1 (Santa Cruz Biotechnology). Immunodetection was carried out by incubation with horseradish peroxidase–conjugated anti-mouse or anti-rabbit IgG (Promega) and developed by enhanced chemiluminescence (Amersham-Pharmacia).

Quantitative reverse transcriptase PCR

Total RNA (1 μg) was reverse transcribed using the ImProm II Reverse Transcriptase enzyme (Promega) and random hexamers. The quantitative assessment of IL7RA transcripts was made by SYBR green-based quantitative reverse transcriptase PCR (qRT-PCR) on an ABI PRISM 7500 (Applied Biosystems) with the following primers: ABL, TGGAGATAACACTCTAAGCATAACTAAAGGT and GATGTAGTTGCTTGGGACCCA; and IL7R, GGATTAAGCCTATCGTATGGC (exon 7) and GCTTGAATGTCATCCACCCT (exon 8). Standard curves were obtained by serial dilutions of PCR products, and IL7RA transcript values were normalized with respect to the number of ABL transcripts.

IL-7 plasma quantifications

Human IL-7 levels were quantified in plasma, using the high sensitivity IL-7 Quantikine HS Elisa kit (R&D) according to the manufacturer's instructions. Samples were assayed in duplicate.

Ex vivo assessment of IL-7Rα expression in primary T-ALL cells

Primary T-ALL cells were cultured in 24-well plates as 2 × 106cells/mL at 37°C with 5% CO2 in RPMI-1640 medium supplemented with 10% FBS (Invitrogen Corporation), with or without 10 ng/mL hIL-7 (Peprotech EC). Immediately ex vivo (0 hour) and at 24 hours of culture, cells were stained with IL-7Rα-PE (R&D) analyzed by flow cytometry.

Statistical analysis

Log-rank test, Student t test, Mann–Whitney test, and 2-way ANOVA were used to compare data, as appropriate (P < 0.05 was considered significant).

IL-7 accelerates leukemia expansion and leukemia-related death in mice xenotransplanted with human T-ALL cell lines

Although transgenic mouse models of leukemia provide valuable insights into the mechanisms of leukemogenesis, in vivo studies using primary human leukemia cells may help elucidate processes unique to human disease. Both recombinant IL-7 and endogenously produced murine IL-7 are bioactive upon human lymphocytes, including T-ALL cells (24, 25). Therefore, we sought to test the in vivo effects of microenvironmental IL-7 on human T-ALL development by xenogeneic transplantation of leukemia cells into Rag2−/Il2rg−/ hosts differing exclusively in the capacity to produce IL-7. In the absence of Rag2 recombinase and the IL-2 common γ-chain, these hosts lack T, B, and natural killer (NK) cells and therefore tolerate T-ALL transplantation. HPB-ALL T-ALL cells stably expressing luciferase and eGFP (HPB-ALL.Luc.GFP) were transplanted i.v. into Rag2−/Il2rg−/ [IL-7 wild-type (WT)] and Rag2−/Il2rg−/Il7−/ [IL-7 knockout (KO)] mice. Five weeks (35 days) posttransplantation, mice were injected with luciferin to assess tumor burden and localization by whole-body bioluminescence imaging. IL-7 WT animals displayed strikingly stronger and more disseminated luciferase activity (Fig. 1A, left). Quantification of bioluminescence intensity confirmed that the tumor burden was significantly higher in IL-7 WT mice (Fig. 1A, right). Analysis of sacrificed animals showed that the lungs, spleen, liver, kidneys, and bone marrow were infiltrated with HPB-ALL.Luc.GFP cells (data not shown). These data suggested that absence of IL-7 delayed disease progression and dissemination in vivo.

Figure 1.

IL-7 accelerates leukemia expansion and leukemia-related death in mice xenotransplanted with human T-ALL cell lines. A, Rag2−/−Il2rg−/− mice, either Il7+/+ (IL-7 WT; n = 3) or Il7−/− (IL-7 KO; n = 3), were injected i.v. with 107 HPB-ALL.Luc.GFP cells and analyzed 5 weeks posttransplantation. Animals were injected i.p. with 150 μg luciferin/g 7 minutes before imaging and ventrally scanned for total-body luminescence (total flux), with a medium binning 3-minute exposure, using IVIS Lumina and Living Image software. Images on the left are overlays of the luciferase signal with photographs of each animal. Corresponding bioluminescence values are represented as mean ± SEM in the graph on the right (P = 0.0245; Student t test). B–E, IL-7 WT (black; n = 9) or IL-7 KO (red; n = 10) mice were injected i.v. with 107 TAIL7 cells. B, human leukemia cells were monitored in the blood through time by flow cytometric analysis with an anti-human CD2 antibody. Differences between IL-7 WT and IL-7 KO groups were statistically significant (P = 0.0047; 2-way ANOVA). C, animals were sacrificed 84 days posttransplantation, and bone marrow infiltration of TAIL7 cells was evaluated as described in the Materials and Methods. Animals were classified as leukemic if presenting more than 20% T-ALL cells in the bone marrow, preleukemic if 20% or less, and nonleukemic if less than 0.1%. D, infiltration of TAIL7 cells in the spleen was analyzed at the same time point (P = 0.0782; Mann–Whitney test). Lines indicate median values of each group. E, survival of TAIL7-transplanted IL-7 WT (n = 8) and IL-7 KO mice (n = 14) was compared. Kaplan–Meier survival curves are indicated. Disease progression was significantly accelerated in IL-7 WT mice (P = 0.0023; log-rank test). Experiments in A and E were carried out once. Results in B–D are representative of 3 independent experiments.

Figure 1.

IL-7 accelerates leukemia expansion and leukemia-related death in mice xenotransplanted with human T-ALL cell lines. A, Rag2−/−Il2rg−/− mice, either Il7+/+ (IL-7 WT; n = 3) or Il7−/− (IL-7 KO; n = 3), were injected i.v. with 107 HPB-ALL.Luc.GFP cells and analyzed 5 weeks posttransplantation. Animals were injected i.p. with 150 μg luciferin/g 7 minutes before imaging and ventrally scanned for total-body luminescence (total flux), with a medium binning 3-minute exposure, using IVIS Lumina and Living Image software. Images on the left are overlays of the luciferase signal with photographs of each animal. Corresponding bioluminescence values are represented as mean ± SEM in the graph on the right (P = 0.0245; Student t test). B–E, IL-7 WT (black; n = 9) or IL-7 KO (red; n = 10) mice were injected i.v. with 107 TAIL7 cells. B, human leukemia cells were monitored in the blood through time by flow cytometric analysis with an anti-human CD2 antibody. Differences between IL-7 WT and IL-7 KO groups were statistically significant (P = 0.0047; 2-way ANOVA). C, animals were sacrificed 84 days posttransplantation, and bone marrow infiltration of TAIL7 cells was evaluated as described in the Materials and Methods. Animals were classified as leukemic if presenting more than 20% T-ALL cells in the bone marrow, preleukemic if 20% or less, and nonleukemic if less than 0.1%. D, infiltration of TAIL7 cells in the spleen was analyzed at the same time point (P = 0.0782; Mann–Whitney test). Lines indicate median values of each group. E, survival of TAIL7-transplanted IL-7 WT (n = 8) and IL-7 KO mice (n = 14) was compared. Kaplan–Meier survival curves are indicated. Disease progression was significantly accelerated in IL-7 WT mice (P = 0.0023; log-rank test). Experiments in A and E were carried out once. Results in B–D are representative of 3 independent experiments.

Close modal

To confirm these observations, we used TAIL7 cells, which are IL-7-dependent in vitro and constitute a model for primary T-ALL (18). First, we transplanted CFSE-labeled TAIL7 cells into IL-7 WT and IL-7 KO mice and evaluated engraftment 6 hours after i.v. injection. Analysis of the bone marrow revealed the presence of very few leukemia cells, and no difference between IL-7 WT (36.5 ± 26.7) and IL-7 KO (31.6 ± 16.7) mice (Supplementary Fig. S1). Spleen and several nonlymphoid organs (lung, liver, and kidney) were also analyzed and all presented very few cells with no differences between the 2 mouse strains (data not shown). Our data indicate that IL-7 did not affect the engraftment and initial homing capacity of T-ALL cells.

We next evaluated the effect of IL-7 on disease progression. The percentage of TAIL7 cells circulating in the peripheral blood increased with time and was consistently higher in IL-7 WT mice at all time points analyzed (Fig. 1B). These differences may have resulted from compromised leukemia expansion in the bone marrow of IL-7–deficient mice. To test this possibility, mice were sacrificed 84 days posttransplantation, before disease symptoms were apparent. All IL-7 WT animals (n = 9) presented clear bone marrow involvement. Most mice (6 of 9; 67%) displayed overt leukemia according to the clinical definition (23), presenting more than 20% leukemia cells in the bone marrow. All the remaining IL-7 WT mice showed detectable disease in the bone marrow and were thus considered preleukemic (3 of 9; 33%), as defined in Materials and Methods (Fig. 1C). In contrast, only 4 of 10 (40%) IL-7 KO mice were leukemic and 2 of 10 preleukemic (20%; Fig. 1C). The remaining 4 IL-7 KO mice did not show detectable signs of bone marrow involvement at this time point or displayed extremely low leukemia cellularity (<0.1%). All IL-7 WT and most IL-7 KO mice, except those without signs of leukemia, displayed splenomegaly (data not shown) due to infiltration with malignant blasts (Fig. 1D). The nonlymphoid organs analyzed (liver, kidney, and lungs) also presented leukemia infiltration (Supplementary Fig. S2). However, IL-7 KO mice consistently displayed a more heterogeneous distribution and lower median values of malignant infiltration in all lymphoid and nonlymphoid organs analyzed (Fig. 1C and D; Supplementary Fig. S2). Importantly, we found that the median survival of TAIL7-transplanted IL-7 WT mice (97 days) was significantly shorter than that of IL-7 KO mice (138 days; P = 0.0023; log-rank test; Fig. 1E). Postmortem analysis showed that all animals died of leukemia with multiple organ infiltration (Supplementary Fig. S3). Hence, although our data indicate that lack of IL-7 is not sufficient to prevent leukemia progression and leukemia-related death, IL-7 clearly contributed significantly to leukemia acceleration in vivo.

Both IL-7 KO and IL-7 WT mice lack γ-chain, which is essential for efficient IL-7–mediated signaling by forming the IL-7R together with IL-7Rα (26, 27). Thus, the differences observed in leukemia expansion should largely reflect the direct impact of IL-7 on T-ALL cells, which display both IL-7Rα and γ-chain (11, 28). For confirmation, we transplanted growth factor–independent, IL-7Rα–negative P12 T-ALL cells and analyzed IL-7 KO and WT mice at 4 weeks. Both strains showed similar signs of leukemia (Supplementary Fig. S4).

IL-7 accelerates leukemia expansion in mice xenotransplanted with human primary T-ALL cells

To ask whether the influence of IL-7 was a more general feature of T-ALL and not restricted only to leukemia cell lines, we xenotransplanted primary T-ALL cells collected from 2 patients at diagnosis, which differed in their developmental maturation block (Table 1). According to the EGIL criteria (22), the samples were arrested at the cortical (patient 1) and mature (patient 2) thymocyte stage, whereas TAIL7 cells are pre-T and HPB-ALL are cortical but differ from patient 1 in the expression of CD3 (Table 1). Similar to the cell lines, we observed a longitudinal increase in the percentage of circulating T-ALL cells, with systematically higher levels in the presence of IL-7 (Fig. 2A). In addition, IL-7 WT mice culled 112 days posttransplantation presented significantly higher leukemia involvement in the bone marrow than IL-7 KO animals (Fig. 2B). Furthermore, absence of IL-7 clearly impaired infiltration of organs such as spleen, liver, kidney, and lungs (Fig. 2C).

Figure 2.

IL-7 accelerates leukemia expansion in mice xenotransplanted with human primary T-ALL cells. IL-7 WT (n = 3) and IL-7 KO (n = 4) mice were injected i.v. with 5 × 106 primary T-ALL cells. A, human T-ALL cells were monitored in the blood through time by flow cytometric analysis, using an anti-human CD2 antibody. Differences between IL-7 WT and IL-7 KO groups were statistically significant (P = 0.0259; 2-way ANOVA). Representative results of 1 of 2 independent experiments carried out (each using a different patient sample) are shown. Animals were sacrificed 112 days posttransplantation and (B) bone marrow (P = 0.0002; Student t test), (C) spleen (P = 0.0014), liver (P = 0.0040), kidney (P = 0.0873), and lung (P = 0.0044) were disrupted into a cell suspension and analyzed for primary T-ALL cell infiltration by flow cytometry with an anti-human CD5 antibody. Results indicate mean ± SEM for each organ and represent a pool from 2 independent experiments using 2 different patient samples for a total of 4 IL-7 WT and 6 IL-7 KO mice.

Figure 2.

IL-7 accelerates leukemia expansion in mice xenotransplanted with human primary T-ALL cells. IL-7 WT (n = 3) and IL-7 KO (n = 4) mice were injected i.v. with 5 × 106 primary T-ALL cells. A, human T-ALL cells were monitored in the blood through time by flow cytometric analysis, using an anti-human CD2 antibody. Differences between IL-7 WT and IL-7 KO groups were statistically significant (P = 0.0259; 2-way ANOVA). Representative results of 1 of 2 independent experiments carried out (each using a different patient sample) are shown. Animals were sacrificed 112 days posttransplantation and (B) bone marrow (P = 0.0002; Student t test), (C) spleen (P = 0.0014), liver (P = 0.0040), kidney (P = 0.0873), and lung (P = 0.0044) were disrupted into a cell suspension and analyzed for primary T-ALL cell infiltration by flow cytometry with an anti-human CD5 antibody. Results indicate mean ± SEM for each organ and represent a pool from 2 independent experiments using 2 different patient samples for a total of 4 IL-7 WT and 6 IL-7 KO mice.

Close modal

IL-7 promotes p27Kip1 downregulation, Bcl-2 upregulation, proliferation, and viability of xenotransplanted human primary T-ALL cells

We previously showed that IL-7 promotes survival and cell-cycle progression of T-ALL cells in vitro via Bcl-2 upregulation and p27Kip1 downregulation (12, 13). We sought to understand whether the same mechanisms and functional effects were responsible for the accelerated leukemia progression in the presence of IL-7 in vivo. We collected T-ALL cells from the bone marrow of mice sacrificed at 112 days and analyzed them for viability and Bcl-2 expression. Primary leukemia cells collected from IL-7 WT animals displayed significantly higher Bcl-2 levels (Fig. 3A) and increased percentage of viable cells (Fig. 3B), in agreement with the observation that IL-7 transgenic mice present upregulation of Bcl-2 protein (29). Conversely, p27Kip1 levels were downregulated in T-ALL cells recovered from IL-7 WT mice (Fig. 3C), which presented higher Ki-67 expression, indicative of increased in vivo proliferation (Fig. 3D).

Figure 3.

IL-7 promotes p27Kip1 downregulation, Bcl-2 upregulation, proliferation, and viability of xenotransplanted human primary T-ALL cells. IL-7 WT and IL-7 KO mice were injected i.v. with 5 × 106 primary T-ALL cells from 2 distinct patients in independent experiments. Animals were sacrificed 112 days posttransplantation and primary T-ALL cells in the bone marrow were discriminated by flow cytometry with anti-human CD5 antibodies. A, Bcl-2 protein levels were assessed by flow cytometry after intracellular staining of primary T-ALL cells (patient 1) with FITC-conjugated anti–Bcl-2 antibody. Left, results are representative of both patients analyzed. Specific MIF, as described in Materials and Methods, is indicated in the histogram for each condition. Right, Bcl-2 levels in T-ALL cells collected from IL-7 WT and IL-7 KO mice (P = 0.0006; Student t test). Results indicate mean ± SEM and represent a pool from the 2 different patient samples for a total of 4 IL-7 WT and 6 IL-7 KO mice. B, primary T-ALL cells (patient 1) recovered from IL-7 WT (n = 3) and IL-7 KO (n = 2) mice were stained with Annexin V–PE and viability was determined by flow cytometry. Left, a representative histogram overlay is shown with the percentage of Annexin V–negative cells indicated. Right, percentage of Annexin V–negative T-ALL cells collected from IL-7 WT and IL-7 KO mice (P = 0.0514). Results represent a pool from the 2 different patient samples for a total of 4 IL-7 WT and 2 IL-7 KO mice. C, total bone marrow cells from IL-7 WT (n = 5) and IL-7 KO (n = 6) mice were lysed, resolved by 10% SDS-PAGE, and immunoblotted with anti-p27Kip1 antibody. Left, membrane was stripped and reprobed with actin to confirm equal loading. Patient 1, lanes 1, 2, 6, and 7; patient 2, lanes 3 to 5 and 8 to 11; total lysates of TAIL7 cells were used as a positive control. Right, corresponding densitometric analysis of p27Kip1 levels, normalized to actin loading control and expressed in arbitrary units (a.u.), in IL-7 KO and IL-7 WT mice (P = 0.0260). D, Ki-67 protein levels were assessed by flow cytometry after intracellular staining of primary T-ALL cells with PE-conjugated anti–Ki-67 antibody. Left, a representative histogram overlay is shown. Right, percentage of Ki-67–positive T-ALL cells collected from IL-7 WT and IL-7 KO mice (P = 0.0121). Results represent a pool from the 2 different patient samples for a total of 4 IL-7 WT and 6 IL-7 KO mice.

Figure 3.

IL-7 promotes p27Kip1 downregulation, Bcl-2 upregulation, proliferation, and viability of xenotransplanted human primary T-ALL cells. IL-7 WT and IL-7 KO mice were injected i.v. with 5 × 106 primary T-ALL cells from 2 distinct patients in independent experiments. Animals were sacrificed 112 days posttransplantation and primary T-ALL cells in the bone marrow were discriminated by flow cytometry with anti-human CD5 antibodies. A, Bcl-2 protein levels were assessed by flow cytometry after intracellular staining of primary T-ALL cells (patient 1) with FITC-conjugated anti–Bcl-2 antibody. Left, results are representative of both patients analyzed. Specific MIF, as described in Materials and Methods, is indicated in the histogram for each condition. Right, Bcl-2 levels in T-ALL cells collected from IL-7 WT and IL-7 KO mice (P = 0.0006; Student t test). Results indicate mean ± SEM and represent a pool from the 2 different patient samples for a total of 4 IL-7 WT and 6 IL-7 KO mice. B, primary T-ALL cells (patient 1) recovered from IL-7 WT (n = 3) and IL-7 KO (n = 2) mice were stained with Annexin V–PE and viability was determined by flow cytometry. Left, a representative histogram overlay is shown with the percentage of Annexin V–negative cells indicated. Right, percentage of Annexin V–negative T-ALL cells collected from IL-7 WT and IL-7 KO mice (P = 0.0514). Results represent a pool from the 2 different patient samples for a total of 4 IL-7 WT and 2 IL-7 KO mice. C, total bone marrow cells from IL-7 WT (n = 5) and IL-7 KO (n = 6) mice were lysed, resolved by 10% SDS-PAGE, and immunoblotted with anti-p27Kip1 antibody. Left, membrane was stripped and reprobed with actin to confirm equal loading. Patient 1, lanes 1, 2, 6, and 7; patient 2, lanes 3 to 5 and 8 to 11; total lysates of TAIL7 cells were used as a positive control. Right, corresponding densitometric analysis of p27Kip1 levels, normalized to actin loading control and expressed in arbitrary units (a.u.), in IL-7 KO and IL-7 WT mice (P = 0.0260). D, Ki-67 protein levels were assessed by flow cytometry after intracellular staining of primary T-ALL cells with PE-conjugated anti–Ki-67 antibody. Left, a representative histogram overlay is shown. Right, percentage of Ki-67–positive T-ALL cells collected from IL-7 WT and IL-7 KO mice (P = 0.0121). Results represent a pool from the 2 different patient samples for a total of 4 IL-7 WT and 6 IL-7 KO mice.

Close modal

Leukemia cells in T-ALL patients appear to respond to and consume IL-7

IL-7 circulating levels are regulated by consumption (30) and IL-7 signaling leads to the transcriptional downregulation of IL-7Rα (31). Although cancer cells may grow independently of external stimuli, our data argue that a significant fraction of human T-ALL cells respond to and benefit significantly from the presence of IL-7 in vivo. We collected evidence directly from patient specimens at diagnosis supporting this notion. We found that T-ALL cells had significantly lower IL7RA mRNA levels than normal T-cell precursors (Fig. 4A) and that IL-7 levels were decreased in the plasma of T-ALL patients as compared with healthy age-matched controls (Fig. 4B), suggesting that T-ALL cells consume IL-7 and thereby downregulate IL-7Rα. In support of this notion, we found that 4 of 6 patient samples cultured ex vivo in medium without IL-7 showed upregulation of IL-7Rα surface expression, which was prevented by the addition of IL-7 (Fig. 4C). Taking into account that more than 70% of T-ALL patient samples respond to IL-7 ex vivo and express functional IL-7Rs (11, 28), our current observations suggest that human T-ALL cells from a majority of patients might be sensitive to IL-7 signaling in vivo in the actual disease setting.

Figure 4.

Ex vivo evidence for leukemia cell responsiveness to IL-7 in T-ALL patients. A, RNA was collected from primary T-ALL samples (n = 12) and normal control thymocytes (n = 9), and qRT-PCR was carried out to determine IL-7Rα mRNA expression levels (P = 0.0002, unpaired 2-tailed Student t test). B, IL-7 plasma levels in samples collected from T-ALL patients (n = 7) or age-matched healthy controls (n = 8) were determined using an IL-7 ELISA (P = 0.016). C, IL-7Rα expression in T-ALL cells was evaluated by flow cytometry ex vivo and after 24 hours of in vitro culture with or without IL-7 (10 ng/mL). Histogram overlay is representative of 4 of 6 (67%) patients analyzed.

Figure 4.

Ex vivo evidence for leukemia cell responsiveness to IL-7 in T-ALL patients. A, RNA was collected from primary T-ALL samples (n = 12) and normal control thymocytes (n = 9), and qRT-PCR was carried out to determine IL-7Rα mRNA expression levels (P = 0.0002, unpaired 2-tailed Student t test). B, IL-7 plasma levels in samples collected from T-ALL patients (n = 7) or age-matched healthy controls (n = 8) were determined using an IL-7 ELISA (P = 0.016). C, IL-7Rα expression in T-ALL cells was evaluated by flow cytometry ex vivo and after 24 hours of in vitro culture with or without IL-7 (10 ng/mL). Histogram overlay is representative of 4 of 6 (67%) patients analyzed.

Close modal

There is mounting evidence that microenvironmental factors can contribute to tumor progression. IL-7 is produced in the thymus and bone marrow, the microenvironments where T-ALL develops and expands. Interestingly, IL-7 has been shown to have oncogenic potential in vivo. Transgenic mice expressing IL-7 in lymphocytes develop B- and T-cell lymphomas (1) as a consequence of an autocrine loop involving IL-7 stimulation via IL-7R (2). However, there is no evidence that human T-ALL cells express IL-7, largely excluding the existence in this malignancy of an IL-7–dependent autocrine loop that has been suggested to play a role in other hematologic cancers (32, 33). Thus, in the present study, we explored the alternative hypothesis that IL-7 produced by the microenvironment may promote human T-ALL expansion in vivo.

Our data indicate that IL-7 does not affect the engraftment and initial homing capacity of T-ALL cells to the bone marrow or other organs. However, it remains to be evaluated whether the late differences between IL-7–deficient and IL-replete mice regarding leukemia infiltration into organs such as spleen and liver reflect modulation of leukemia cell trafficking from the bone marrow to these organs and/or of malignant cell proliferation within each infiltrated organ.

We found that lack of IL-7 is not sufficient to prevent leukemia progression and leukemia-related death, such that all animals died of leukemia irrespective of IL-7. This may reflect the acquisition of growth factor independence or the effect of other microenvironmental stimuli (e.g., γC-signaling cytokines (11), Notch ligands (34), or chemokines such as CCL25 and CXCL13 (35, 36) that may provide T-ALL cells with alternative growth signals in the absence of IL-7. This notwithstanding, IL-7 clearly contributes significantly to leukemia acceleration in vivo. Curiously, despite the evidence that mouse and human IL-7 have similar in vitro bioactivity toward human lymphocytes (24, 25), including T-ALL cells (25), it was recently shown that in vivo IL-7 present in the mouse is less active on human cells (37). This suggests that the effect of IL-7 on human leukemia progression in the RAG KO xenotransplant models we used may constitute an underestimation of the impact of IL-7 on human T-ALL patients. Moreover, because cancer cells are generally viewed as nonreliant on growth factor signals (38), the fact that IL-7 accelerated disease progression is especially remarkable. The related questions of whether IL-7 promotes survival of a putative leukemia stem cell population and participates in T-ALL initiation remain to be scrutinized.

At the molecular level, we found that IL-7–related disease progression was associated with decreased p27Kip1 expression and upregulated Bcl-2. Given our previous demonstration that regulation of p27Kip1 and Bcl-2 is mandatory for IL-7–mediated antiapoptotic and proliferative effects on T-ALL cells in vitro (13), it is reasonable to infer that the same mechanisms underlie T-ALL expansion in vivo in response to IL-7. In support of this possibility, it is noteworthy that T-ALL patient samples frequently display p27Kip1 downregulation (39) and Bcl-2 upregulation (40). Moreover, most primary T-ALL samples show PI3K pathway activation (17), which may be the consequence not only of cell autonomous mechanisms (17, 41, 42) but also of microenvironmental stimuli such as IL-7 (12). The importance of IL-7/IL-7R signaling is further illustrated by the observations that in vitro IL-7 responsiveness (28) and IL7RA gene expression (43) appear to have prognostic value in T-ALL. Notably, our studies indicate that the in vivo impact of IL-7 on T-ALL cells is not restricted to a particular maturation stage or CD4/CD8 immunophenotype (Table 1). These observations are reminiscent of our in vitro findings, in that T-ALL patient samples proliferated in response to IL-7 irrespective of the stage at which they were developmentally blocked (11).

Altogether, our data provide the first clear evidence that human T-ALL cells utilize the IL-7/IL-7R axis for expansion in vivo, providing experimental support to the hypothesis that responsiveness to a γC-signaling cytokine contributes to T-ALL development in vivo (5, 44). Because the majority of T-ALL cases are known to respond to IL-7 in vitro (11) and thus possibly benefit from IL-7 stimulation in vivo, therapeutic approaches that integrate targeting IL-7, IL-7R, or key elements in IL-7/IL-7R–mediated signaling into current protocols may prove beneficial for the treatment of T-ALL. In addition, our observations confirm the need for caution when administering IL-7 in the context of cancer immunotherapy (45) and suggest that the promise that IL-7 holds as an immunorestorative (46, 47) and in enhancing immunologic responses against cancer (48, 49) should be further evaluated strictly in patients suffering from cancers that are well characterized as refractory to the cytokine.

No potential conflicts of interest were disclosed.

We thank Dr. Paulo Lúcio for kindly providing the immunophenotypic analysis of primary patient samples, Dr. Miguel Abecasis for generously providing the thymic specimens, and Daniel Ribeiro, Nádia Correia, Jaíra Ferreira de Vasconcellos, and Priscila P. Zenatti for their invaluable help. We especially acknowledge the contribution of patients and their families, and Dr. Mário Chagas and all the physicians and nurses at the Pediatric Service of Instituto Português de Oncologia de Lisboa, in providing primary samples.

This work was supported by grants from Associação Portuguesa Contra a Leucemia, FCT (POCI/SAU-OBS/58913 and PTDC/SAU-OBD/104816), and Children with Leukaemia Charity, UK, to J.T. Barata; FAPESP (08/10034-1) to J.A. Yunes, Medical Research Council, UK, program code U117573801 to B. Seddon. A. Silva, L.R. Martins, and B.A. Cardoso had PhD fellowships from FCT-SFRH. A.B.A. Laranjeira had a PhD fellowship from FAPESP.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Rich
BE
,
Campos-Torres
J
,
Tepper
RI
,
Moreadith
RW
,
Leder
P
. 
Cutaneous lymphoproliferation and lymphomas in interleukin 7 transgenic mice
.
J Exp Med
1993
;
177
:
305
16
.
2.
Abraham
N
,
Ma
MC
,
Snow
JW
,
Miners
MJ
,
Herndier
BG
,
Goldsmith
MA
. 
Haploinsufficiency identifies STAT5 as a modifier of IL-7-induced lymphomas
.
Oncogene
2005
;
24
:
5252
7
.
3.
Laouar
Y
,
Crispe
IN
,
Flavell
RA
. 
Overexpression of IL-7R alpha provides a competitive advantage during early T-cell development
.
Blood
2004
;
103
:
1985
94
.
4.
Jiang
Q
,
Li
WQ
,
Aiello
FB
,
Mazzucchelli
R
,
Asefa
B
,
Khaled
AR
. 
Cell biology of IL-7, a key lymphotrophin
.
Cytokine Growth Factor Rev
2005
;
16
:
513
33
.
5.
Barata
JT
,
Cardoso
AA
,
Boussiotis
VA
. 
Interleukin-7 in T-cell acute lymphoblastic leukemia: an extrinsic factor supporting leukemogenesis?
Leuk Lymphoma
2005
;
46
:
483
95
.
6.
Mazzucchelli
RI
,
Warming
S
,
Lawrence
SM
,
Ishii
M
,
Abshari
M
,
Washington
AV
, et al
Visualization and identification of IL-7 producing cells in reporter mice
.
PLoS One
2009
;
4
:
e7637
.
7.
Alves
NL
,
Richard-Le Goff
O
,
Huntington
ND
,
Sousa
AP
,
Ribeiro
VS
,
Bordack
A
, et al
Characterization of the thymic IL-7 niche in vivo
.
Proc Natl Acad Sci U S A
2009
;
106
:
1512
7
.
8.
Scupoli
MT
,
Vinante
F
,
Krampera
M
,
Vincenzi
C
,
Nadali
G
,
Zampieri
F
, et al
Thymic epithelial cells promote survival of human T-cell acute lymphoblastic leukemia blasts: the role of interleukin-7
.
Haematologica
2003
;
88
:
1229
37
.
9.
Scupoli
MT
,
Perbellini
O
,
Krampera
M
,
Vinante
F
,
Cioffi
F
,
Pizzolo
G
. 
Interleukin 7 requirement for survival of T-cell acute lymphoblastic leukemia and human thymocytes on bone marrow stroma
.
Haematologica
2007
;
92
:
264
6
.
10.
Touw
I
,
Pouwels
K
,
van Agthoven
T
,
van Gurp
R
,
Budel
L
,
Hoogerbrugge
H
, et al
Interleukin-7 is a growth factor of precursor B and T acute lymphoblastic leukemia
.
Blood
1990
;
75
:
2097
101
.
11.
Barata
JT
,
Keenan
TD
,
Silva
A
,
Nadler
LM
,
Boussiotis
VA
,
Cardoso
AA
. 
Common gamma chain-signaling cytokines promote proliferation of T-cell acute lymphoblastic leukemia
.
Haematologica
2004
;
89
:
1459
67
.
12.
Barata
JT
,
Silva
A
,
Brandao
JG
,
Nadler
LM
,
Cardoso
AA
,
Boussiotis
VA
. 
Activation of PI3K is indispensable for interleukin 7-mediated viability, proliferation, glucose use, and growth of T cell acute lymphoblastic leukemia cells
.
J Exp Med
2004
;
200
:
659
69
.
13.
Barata
JT
,
Cardoso
AA
,
Nadler
LM
,
Boussiotis
VA
. 
Interleukin-7 promotes survival and cell cycle progression of T-cell acute lymphoblastic leukemia cells by down-regulating the cyclin-dependent kinase inhibitor p27(kip1)
.
Blood
2001
;
98
:
1524
31
.
14.
Brown
VI
,
Fang
J
,
Alcorn
K
,
Barr
R
,
Kim
JM
,
Wasserman
R
, et al
Rapamycin is active against B-precursor leukemia in vitro and in vivo, an effect that is modulated by IL-7-mediated signaling
.
Proc Natl Acad Sci U S A
2003
;
100
:
15113
8
.
15.
Williams
RT
,
Roussel
MF
,
Sherr
CJ
. 
Arf gene loss enhances oncogenicity and limits imatinib response in mouse models of Bcr-Abl-induced acute lymphoblastic leukemia
.
Proc Natl Acad Sci U S A
2006
;
103
:
6688
93
.
16.
Williams
RT
,
den Besten
W
,
Sherr
CJ
. 
Cytokine-dependent imatinib resistance in mouse BCR-ABL+, Arf-null lymphoblastic leukemia
.
Genes Dev
2007
;
21
:
2283
7
.
17.
Silva
A
,
Yunes
JA
,
Cardoso
BA
,
Martins
LR
,
Jotta
PY
,
Abecasis
M
, et al
PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability
.
J Clin Invest
2008
;
118
:
3762
74
.
18.
Barata
JT
,
Boussiotis
VA
,
Yunes
JA
,
Ferrando
AA
,
Moreau
LA
,
Veiga
JP
, et al
IL-7-dependent human leukemia T-cell line as a valuable tool for drug discovery in T-ALL
.
Blood
2004
;
103
:
1891
900
.
19.
DSMZ Human and Animal Cell Lines [cited 2011 June 27]
.
Available from:
http://www.dsmz.de/human_and_animal_cell_lines/.
20.
Amendola
M
,
Venneri
MA
,
Biffi
A
,
Vigna
E
,
Naldini
L
. 
Coordinate dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters
.
Nat Biotechnol
2005
;
23
:
108
16
.
21.
Henriques
CM
,
Rino
J
,
Nibbs
RJ
,
Graham
GJ
,
Barata
JT
. 
IL-7 induces rapid clathrin-mediated internalization and JAK3-dependent degradation of IL-7Ralpha in T cells
.
Blood
2010
;
115
:
3269
77
.
22.
Bene
MC
,
Castoldi
G
,
Knapp
W
,
Ludwig
WD
,
Matutes
E
,
Orfao
A
, et al
Proposals for the immunological classification of acute leukemias. European Group for the Immunological Characterization of Leukemias (EGIL)
.
Leukemia
1995
;
9
:
1783
6
.
23.
Barabe
F
,
Kennedy
JA
,
Hope
KJ
,
Dick
JE
. 
Modeling the initiation and progression of human acute leukemia in mice
.
Science
2007
;
316
:
600
4
.
24.
Johnson
SE
,
Shah
N
,
Panoskaltsis-Mortari
A
,
LeBien
TW
. 
Murine and human IL-7 activate STAT5 and induce proliferation of normal human pro-B cells
.
J Immunol
2005
;
175
:
7325
31
.
25.
Barata
JT
,
Silva
A
,
Abecasis
M
,
Carlesso
N
,
Cumano
A
,
Cardoso
AA
. 
Molecular and functional evidence for activity of murine IL-7 on human lymphocytes
.
Exp Hematol
2006
;
34
:
1133
42
.
26.
Kondo
M
,
Takeshita
T
,
Higuchi
M
,
Nakamura
M
,
Sudo
T
,
Nishikawa
S
, et al
Functional participation of the IL-2 receptor gamma chain in IL-7 receptor complexes
.
Science
1994
;
263
:
1453
4
.
27.
Ziegler
SE
,
Morella
KK
,
Anderson
D
,
Kumaki
N
,
Leonard
WJ
,
Cosman
D
, et al
Reconstitution of a functional interleukin (IL)-7 receptor demonstrates that the IL-2 receptor gamma chain is required for IL-7 signal transduction
.
Eur J Immunol
1995
;
25
:
399
404
.
28.
Karawajew
L
,
Ruppert
V
,
Wuchter
C
,
Kösser
A
,
Schrappe
M
,
Dörken
B
, et al
Inhibition of in vitro spontaneous apoptosis by IL-7 correlates with bcl-2 up-regulation, cortical/mature immunophenotype, and better early cytoreduction of childhood T-cell acute lymphoblastic leukemia
.
Blood
2000
;
96
:
297
306
.
29.
El Kassar
N
,
Lucas
PJ
,
Klug
DB
,
Zamisch
M
,
Merchant
M
,
Bare
CV
, et al
A dose effect of IL-7 on thymocyte development
.
Blood
2004
;
104
:
1419
27
.
30.
Guimond
M
,
Veenstra
RG
,
Grindler
DJ
,
Zhang
H
,
Cui
Y
,
Murphy
RD
, et al
Interleukin 7 signaling in dendritic cells regulates the homeostatic proliferation and niche size of CD4+ T cells
.
Nat Immunol
2009
;
10
:
149
57
.
31.
Park
JH
,
Yu
Q
,
Erman
B
,
Appelbaum
JS
,
Montoya-Durango
D
,
Grimes
HL
, et al
Suppression of IL7Ralpha transcription by IL-7 and other prosurvival cytokines: a novel mechanism for maximizing IL-7-dependent T cell survival
.
Immunity
2004
;
21
:
289
302
.
32.
Cattaruzza
L
,
Gloghini
A
,
Olivo
K
,
Di Francia
R
,
Lorenzon
D
,
De Filippi
R
, et al
Functional coexpression of Interleukin (IL)-7 and its receptor (IL-7R) on Hodgkin and Reed-Sternberg cells: Involvement of IL-7 in tumor cell growth and microenvironmental interactions of Hodgkin's lymphoma
.
Int J Cancer
2009
;
125
:
1092
101
.
33.
Nakayama
J
,
Yamamoto
M
,
Hayashi
K
,
Satoh
H
,
Bundo
K
,
Kubo
M
, et al
BLNK suppresses pre-B-cell leukemogenesis through inhibition of JAK3
.
Blood
2009
;
113
:
1483
92
.
34.
Armstrong
F
,
Brunet de la
Grange P
,
Gerby
B
,
Rouyez
MC
,
Calvo
J
,
Fontenay
M
, et al
NOTCH is a key regulator of human T-cell acute leukemia initiating cell activity
.
Blood
2009
;
113
:
1730
40
.
35.
Qiuping
Z
,
Qun
L
,
Chunsong
H
,
Xiaolian
Z
,
Baojun
H
,
Mingzhen
Y
, et al
Selectively increased expression and functions of chemokine receptor CCR9 on CD4+ T cells from patients with T-cell lineage acute lymphocytic leukemia
.
Cancer Res
2003
;
63
:
6469
77
.
36.
Qiuping
Z
,
Jie
X
,
Youxin
J
,
Qun
W
,
Wei
J
,
Chun
L
, et al
Selectively frequent expression of CXCR5 enhances resistance to apoptosis in CD8(+)CD34(+) T cells from patients with T-cell-lineage acute lymphocytic leukemia
.
Oncogene
2005
;
24
:
573
84
.
37.
van Lent
AU
,
Dontje
W
,
Nagasawa
M
,
Siamari
R
,
Bakker
AQ
,
Pouw
SM
, et al
IL-7 enhances thymic human T cell development in “human immune system” Rag2−/−IL-2Rgammac−/− mice without affecting peripheral T cell homeostasis.
J Immunol
2009
;
183
:
7645
55
.
38.
Hanahan
D
,
Weinberg
RA
. 
The hallmarks of cancer
.
Cell
2000
;
100
:
57
70
.
39.
Wolfraim
LA
,
Fernandez
TM
,
Mamura
M
,
Fuller
WL
,
Kumar
R
,
Cole
DE
, et al
Loss of Smad3 in acute T-cell lymphoblastic leukemia
.
N Engl J Med
2004
;
351
:
552
9
.
40.
Coustan-Smith
E
,
Kitanaka
A
,
Pui
CH
,
McNinch
L
,
Evans
WE
,
Raimondi
SC
, et al
Clinical relevance of BCL-2 overexpression in childhood acute lymphoblastic leukemia
.
Blood
1996
;
87
:
1140
6
.
41.
Palomero
T
,
Sulis
ML
,
Cortina
M
,
Real
PJ
,
Barnes
K
,
Ciofani
M
, et al
Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia
.
Nat Med
2007
;
13
:
1203
10
.
42.
Gutierrez
A
,
Sanda
T
,
Grebliunaite
R
,
Carracedo
A
,
Salmena
L
,
Ahn
Y
, et al
High frequency of PTEN, PI3K, and AKT abnormalities in T-cell acute lymphoblastic leukemia
.
Blood
2009
;
114
:
647
50
.
43.
Cleaver
AL
,
Beesley
AH
,
Firth
MJ
,
turges
NC
,
O'Leary
RA
,
Hunger
SP
, et al
Gene-based outcome prediction in multiple cohorts of pediatric T-cell acute lymphoblastic leukemia: a Children's Oncology Group study
.
Mol Cancer
2010
;
9
:
105
.
44.
McCormack
MP
,
Rabbitts
TH
. 
Activation of the T-cell oncogene LMO2 after gene therapy for X-linked severe combined immunodeficiency
.
N Engl J Med
2004
;
350
:
913
22
.
45.
Capitini
CM
,
Chisti
AA
,
Mackall
CL
. 
Modulating T-cell homeostasis with IL-7: preclinical and clinical studies
.
J Intern Med
2009
;
266
:
141
53
.
46.
Sportes
C
,
Hakim
FT
,
Memon
SA
,
Zhang
H
,
Chua
KS
,
Brown
MR
, et al
Administration of rhIL-7 in humans increases in vivo TCR repertoire diversity by preferential expansion of naive T cell subsets
.
J Exp Med
2008
;
205
:
1701
14
.
47.
Sportes
C
,
Babb
RR
,
Krumlauf
MC
,
Hakim
FT
,
Steinberg
SM
,
Chow
CK
, et al
Phase I study of recombinant human interleukin-7 administration in subjects with refractory malignancy
.
Clin Cancer Res
2010
;
16
:
727
35
.
48.
Li
B
,
VanRoey
MJ
,
Jooss
K
. 
Recombinant IL-7 enhances the potency of GM-CSF-secreting tumor cell immunotherapy
.
Clin Immunol
2007
;
123
:
155
65
.
49.
Pellegrini
M
,
Calzascia
T
,
Elford
AR
,
Shahinian
A
,
Lin
AE
,
Dissanayake
D
, et al
Adjuvant IL-7 antagonizes multiple cellular and molecular inhibitory networks to enhance immunotherapies
.
Nat Med
2009
;
15
:
528
36
.

Supplementary data