BRCA1, the breast cancer- and ovarian cancer-specific tumor suppressor, can be a transcriptional repressor or a transcriptional activator, depending on the promoter context. To identify the genes activated or repressed by BRCA1, we have analyzed microarray results from cells depleted of BRCA1 and revealed a number of genes regulated by BRCA1 on the level of transcription. Among the genes repressed by BRCA1, we have identified amphiregulin (AREG) and early growth response-1 (EGR1). Results indicate that BRCA1 regulates AREG transcription directly through binding to the AREG promoter, however, we could not detect BRCA1 on the EGR1 promoter, suggesting that EGR1 is indirectly regulated by BRCA1. In an attempt to identify the mechanism of the AREG transcriptional repression by BRCA1, we have mapped two independent BRCA1 response elements on the AREG located at positions −202/−182 and +19/+122. BRCA1 depletion leads to induction of the AREG protein. Taken together, our data build the connection between BRCA1 loss of function and AREG upregulation—a change in gene expression often observed in breast cancer. Cancer Res; 70(3); 996–1005

Loss of function of the tumor suppressor BRCA1 (breast cancer–associated 1) protein is responsible for the high percentage of familial and sporadic breast cancers. BRCA1 inactivating mutations are found in ∼50% of patients with familial breast cancer (1, 2); however, in sporadic breast cancer, mutations in BRCA1 are almost never found. Nevertheless, sporadic cases are often characterized by decreased BRCA1 mRNA and protein levels (3). Moreover, in many clinical samples, ∼14% of sporadic breast cancers revealed hypermethylated BRCA1 promoter—an evidence of epigenetic downregulation (4).

BRCA1 protein participates in key cellular processes, including transcription, repair of DNA damage, cell cycle checkpoints, and centrosome dynamics (57). The question of how BRCA1 mediates its role as a tumor suppressor is unresolved. BRCA1 is primarily a nuclear protein (1), and one of its first identified roles is transcriptional stimulation (8, 9). BRCA1 copurifies with an RNA polymerase II (RNAPII)–containing complex (911). The mechanism by which BRCA1 protein regulates transcription has been elucidated. BRCA1 stimulates transcription at a variety of promoters by stabilizing the preinitiation complex (12). BRCA1 can also act as a transcriptional repressor when in the presence of active ubiquitination cofactors, by conjugating ubiquitin on RNAPII and preventing the initiation of RNA synthesis (13). It is likely that the specificity of whether BRCA1 stimulates or represses the transcription reaction depends on the factors that recruit BRCA1 protein to the promoter (12, 13).

How might the function of BRCA1 as a transcriptional repressor contribute to its function as a tumor suppressor? We hypothesize that the recruitment of BRCA1 to a gene promoter regulates the transcription of a factor that is critical for tumorigenesis. In the current study, we performed gene expression microarray analysis with RNAi-depleted BRCA1 samples and identified genes significantly repressed by BRCA1, including amphiregulin (AREG) and early growth response 1 (EGR1). We found that BRCA1 is present on the AREG promoter. Using reporter assays, we determined that the response to BRCA1 repression mapped to two sites, the −202/−182 and +19/+122 positions of the AREG promoter. By contrast, our results suggest that BRCA1 indirectly regulates EGR1 transcription, possibly through AREG protein induction. Taken together, our data show the connection between BRCA1 tumor suppressor and AREG, a ligand of the epidermal growth factor receptor (EGFR), which is important in breast cancer development and progression.

Constructs

Plasmids for the expression of specific shRNA were prepared as described (14). The BRCA1-specific shRNA plasmid was the same one used previously (13). Reporter constructs were based on the AREG promoter–containing vector described by Plowman and colleagues (15) and were prepared by subcloning of the promoter fragments −643/+122, −202/+122, −182/+122, −159/+122, −136/+122, −110/+122, −44/+122, −202/+19, −182/+19, −159/+19, −136/+19, and −110/+19 into pGL3 basic vector (Promega). The primer sequences used for subcloning are presented in Supplementary Materials (Supplementary Table S1).

Cell culture

The HeLa cell line (ATCC cell line CCL-2) was maintained in DMEM supplemented with 10% bovine serum, 100 IU/mL penicillin, and 100 μg/mL streptomycin. The SUM149PT cell line (Asterand) was maintained in Ham's F-12 medium supplemented with 5% fetal bovine serum, 5 μg/mL insulin, 2 μg/mL hydrocortisone, and 5 μg/mL gentamicin. All the cell lines were maintained in a humidified incubator at 37°C and 5% CO2.

Preparation of cDNA for microarray and TaqMan analysis

HeLa cells were cotransfected (Lipofectamine; Invitrogen) with 5 μg of shRNA expression plasmid (14) and 20 ng of pBabe-puromycin plasmid. BRCA1 shRNA (gccacaggaccccaagaaugag) was targeted to the 3′-untranslated region of the BRCA1 mRNA. The control shRNA was targeted against a mutant green fluorescent protein (GFP) construct (gggccauggcacguacggcaag). Puromycin selection (2 μg/mL) was applied 24 h after transfection, and cells were harvested at 72 h posttransfection. BRCA1 siRNA used to eliminate the possibility of an off-target effect was targeted to position 2616 of the mRNA (GGU UUC AAA GCG CCA GUC AdTdT). The control siRNA was targeted against luciferase (UCG AAG UAU UCC GCG UAC GdTdT). RNA was prepared with either Tri Reagent (Molecular Research), with which RNA was further purified over RNeasy columns (Qiagen), or Dynabeads mRNA direct kit (Invitrogen). Microarray analysis was performed on separate samples at the Harvard Biopolymers Facility (Boston, MA) and at the Microarray Shared Resource in Comprehensive Cancer Center (Ohio State University, Columbus, OH) on the Affymetrix HG-U133_plus_2 chip. The use of different RNA purification strategies and of different microarray facilities resulted in identification of the most robust changes in gene expression secondary to BRCA1 depletion. For TaqMan assays, cDNA was reverse transcribed from mRNA using the Superscript II kit (Invitrogen). Primers for AREG, EGR1, Jun, BRE, XRCC4, DDX58, KRT17, GDF15, and CCL5 were purchased from Applied Biosystems. Real-time PCR reactions were done in nine replicates. GAPDH and TFRC were used as controls. Calculations of ΔΔCt value were done as described previously (16).

Chromatin immunoprecipitation

The cells were treated with 1% formaldehyde for 20 min at 37°C in the incubator, washed three times with 1× PBS buffer, and lysed in a warm buffer (30°C) containing 50 mmol/L Tris-HCl (pH 8.1), 10 mmol/L EDTA, 1% SDS, protease inhibitor cocktail, and 1 mmol/L phenylmethylsulfonylfluoride. The lysate was incubated on ice for 20 min and sonicated to obtain ∼500 bp DNA fragments. The samples were diluted 10-fold into dilution buffer [part of chromatin immunoprecipitation (ChIP) Assay Kit (17-295), Upstate (Millipore)], precleared with ssDNA/protein A beads [part of ChIP Assay Kit (17-295), Upstate (Millipore)], and incubated with the antibodies at 4°C overnight. The BRCA1-specific antibody and matched preimmune serum have been described before (17). Sp1 (SC-59, Santa Cruz Biotechnology) and histone H3 antibodies [06-755, Upstate (Millipore)] were used. The beads were added and incubated for 1 h; washed once with the high-salt solution [part of ChIP Assay Kit (17-295), Upstate (Millipore)], low-salt solution [part of ChIP Assay Kit (17-295), Upstate (Millipore)], and LiCl solution [part of ChIP Assay Kit (17-295), Upstate (Millipore)]; and washed three times with 1× TE buffer (pH 8.0). The samples were eluted from the beads in 1% SDS and 0.1 mol/L NaHCO3 solution and treated with 0.2 mol/L NaCl for 6 h at 65°C, then with 0.1 mg/mL proteinase K [in buffer containing 10 mmol/L EDTA and 70 mmol/L Tris-HCl (pH 6.5)] for 1 h at 45°C and extracted using PCR clean-up kit (Qiagen). Alternatively, the samples were prepared using ChIP-IT Express Enzymatic kit (Active Motif). The samples were analyzed by real-time PCR using SYBR green dye (Bio-Rad), and the primers were described in Supplementary Materials Table S2. Real-time PCR reactions were run on the equipment provided by Plant-Microbe Genomics Facility (Ohio State University, Columbus, OH). Results were analyzed using the methods described previously (Bio-Rad, Bulletin 2916).

Reporter gene assay

HeLa cells on a six-well plate were cotransfected (Lipofectamine; Invitrogen) with 1.6 μg of shRNA expression plasmid targeting either BRCA1 or, as a control, mutant GFP (14), 1.6 μg promoter-reporter construct, and 66 ng of pBabe-puromycin plasmid. Puromycin selection (2 μg/mL) was applied 24 h after transfection; 72 h after transfection, cells were lysed using the lysis buffer from the luciferase assay system kit (Promega). The fluorescent units were normalized to the sample protein content measured using BCA protein assay kit (Pierce). The transfection efficiency was checked by cotransfection of the GFP expression plasmid.

Inhibition of BRCA1 reveals a number of repressed and activated genes in cancer-associated pathways

In an effort to determine which genes might be contributing to cancer development and progression when BRCA1 function is lost, we performed an Affymetrix array analysis by comparing the gene expression pattern of HeLa cells in which BRCA1 protein was depleted using RNAi (Fig. 1A).

Figure 1.

Affymetrix data identify a number of genes repressed by BRCA1, among them AREG and EGR1, and the pathway analysis reveals EGR1 as a downstream target for AREG. A, shRNA-mediated BRCA1 depletion in HeLa cells. HeLa cells were transfected with a plasmid expressing shRNA specific for GFP (Control, lane 1) or for BRCA1 (lane 2). Cells were harvested 72 h after transfection, and Western blots were probed with antibodies against BRCA1 (top) and RNA polymerase II large subunit (Rpb1, loading control, bottom). B, validation of the data obtained from the Affymetrix microarray analysis by real-time PCR. The controls in Affymetrix microarray data and in real-time PCR were normalized to 1 and shown in white and light gray. The Affymetrix microarray data and the real-time PCR data for the samples where BRCA1 was depleted are shown in dark gray and black, respectively. X axis, genes used in the study; Y axis, fold change relative to the control. C, pathway analysis of the genes identified by Affymetrix microarray and validated by quantitative real-time PCR. A biological circuit with AREG taken from IPA software of microarray results is shown. AREG, GDF15, EGR1, and KRT17 all had significant changes in expression following depletion of BRCA1; EGFR did not significantly change expression but was included in the regulatory module due to the pathway analysis. The position of each gene in the figure corresponds to its cellular localization. The dashed line illustrates the indirect connections between the molecules; the solid lines indicate direct connection between molecules. The line without arrows shows interaction; the lines with arrows indicate activation.

Figure 1.

Affymetrix data identify a number of genes repressed by BRCA1, among them AREG and EGR1, and the pathway analysis reveals EGR1 as a downstream target for AREG. A, shRNA-mediated BRCA1 depletion in HeLa cells. HeLa cells were transfected with a plasmid expressing shRNA specific for GFP (Control, lane 1) or for BRCA1 (lane 2). Cells were harvested 72 h after transfection, and Western blots were probed with antibodies against BRCA1 (top) and RNA polymerase II large subunit (Rpb1, loading control, bottom). B, validation of the data obtained from the Affymetrix microarray analysis by real-time PCR. The controls in Affymetrix microarray data and in real-time PCR were normalized to 1 and shown in white and light gray. The Affymetrix microarray data and the real-time PCR data for the samples where BRCA1 was depleted are shown in dark gray and black, respectively. X axis, genes used in the study; Y axis, fold change relative to the control. C, pathway analysis of the genes identified by Affymetrix microarray and validated by quantitative real-time PCR. A biological circuit with AREG taken from IPA software of microarray results is shown. AREG, GDF15, EGR1, and KRT17 all had significant changes in expression following depletion of BRCA1; EGFR did not significantly change expression but was included in the regulatory module due to the pathway analysis. The position of each gene in the figure corresponds to its cellular localization. The dashed line illustrates the indirect connections between the molecules; the solid lines indicate direct connection between molecules. The line without arrows shows interaction; the lines with arrows indicate activation.

Close modal

Our study revealed the large number of genes that were either upregulated or downregulated following depletion of BRCA1, and we chose 2.3-fold change as a reasonable cutoff for further investigation. The list of these genes is shown in Table S3 of Supplementary Materials. The Ingenuity Pathway Analysis (IPA) software was used to analyze the lists of genes and reveal their contribution to disease, and to identify genetic networks and pathways that include the affected genes. Analysis of the gene list (253 genes), using IPA software, revealed that 85 genes are expressed in the mammary gland and 153 genes are expressed in breast cancer cell lines (Table S4 of Supplementary Materials). Moreover, IPA revealed the involved biological functions and diseases. The distribution of the genes according to their function and their role in the pathologic processes is presented in Table 1. The pathologic processes that involve cancer (cell cycle, cell growth, cell movement, and gene expression) are all consistent with known functions of BRCA1 in controlling cell cycle progression after DNA damage (18), DNA repair (19), and control of centrosomes (18, 20).

Table 1.

The distribution of genes upregulated or downregulated >2.3-fold in response to BRCA1 silencing according the top networks, diseases and disorders to which they might be involved, and their function in the cell

Top networksScoreMolecules
Immune response, viral function, nucleic acid metabolism 46 26 
Cardiac hypertrophy, cardiovascular disease, developmental disorder 39 23 
Cancer, cell cycle, gastrointestinal disease 34 21 
Cancer, cellular growth and proliferation, hematologic disease 32 20 
Cardiovascular system development and function, cell morphology, cellular development 30 19 
Cancer, cellular movement, neurologic disease 21 15 
Amino acid metabolism, cancer, small-molecule biochemistry 21 15 
Cardiovascular system development and function, molecular transport, small-molecule biochemistry 20 14 
Cell signaling, nucleic acid metabolism, small-molecule biochemistry 18 13 
Organ morphology, reproductive system development and function, amino acid metabolism 18 13 
Cancer, cell death, gene expression 18 13 
Drug metabolism, molecular transport, nucleic acid metabolism 16 12 
 
Diseases and disorders P Molecules 
Cancer 1.45E−08 to 2.79E−03 100 
Viral function 2.66E−06 to 1.57E−03 
Organism injuries and abnormalities 2.84E−06 to 2.47E−03 29 
Dermatologic diseases and conditions 6.25E−06 to 3.91E−04 22 
Genetic disorder 6.25E−06 to 2.70E−03 12 
 
Molecular and cellular functions P Molecules 
Cell death 2.27E−08 to 2.79E−03 67 
Cellular growth and proliferation 2.86E−07 to 2.79E−03 69 
Cellular development 2.66E−06 to 2.72E−03 25 
Gene expression 9.07E−06 to 1.73E−03 34 
Cell cycle 1.50E−05 to 2.79E−03 34 
Top networksScoreMolecules
Immune response, viral function, nucleic acid metabolism 46 26 
Cardiac hypertrophy, cardiovascular disease, developmental disorder 39 23 
Cancer, cell cycle, gastrointestinal disease 34 21 
Cancer, cellular growth and proliferation, hematologic disease 32 20 
Cardiovascular system development and function, cell morphology, cellular development 30 19 
Cancer, cellular movement, neurologic disease 21 15 
Amino acid metabolism, cancer, small-molecule biochemistry 21 15 
Cardiovascular system development and function, molecular transport, small-molecule biochemistry 20 14 
Cell signaling, nucleic acid metabolism, small-molecule biochemistry 18 13 
Organ morphology, reproductive system development and function, amino acid metabolism 18 13 
Cancer, cell death, gene expression 18 13 
Drug metabolism, molecular transport, nucleic acid metabolism 16 12 
 
Diseases and disorders P Molecules 
Cancer 1.45E−08 to 2.79E−03 100 
Viral function 2.66E−06 to 1.57E−03 
Organism injuries and abnormalities 2.84E−06 to 2.47E−03 29 
Dermatologic diseases and conditions 6.25E−06 to 3.91E−04 22 
Genetic disorder 6.25E−06 to 2.70E−03 12 
 
Molecular and cellular functions P Molecules 
Cell death 2.27E−08 to 2.79E−03 67 
Cellular growth and proliferation 2.86E−07 to 2.79E−03 69 
Cellular development 2.66E−06 to 2.72E−03 25 
Gene expression 9.07E−06 to 1.73E−03 34 
Cell cycle 1.50E−05 to 2.79E−03 34 

The distribution of the genes according to the diseases and disorders to which they might be related is also shown in Table 1. One hundred of these genes are involved in cancer development and progression. The functional analysis of the genes reveals that they are involved in cell growth and proliferation (69 molecules), cell death (67 molecules), cellular development, gene expression, and cell cycle regulation (Table 1). The results shown in Table 1 illustrate how BRCA1 loss can contribute to cancer development and progression. Because the changes in gene expression due to BRCA1 depletion are consistent with known processes, functions, and diseases associated with BRCA1, an investigation of specific genes from this dataset is supported.

Inhibition of BRCA1 leads to increased AREG mRNA expression

Loss of BRCA1 protein, as may occur in a breast cancer tumor cell, would be expected to result in a derepression of genes that the tumor suppressor normally inhibits. Genes that were significantly upregulated in our dataset and identified using IPA to affect cancer development and progression were selected from the microarray data and further validated by real-time PCR (Fig. 1B). AREG, EGR1, DDX58, KRT17, GDF15, and CCL5 were confirmed by real-time PCR (Fig. 1B). The genes BRE, Jun, and XRCC4 were not confirmed by real-time PCR and therefore excluded from the study. AREG, EGR1, DDX58, KRT17, GDF15, and CCL5 were all expressed in breast cancer cell lines according to IPA (Supplementary Table S4).

Among the genes upregulated in HeLa cells with depleted BRCA1, we have identified AREG and EGR1 to be of particular interest because both genes have been reported to have high levels of expression in breast cancer (21, 22); moreover, both genes were upregulated in Affymetrix microarray experiment and validated by quantitative real-time PCR. Affymetrix data revealed 3.7-fold increase in AREG mRNA, and quantitative reverse transcriptase-PCR (RT-PCR) revealed a 6.3-fold increase in AREG expression after depletion of BRCA1 by RNAi (Fig. 1B). Therefore, we conclude that the BRCA1 silencing leads to the increased AREG mRNA expression in HeLa cells. For EGR1, we have observed 2.5-fold increase in expression from Affymetrix data and 11.3-fold increase in quantitative real-time PCR (Fig. 1B). To eliminate the possibility of off-target effects, we depleted BRCA1 in HeLa cells using a siRNA targeting a different BRCA1 sequence than that specified by the shRNA used in the preceding experiments. The quantitative real-time PCR data revealed a 2.3-fold increase in AREG expression and 2.9-fold increase in EGR1 expression (Supplementary Fig. S1); therefore, we have concluded that AREG and EGR1 mRNA levels increase in response to BRCA1 depletion. Moreover, IPA analysis revealed that EGR1 is a downstream target for AREG (Fig. 1C; Supplementary Fig. S2) and indicated how genes identified by microarray and confirmed by quantitative real-time PCR can all be linked: AREG overexpression indirectly leads to EGR1 upregulation, which, in turn, stimulates growth differentiation factor 15 (GDF15). AREG has been reported to bind to EGFR and to activate it (23). Pathway analysis reveals that EGFR interacts with KRT17 and stimulates EGR1 expression, which, in turn, stimulates GDF15 (Fig. 1C). The stimulation of this module could be initiated by increases in AREG concentration. Our subsequent experiments are focused on AREG and EGR1 because the increases in mRNA levels for these genes ranked among the highest in the Affymetrix data, and both of these genes are linked to breast cancer.

BRCA1 binds to the AREG promoter

To test whether BRCA1 regulation of AREG is direct, we assayed, using the ChIP assay, for the presence of BRCA1 protein on the AREG promoter. Using either antibodies specific to BRCA1 or a matched preimmune serum, the quantitative real-time PCR of the immunoprecipitated DNA used primers covering two regions, −490/−184 and −201/+13, of the AREG promoter. We observed a 3- and 5-fold increase relative to the matched preimmune serum for the promoter regions at −490 to −184 and −201 to +13, respectively, relative to the mRNA start site (Fig. 2A and B). As a positive control, ChIP assay using antibody specific for histone H3 showed an 8.8-fold increase in PCR signal when compared with the negative control preimmune serum for the region −490/−184, and 37.3-fold increase when compared with the negative control preimmune serum for the region −201/+13 (data not shown). We conclude that BRCA1 is present on the AREG promoter and directly represses AREG transcription. Because histone H3 is certainly abundant in multiple sites on the AREG promoter, it is not surprising that the ChIP assay revealed a higher-fold increase relative to BRCA1. As an additional positive control, we assayed by ChIP for the presence of the Sp1 transcription factor on the AREG promoter using antibodies specific for Sp1 because its binding site is located at positions −3/−8 of the AREG promoter (ref. 15; Fig. 2A). As negative controls, we assayed by ChIP for AREG exon 4 (∼5.5 kb away from transcription start site) and exon 6 (∼9.8 kb away from the transcription start site) regions using antibodies specific for BRCA1 and Sp1. As shown in Fig. 2C, Sp1 and BRCA1 samples had an increase in relative promoter binding compared with the preimmune matched serum on the AREG regulatory region −490/−184. By contrast, neither Sp1 nor BRCA1 bound to the AREG exon 4 and AREG exon 6 regions. Taken together, these results indicate that BRCA1 indeed binds directly to the proximal promoter region of the AREG gene.

Figure 2.

BRCA1 is present on the AREG promoter but not on the EGR1 promoter. A, map of human AREG gene showing regulatory elements and exons that were used in ChIP assay. B, relative AREG promoter–BRCA1 and EGR1 promoter–BRCA1 associations in HeLa cells. Data derived from the quantitative real-time PCR are shown. Chromatin from HeLa cells was immunoprecipitated with preimmune serum (negative control) or with BRCA1-specific antiserum. For the AREG promoter, the primers for regions −490/−184 and −201/+13 were used; for the EGR1 promoter, the primers for region −108/−21 were used. Error bars show SEM from three experiments for the AREG promoter and from five experiments for the EGR1 promoter. C, positive and negative controls for ChIP assay on AREG promoter. Relative AREG promoter–BRCA1 and AREG promoter–Sp1 association in HeLa cells is illustrated. The data derived from the quantitative real-time PCR are shown. Chromatin from HeLa cells was immunoprecipitated with preimmune serum (negative control), with BRCA1-specific antiserum, or with Sp1-specific antiserum. For the AREG promoter, the primers for the region −490/−184 were used; for the negative controls, the primers for the regions of AREG exons 4 and 6 were used, and each experiment was done three times. For the negative control experiments, PCR products were obtained only for the input samples (data not shown). Error bars show the SEM from three experiments.

Figure 2.

BRCA1 is present on the AREG promoter but not on the EGR1 promoter. A, map of human AREG gene showing regulatory elements and exons that were used in ChIP assay. B, relative AREG promoter–BRCA1 and EGR1 promoter–BRCA1 associations in HeLa cells. Data derived from the quantitative real-time PCR are shown. Chromatin from HeLa cells was immunoprecipitated with preimmune serum (negative control) or with BRCA1-specific antiserum. For the AREG promoter, the primers for regions −490/−184 and −201/+13 were used; for the EGR1 promoter, the primers for region −108/−21 were used. Error bars show SEM from three experiments for the AREG promoter and from five experiments for the EGR1 promoter. C, positive and negative controls for ChIP assay on AREG promoter. Relative AREG promoter–BRCA1 and AREG promoter–Sp1 association in HeLa cells is illustrated. The data derived from the quantitative real-time PCR are shown. Chromatin from HeLa cells was immunoprecipitated with preimmune serum (negative control), with BRCA1-specific antiserum, or with Sp1-specific antiserum. For the AREG promoter, the primers for the region −490/−184 were used; for the negative controls, the primers for the regions of AREG exons 4 and 6 were used, and each experiment was done three times. For the negative control experiments, PCR products were obtained only for the input samples (data not shown). Error bars show the SEM from three experiments.

Close modal

In contrast to the results with the AREG promoter, ChIP experiments aiming to investigate whether BRCA1 binds the EGR1 promoter revealed the absence of BRCA1 on the EGR1 promoter (Fig. 2B), suggesting that the effect of BRCA1 on EGR1 transcript upregulation is indirect. This result is consistent with the outcome of the analysis using the IPA software, which showed that EGR1 stimulation is a downstream target of increasing AREG protein concentration (Fig. 1C; Supplementary Fig. S2). AREG is an extracellular ligand that interacts with the EGFR present on the surface of HeLa cells (24), leading to activation of a number of downstream genes, including EGR1, which was significantly increased by BRCA1 depletion.

BRCA1 repression of AREG transcription maps to two elements of the AREG promoter

We mapped the sequences of the AREG promoter DNA that are BRCA1 responsive, by using a gene expression reporter assay. The reporter construct contained the AREG regulatory sequence −643/+122 relative to the mRNA 5′ end previously described by Plowman and colleagues (15). The reporter gene, luciferase, was placed downstream of the AREG promoter. HeLa cells were transfected with the reporter plasmid, the plasmid that expresses the shRNA that specifies BRCA1 mRNA, and the plasmid carrying puromycin resistance. Cells that received these plasmids were then selected by growth in the presence of puromycin, and BRCA1 protein was effectively depleted (Fig. 3A; Supplementary Fig. S3).

Figure 3.

BRCA1 response elements map to positions −202/−182 and +19/+122 of the AREG promoter. A, shRNA-mediated BRCA1 depletion in HeLa cells. HeLa cells were transfected with a plasmid expressing shRNA specific for GFP (control, lane 1) or for BRCA1 (lane 2), reporter plasmid, and puromycin selection plasmid. Twenty-four hours after transfection, puromycin was added to the medium to select cells that received plasmid. Cell lysates were harvested 72 h after transfection, and Western blots were probed with antibodies against BRCA1 (top) and RNA polymerase II large subunit (Rpb1, loading control, bottom). The Western blot for samples transfected with the promoter-reporter construct containing the AREG regulatory sequence −202/+122 is shown. The examples of Western blots showing the samples transfected with other promoter-reporter constructs are shown in Supplementary Fig. S3. B, reporter gene assay in HeLa cells. Left, promoter-reporter constructs used in this study; right, results derived from the reporter gene assay. The control samples (control RNAi) are in black; the test samples (BRCA1 RNAi) are in white. Error bars represent SEM of three repeats.

Figure 3.

BRCA1 response elements map to positions −202/−182 and +19/+122 of the AREG promoter. A, shRNA-mediated BRCA1 depletion in HeLa cells. HeLa cells were transfected with a plasmid expressing shRNA specific for GFP (control, lane 1) or for BRCA1 (lane 2), reporter plasmid, and puromycin selection plasmid. Twenty-four hours after transfection, puromycin was added to the medium to select cells that received plasmid. Cell lysates were harvested 72 h after transfection, and Western blots were probed with antibodies against BRCA1 (top) and RNA polymerase II large subunit (Rpb1, loading control, bottom). The Western blot for samples transfected with the promoter-reporter construct containing the AREG regulatory sequence −202/+122 is shown. The examples of Western blots showing the samples transfected with other promoter-reporter constructs are shown in Supplementary Fig. S3. B, reporter gene assay in HeLa cells. Left, promoter-reporter constructs used in this study; right, results derived from the reporter gene assay. The control samples (control RNAi) are in black; the test samples (BRCA1 RNAi) are in white. Error bars represent SEM of three repeats.

Close modal

Depletion of BRCA1 led to 2.5-fold derepression of the reporter containing the AREG regulatory sequence −643/+122 (Fig. 3B). The deletion of region −643/−203 from the promoter-reporter construct revealed that this sequence was not important for the BRCA1 repression and therefore mapped the BRCA1-responsive region to −202/+122. These results for the BRCA1 repression of the reporter containing −202/+122 of the AREG promoter were validated using a siRNA specific for a different BRCA1 sequence, ruling out off-target effects as causing this repression (Supplementary Fig. S4). The comparison of the promoter-reporter constructs containing −202/+122 and −202/+19 fragments of the AREG promoter with the further progressive deletion constructs corresponding to −182/+122 and −182/+19 fragments revealed that BRCA1 depletion can lead to derepression of the reporters containing −202/+122, −202/+19, and −182/+122 fragments of the promoter but not −182/+19, leading to the conclusion that BRCA1 binds to two regions on the AREG promoter located at −202/−182 and +19/+122 positions. Moreover, these data illustrate that −202/−182 and +19/+122 BRCA1-responsive sites are independent.

BRCA1 regulates transcription on the variety of promoters; however, on its own, it does not bind DNA with sequence specificity (25, 26). Therefore, we hypothesize that BRCA1 protein binds indirectly to the −202/−182 and +19/+122 DNA elements through other factors specifically bound at these sites, and the identification of these other factors is the subject of continuing investigations.

BRCA1 represses AREG protein levels

The previous experiments have shown that BRCA1 is a transcriptional repressor of the AREG promoter. Depletion of BRCA1 by RNAi resulted in the increased AREG transcript level. According to the pathway analysis (Fig. 1C), the function of AREG protein can cause the upregulation of EGR1 gene that we observed (Fig. 1B). Thus, we tested whether BRCA1 control of AREG transcription could affect protein levels. Western blot analysis of BRCA1-depleted HeLa cell lysates revealed that RNAi targeting BRCA1 leads to the increase of AREG protein level (Fig. 4A). AREG has been reported to be present in cells as 16, 21, 25, and 28 kDa proteins (21). Our data reveal that a protein with migration consistent with a 25 kDa polypeptide and reactive with the AREG-specific antibody is induced following depletion of BRCA1 (Fig. 4A). This result supports the concept that BRCA1 protein represses AREG protein expression.

Figure 4.

BRCA1 controls AREG protein level. A, Western blot analysis of samples derived from the HeLa cell line. Using anti-AREG antibodies (top), the control sample (lane 1) was compared with the sample where BRCA1 was depleted by RNAi (lane 2). The BRCA1 depletion was confirmed using anti-BRCA1 antibodies (middle). The loading control was done using anti-RNA polymerase II large subunit antibody (Rpb1; bottom). B, Western blot analysis of samples derived from the SUM149PT cell line. Exogenous expression of BRCA1 in the BRCA1-mutant SUM149PT cell line (lane 2) resulted in a decrease in AREG protein levels (top, lane 2). The BRCA1 expression was confirmed using anti-BRCA1 antibodies (middle). The loading control was done using anti-TFIIH antibody specific for the 89 kDa subunit (bottom).

Figure 4.

BRCA1 controls AREG protein level. A, Western blot analysis of samples derived from the HeLa cell line. Using anti-AREG antibodies (top), the control sample (lane 1) was compared with the sample where BRCA1 was depleted by RNAi (lane 2). The BRCA1 depletion was confirmed using anti-BRCA1 antibodies (middle). The loading control was done using anti-RNA polymerase II large subunit antibody (Rpb1; bottom). B, Western blot analysis of samples derived from the SUM149PT cell line. Exogenous expression of BRCA1 in the BRCA1-mutant SUM149PT cell line (lane 2) resulted in a decrease in AREG protein levels (top, lane 2). The BRCA1 expression was confirmed using anti-BRCA1 antibodies (middle). The loading control was done using anti-TFIIH antibody specific for the 89 kDa subunit (bottom).

Close modal

AREG was reported to be upregulated in breast cancer (21); moreover, it is known that loss of BRCA1 function can lead to breast cancer development. We asked whether loss of BRCA1 can be connected to breast cancer pathology through AREG upregulation. As a model to study how BRCA1 silencing can affect AREG protein levels in breast tissue, we have chosen SUM149PT invasive breast carcinoma cell line that was reported to have low BRCA1 transcript level due to an inactivating mutation (27). Interestingly, published reports have shown that the SUM149PT cell line has increased AREG protein levels compared with the MCF10A cell line (21), indicating that BRCA1 loss and AREG upregulation could be related.

To test whether BRCA1 regulates AREG protein levels, we performed an experiment wherein BRCA1 was reexpressed in SUM149PT cells and compared the AREG level to untreated samples. The data shown in Fig. 4B illustrates that BRCA1 expression leads to the moderate yet significant decrease of the AREG protein level (25 kDa band). The fact that the effect was moderate was not surprising and could be explained by the fact that the transfection efficiency in SUM149PT cell line was ∼40% (data not shown).

Taken together, our data from two different cell lines show that BRCA1 regulates AREG expression. From this finding, we suggest a model in which loss of BRCA1 often observed in breast cancer patients results in AREG upregulation, which was shown to stimulate proliferation and migration (21).

The BRCA1 tumor suppressor has been shown to have various cellular roles, including transcription regulation, DNA damage repair, and cell cycle regulation (28). Loss of BRCA1 due to inactivation or mutation leads to cancer. Despite intensive study for several years, the question of how the loss of function of BRCA1 leads to cancer development and progression remains unresolved. In this study, we have found that (a) depletion of BRCA1 protein results in derepression of a number of genes, including AREG and EGR1; (b) BRCA1 binds to the AREG promoter but not the EGR1 promoter; (c) the AREG promoter contains two independent DNA sites that are responsive to BRCA1; and (d) AREG protein levels are controlled by BRCA1 protein. Taken together, these results suggest that a part of the tumorigenic phenotype of breast cancer might be explained through loss of BRCA1 repression of AREG gene expression.

To address the role of BRCA1 repression of transcription in tumor suppression, we first identified the genes that significantly change their expression levels in response to BRCA1 depletion in HeLa cells. We have chosen the HeLa cell line for our experiments because it is a well-characterized cell line that has endogenously expressed BRCA1; moreover, in HeLa, BRCA1 can be efficiently depleted. These data are in agreement with previously published results showing that BRCA1 can act both as a transcriptional repressor and as a transcriptional activator depending on the promoter context (12, 13). Among the genes that showed high fold change, we have selected those that were shown to play a role in cancer, among them AREG and EGR1. After confirming our Affymetrix results by real-time PCR, we have focused our further study on these two genes.

The comparison of our data in HeLa cells with published results from MCF10A mammary epithelial cells in three-dimensional culture following depletion of the BRCA1/CtIP/ZBRK1 repressor complex (29) revealed similar effect for AREG and EGR1. In that study, depletion of BRCA1 resulted in a 50% increase in expression of AREG and EGR1. Although the effect on these genes after BRCA1 depletion had a lower magnitude, the trend is in the same direction, suggesting that BRCA1 control of AREG is not limited to HeLa cells.

AREG and EGR1 upregulation of transcription as a response to BRCA1 depletion illustrates BRCA1 involvement in the regulation of these genes; however, the microarray results alone do not answer the question of whether BRCA1 directly regulates AREG and EGR1 transcription. ChIP data showed the presence of BRCA1 on AREG promoter but not on the EGR1 promoter. Moreover, EGR1 is a downstream effector in a gene activation cascade initiated by AREG (30). Taken together, our data suggest that BRCA1 is present on the AREG promoter and acts as a transcriptional repressor, and that EGR1 upregulation is secondary to AREG derepression when BRCA1 is depleted. Moreover, EGR1 leads to direct activation of GDF15, which is upregulated in breast cancer (refs. 31, 32; Fig. 1C); therefore, our data suggest how BRCA1, AREG, EGR1, and GDF15 can be connected together.

Because our data revealed that BRCA1 silencing is indirectly involved in the upregulation of EGR1 transcription, we have focused our further study on AREG. AREG is a member of the epidermal growth factor family and is a ligand of EGFR. It is expressed as a transmembrane precursor that is cleaved by ADAM17 protease and released to activate its receptor (23). Analysis of AREG-depleted mice revealed an essential role of AREG in mammary epithelial development (23, 33). AREG overexpression has been frequently observed in colon, breast, prostate, pancreas, lung, and ovarian cancer, as well as in squamous cell carcinomas and myeloma cells (3440). AREG can promote its own expression through the activation of EGFR in a positive-feedback AREG autocrine loop (21). Overexpression of AREG in MCF10A cell line leads to increased cell motility and invasion (21).

Although AREG function has been well described (21, 23, 41) and the AREG promoter has been characterized (15), a full understanding of AREG transcriptional control remains undetermined. Only a few transcription factors have been shown to regulate AREG transcription, among them Sp1 binding at positions −3/−8 (15), cAMP-responsive element binding protein binding at positions −57/−64 (42), and WT1 zinc finger transcription factor binding at positions −68/−84 of the AREG promoter (43). 17β-Estradiol has been shown to induce AREG mRNA expression through activation of estrogen receptor (44), although no estrogen response element is characterized on this promoter. None of these known enhancers correlates with the BRCA1 elements that we mapped, using the reporter assay, on the AREG promoter.

BRCA1 has been reported to regulate transcription on a variety of promoters; however, on its own, it binds DNA only in a non–sequence-specific manner (25, 26). BRCA1 can regulate transcription by interacting with other transcription factors that can bind to specific sites on DNA, and, in this way, BRCA1 alters the function of these transcription factors (28, 45). We have identified two independent BRCA1 response elements on the AREG promoter located at the −202/−182 and +19/+122 positions. We hypothesize that because BRCA1 is a transcriptional repressor of the AREG promoter, BRCA1 protein, in a complex with BARD1, binds to a sequence-specific transcription factor/activator bound to either of the identified DNA elements, and represses AREG expression (Fig. 5). Identification of the BRCA1 binding sequence-specific transcription factor(s) is the subject of continuing investigation.

Figure 5.

A model suggesting how BRCA1 loss of function might lead to AREG upregulation and contribute to cancer development and progression. A, a model illustrating BRCA1-dependent AREG regulation with intact BRCA1. B, a model illustrating BRCA1-dependent AREG regulation when BRCA1 protein is depleted.

Figure 5.

A model suggesting how BRCA1 loss of function might lead to AREG upregulation and contribute to cancer development and progression. A, a model illustrating BRCA1-dependent AREG regulation with intact BRCA1. B, a model illustrating BRCA1-dependent AREG regulation when BRCA1 protein is depleted.

Close modal

AREG is often overexpressed in breast cancer (46); moreover, AREG expression in breast cancer samples does not correlate with estrogen receptor α (ERα) (46, 47), and AREG and EGFR expression in invasive carcinomas is correlated with the absence of estrogen receptor (48). Tumors resulting from BRCA1 mutations are frequently ER independent. The ER-independent invasive ductal carcinoma cell line SUM149PT has been characterized by low BRCA1 transcript due to the 2288delT BRCA1 inactivating mutation (27) and has an increased AREG mRNA and protein levels (21). Our results suggest that there is a direct link to explain this prior observation. Our experiments show for the first time that BRCA1 depletion leads to AREG upregulation in the HeLa cell line, and BRCA1 expression in SUM149PT cell line leads to reduction in the amount of AREG protein, supporting the idea that BRCA1 controls AREG expression. Moreover, AREG overexpression in MCF10A leads to activation of the genes involved in cell mobility and invasion (21), which allows us to suggest that BRCA1 loss of function can contribute to cancer development and progression through AREG upregulation (Fig. 5). Taken together, our data suggest that a part of the tumorigenic phenotype of breast cancer might be explained through loss of BRCA1 repression of AREG gene expression.

No potential conflicts of interest were disclosed.

We thank Alice Smith (Institute of Cancer Research, London, United Kingdom) for her help with qPCR.

Grant Support: NIH grant CA90281 (J.D. Parvin) and start-up funds from Ohio State University Comprehensive Cancer Center. This work was also supported by Cancer Research UK grant C423/A7640 (to Prof. Sibylle Mittnacht, Institute of Cancer Research, London, United Kingdom).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Miki
Y
,
Swensen
J
,
Shattuck-Eidens
D
, et al
. 
A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1
.
Science
1994
;
266
:
66
71
.
2
Couch
FJ
. 
Genetic epidemiology of BRCA1
.
Cancer Biol Ther
2004
;
3
:
509
14
.
3
Magdinier
F
,
Ribieras
S
,
Lenoir
GM
,
Frappart
L
,
Dante
R
. 
Down-regulation of BRCA1 in human sporadic breast cancer; analysis of DNA methylation patterns of the putative promoter region
.
Oncogene
1998
;
17
:
3169
76
.
4
Turner
N
,
Tutt
A
,
Ashworth
A
. 
Hallmarks of “BRCAness” in sporadic cancers
.
Nat Rev Cancer
2004
;
4
:
814
9
.
5
Starita
LM
,
Parvin
JD
. 
The multiple nuclear functions of BRCA1: transcription, ubiquitination and DNA repair
.
Curr Opin Cell Biol
2003
;
15
:
345
50
.
6
Venkitaraman
AR
. 
Cancer susceptibility and the functions of BRCA1 and BRCA2
.
Cell
2002
;
108
:
171
82
.
7
Parvin
JD
,
Sankaran
S
. 
The BRCA1 E3 ubiquitin ligase controls centrosome dynamics
.
Cell Cycle
2006
;
5
:
1946
50
.
8
Chapman
MS
,
Verma
IM
. 
Transcriptional activation by BRCA1
.
Nature
1996
;
382
:
678
9
.
9
Scully
R
,
Anderson
SF
,
Chao
DM
, et al
. 
BRCA1 is a component of the RNA polymerase II holoenzyme
.
Proc Natl Acad Sci U S A
1997
;
94
:
5605
10
.
10
Anderson
SF
,
Schlegel
BP
,
Nakajima
T
,
Wolpin
ES
,
Parvin
JD
. 
BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A
.
Nat Genet
1998
;
19
:
254
6
.
11
Neish
AS
,
Anderson
SF
,
Schlegel
BP
,
Wei
W
,
Parvin
JD
. 
Factors associated with the mammalian RNA polymerase II holoenzyme
.
Nucleic Acids Res
1998
;
26
:
847
53
.
12
Horwitz
AA
,
Sankaran
S
,
Parvin
JD
. 
Direct stimulation of transcription initiation by BRCA1 requires both its amino and carboxyl termini
.
J Biol Chem
2006
;
281
:
8317
20
.
13
Horwitz
AA
,
Affar el
B
,
Heine
GF
,
Shi
Y
,
Parvin
JD
. 
A mechanism for transcriptional repression dependent on the BRCA1 E3 ubiquitin ligase
.
Proc Natl Acad Sci U S A
2007
;
104
:
6614
9
.
14
Sui
G
,
Soohoo
C
,
Affar el
B
, et al
. 
A DNA vector-based RNAi technology to suppress gene expression in mammalian cells
.
Proc Natl Acad Sci U S A
2002
;
99
:
5515
20
.
15
Plowman
GD
,
Green
JM
,
McDonald
VL
, et al
. 
The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity
.
Mol Cell Biol
1990
;
10
:
1969
81
.
16
Livak
KJ
,
Schmittgen
TD
. 
Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔC(T)) method
.
Methods
2001
;
25
:
402
8
.
17
Schlegel
BP
,
Starita
LM
,
Parvin
JD
. 
Overexpression of a protein fragment of RNA helicase A causes inhibition of endogenous BRCA1 function and defects in ploidy and cytokinesis in mammary epithelial cells
.
Oncogene
2003
;
22
:
983
91
.
18
Xu
X
,
Weaver
Z
,
Linke
SP
, et al
. 
Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells
.
Mol Cell
1999
;
3
:
389
95
.
19
Scully
R
,
Ganesan
S
,
Brown
M
, et al
. 
Location of BRCA1 in human breast and ovarian cancer cells
.
Science
1996
;
272
:
123
6
.
20
Starita
LM
,
Machida
Y
,
Sankaran
S
, et al
. 
BRCA1-dependent ubiquitination of γ-tubulin regulates centrosome number
.
Mol Cell Biol
2004
;
24
:
8457
66
.
21
Willmarth
NE
,
Ethier
SP
. 
Autocrine and juxtacrine effects of amphiregulin on the proliferative, invasive, and migratory properties of normal and neoplastic human mammary epithelial cells
.
J Biol Chem
2006
;
281
:
37728
37
.
22
Bieche
I
,
Lerebours
F
,
Tozlu
S
,
Espie
M
,
Marty
M
,
Lidereau
R
. 
Molecular profiling of inflammatory breast cancer: identification of a poor-prognosis gene expression signature
.
Clin Cancer Res
2004
;
10
:
6789
95
.
23
Sternlicht
MD
,
Sunnarborg
SW
,
Kouros-Mehr
H
,
Yu
Y
,
Lee
DC
,
Werb
Z
. 
Mammary ductal morphogenesis requires paracrine activation of stromal EGFR via ADAM17-dependent shedding of epithelial amphiregulin
.
Development
2005
;
132
:
3923
33
.
24
Sigismund
S
,
Woelk
T
,
Puri
C
, et al
. 
Clathrin-independent endocytosis of ubiquitinated cargos
.
Proc Natl Acad Sci U S A
2005
;
102
:
2760
5
.
25
Paull
TT
,
Cortez
D
,
Bowers
B
,
Elledge
SJ
,
Gellert
M
. 
Direct DNA binding by Brca1
.
Proc Natl Acad Sci U S A
2001
;
98
:
6086
91
.
26
Simons
AM
,
Horwitz
AA
,
Starita
LM
, et al
. 
BRCA1 DNA-binding activity is stimulated by BARD1
.
Cancer Res
2006
;
66
:
2012
8
.
27
Elstrodt
F
,
Hollestelle
A
,
Nagel
JH
, et al
. 
BRCA1 mutation analysis of 41 human breast cancer cell lines reveals three new deleterious mutants
.
Cancer Res
2006
;
66
:
41
5
.
28
Mullan
PB
,
Quinn
JE
,
Harkin
DP
. 
The role of BRCA1 in transcriptional regulation and cell cycle control
.
Oncogene
2006
;
25
:
5854
63
.
29
Furuta
S
,
Wang
JM
,
Wei
S
, et al
. 
Removal of BRCA1/CtIP/ZBRK1 repressor complex on ANG1 promoter leads to accelerated mammary tumor growth contributed by prominent vasculature
.
Cancer Cell
2006
;
10
:
13
24
.
30
Kimura
H
. 
Schwannoma-derived growth factor must be transported into the nucleus to exert its mitogenic activity
.
Proc Natl Acad Sci U S A
1993
;
90
:
2165
9
.
31
Wollmann
W
,
Goodman
ML
,
Bhat-Nakshatri
P
, et al
. 
The macrophage inhibitory cytokine integrates AKT/PKB and MAP kinase signaling pathways in breast cancer cells
.
Carcinogenesis
2005
;
26
:
900
7
.
32
Welsh
JB
,
Sapinoso
LM
,
Kern
SG
, et al
. 
Large-scale delineation of secreted protein biomarkers overexpressed in cancer tissue and serum
.
Proc Natl Acad Sci U S A
2003
;
100
:
3410
5
.
33
Luetteke
NC
,
Qiu
TH
,
Fenton
SE
, et al
. 
Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development
.
Development
1999
;
126
:
2739
50
.
34
Normanno
N
,
De Luca
A
,
Bianco
C
, et al
. 
Epidermal growth factor receptor (EGFR) signaling in cancer
.
Gene
2006
;
366
:
2
16
.
35
Salomon
DS
,
Normanno
N
,
Ciardiello
F
,
Brandt
R
,
Shoyab
M
,
Todaro
GJ
. 
The role of amphiregulin in breast cancer
.
Breast Cancer Res Treat
1995
;
33
:
103
14
.
36
Bostwick
DG
,
Qian
J
,
Maihle
NJ
. 
Amphiregulin expression in prostatic intraepithelial neoplasia and adenocarcinoma: a study of 93 cases
.
Prostate
2004
;
58
:
164
8
.
37
Ebert
M
,
Yokoyama
M
,
Kobrin
MS
, et al
. 
Induction and expression of amphiregulin in human pancreatic cancer
.
Cancer Res
1994
;
54
:
3959
62
.
38
Fontanini
G
,
De Laurentiis
M
,
Vignati
S
, et al
. 
Evaluation of epidermal growth factor-related growth factors and receptors and of neoangiogenesis in completely resected stage I-IIIA non-small-cell lung cancer: amphiregulin and microvessel count are independent prognostic indicators of survival
.
Clin Cancer Res
1998
;
4
:
241
9
.
39
Tsai
ST
,
Yang
KY
,
Jin
YT
,
Lin
YC
,
Chang
MT
,
Wu
LW
. 
Amphiregulin as a tumor promoter for oral squamous cell carcinoma: involvement of cyclooxygenase 2
.
Oral Oncol
2006
;
42
:
381
90
.
40
D'Antonio
A
,
Losito
S
,
Pignata
S
, et al
. 
Transforming growth factor α, amphiregulin and cripto-1 are frequently expressed in advanced human ovarian carcinomas
.
Int J Oncol
2002
;
21
:
941
8
.
41
Berasain
C
,
Castillo
J
,
Perugorria
MJ
,
Prieto
J
,
Avila
MA
. 
Amphiregulin: a new growth factor in hepatocarcinogenesis
.
Cancer Lett
2007
;
254
:
30
41
.
42
O'Reilly
SM
,
Leonard
MO
,
Kieran
N
, et al
. 
Hypoxia induces epithelial amphiregulin gene expression in a CREB-dependent manner
.
Am J Physiol Cell Physiol
2006
;
290
:
C592
600
.
43
Lee
SB
,
Huang
K
,
Palmer
R
, et al
. 
The Wilms tumor suppressor WT1 encodes a transcriptional activator of amphiregulin
.
Cell
1999
;
98
:
663
73
.
44
Martinez-Lacaci
I
,
Saceda
M
,
Plowman
GD
, et al
. 
Estrogen and phorbol esters regulate amphiregulin expression by two separate mechanisms in human breast cancer cell lines
.
Endocrinology
1995
;
136
:
3983
92
.
45
Benezra
M
,
Chevallier
N
,
Morrison
DJ
,
MacLachlan
TK
,
El-Deiry
WS
,
Licht
JD
. 
BRCA1 augments transcription by the NF-κB transcription factor by binding to the Rel domain of the p65/RelA subunit
.
J Biol Chem
2003
;
278
:
26333
41
.
46
Qi
CF
,
Liscia
DS
,
Normanno
N
, et al
. 
Expression of transforming growth factor α, amphiregulin and cripto-1 in human breast carcinomas
.
Br J Cancer
1994
;
69
:
903
10
.
47
LeJeune
S
,
Leek
R
,
Horak
E
,
Plowman
G
,
Greenall
M
,
Harris
AL
. 
Amphiregulin, epidermal growth factor receptor, and estrogen receptor expression in human primary breast cancer
.
Cancer Res
1993
;
53
:
3597
602
.
48
Ma
L
,
de Roquancourt
A
,
Bertheau
P
, et al
. 
Expression of amphiregulin and epidermal growth factor receptor in human breast cancer: analysis of autocriny and stromal-epithelial interactions
.
J Pathol
2001
;
194
:
413
9
.