Hepatocellular carcinoma (HCC) is generally a fatal disease due to a paucity of effective treatment options. The identification of oncogenic microRNAs that exert pleiotropic effects in HCC cells may offer new therapeutic targets. In this study, we have identified the human microRNA miR-191 as a potential target for HCC therapy. Inhibition of miR-191 decreased cell proliferation and induced apoptosis in vitro and significantly reduced tumor masses in vivo in an orthotopic xenograft mouse model of HCC. Additionally, miR-191 was found to be upregulated by a dioxin, a known liver carcinogen, and was found to be a regulator of a variety of cancer-related pathways. Our findings offer a preclinical proof of concept for miR-191 targeting as a rational strategy to pursue for improving HCC treatment. Cancer Res; 70(20); 8077–87. ©2010 AACR.

MicroRNAs (miR) are a class of small RNA molecules that regulate gene expression (1). Their activity is a result of duplex formation between the miR and the 3′ untranslated region (UTR) of targeted mRNAs. This results in translational silencing by either mRNA degradation or translation blocking. Expression studies indicate significant changes in miR expression in different disease states compared with normal tissue (2). Specifically, several studies have reported that various miRs are deregulated in hepatocellular carcinoma (HCC) tissue samples relative to nontumor liver controls (310). HCC is the fifth most common cancer in the world, and the third leading cause of cancer deaths with poor prognosis in most cases. Standard chemotherapy usually has no beneficial outcome on HCC patients. Sorafenib was recently approved for use in HCC and shown to increase survival by 3 months (11). It is still extremely important to search for new therapeutic modalities and novel therapeutic targets to generate effective therapies for this fatal disease. Because miRs are master regulators of gene expression, their deregulation in diseases can trigger changes that lead to the disease phenotype, and the modulation of their activity can be a key to the development of novel therapies.

In this study, we propose the involvement of miR-191 in HCC. miR-191 was previously identified as being upregulated in some solid tumors, but not in HCC, and no functional or mechanistic data were reported (12, 13). We show that miR-191 is upregulated in liver cancer tissue and that its inhibition by a 2-O-metoxyethyl (MOE) anti-miR can reverse the cancerous phenotype of human HCC cells, both in vitro and in vivo. Thus, this compound has the potential of being a novel therapeutic for HCC. We also propose a role for miR-191 in the mechanism, toxicity, and carcinogenesis of dioxins, a family of environmental pollutants, and show the involvement of this miR in cancer-related pathways.

miR expression profiling

Patients and samples.

Southeast Asian samples were received as fresh-frozen tissues from Dr. Jung Hwan Yoon (Seoul National University College of Medicine, Seoul, South Korea). Samples were taken from 30 HCC patients and included tumor and adjacent to tumor tissue from each patient. Caucasian samples were purchased from Indivumed GmbH as formalin-fixed, paraffin-embedded sections. Institutional review approvals were obtained for all samples in accordance with each institute's Institutional Review Board (IRB) or IRB-equivalent guidelines.

RNA extraction.

Total RNA was extracted from frozen tissue using the miRvana miRNA isolation kit (Ambion) according to the manufacturer's instructions. Total RNA from formalin-fixed, paraffin-embedded samples was isolated from 7- to 10-μm-thick tissue sections as previously described (14). EZ-RNA II kit (Biological Industries) was used for total RNA extraction from cell lines.

MicroRNA microarray platform.

Samples were measured using custom miR microarrays as previously described (14).

Quantitative reverse transcription-PCR for miRs.

Samples were measured by quantitative real-time PCR as previously described (15).

Anti-miR chemistry

2′-MOE–modified oligonucleotides were synthesized by Isis Pharmaceuticals as previously described (16) on AKTA Oligopilot 10 (Amersham/GE Healthcare) oligonucleotide synthesizer and purified by ion exchange chromatography on an AKTA Explorer (GE Healthcare) high-performance liquid chromatography (HPLC) system on a strong anion exchange column. Anti-miRs were characterized by ion-pair HPLC mass spectrometric analysis with Agilent 1100 MSD system. The anti–miR-191 sequence was AGCTGCTTTTGGGATTCCGTTG and the negative control anti-miR was ACATACTCCTTTCTCAGAGTCCA, which is the reverse complement sequence of miR-122a with six mismatches, thus being an irrelevant sequence.

Tissue culture work

Cell growth and transfections.

Hep3B, SNU423, and HepG2 cell lines were purchased from the American Type Culture Collection. Cells were grown under standard growth conditions. Transfection of cells with anti-miRs was done using Oligofectamine (Invitrogen) or with Lipofectamine 2000 reagent (Invitrogen) when both anti-miRs and vectors were transfected, according to the manufacturer's instructions.

Induction of miR-191 expression by TCDD in tissue culture.

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) from Supelco (Sigma) in toluene was diluted in DMSO to 1 μmol/L concentration. Cells were grown and treated with 10 nmol/L TCDD in serum-free media. Exposure to TCDD was for 24 to 48 hours.

Cell proliferation assay.

Cells were transfected with anti-miR at a concentration range of 20 to 300 nmol/L, in triplicates. Seventy-two hours after transfection, cells were tested for proliferation using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega), according to the manufacturer's instructions.

Caspase-3/7 activation.

Cells were transfected in triplicates with 50 to 200 nmol/L anti-miRs. Apoptosis was assessed by measuring caspase level 24 hours after transfection using Apo-ONE Homogenous Caspase-3/7 Assay kit (Promega).

Dual-luciferase reporter assay.

Reverse complement sequences to selected miRs were inserted into the 3′-UTR of Renilla luciferase in psiCHECK-2 vector (Promega). Cells were transfected in triplicates with the vector or cotransfected with a vector and an anti-miR. Luminescence was assayed 24 and 48 hours later using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. Results were normalized to the constitutively expressed firefly luciferase from the same vector and shown as the ratio between the various treatments and cells transfected with a nonmodified vector.

Cancer pathway reporter array.

Cignal Finder 10-Pathway Reporter Array (SABiosciences) was used. Reverse transfection technique was implemented. Cells were treated with anti–miR-191 or negative control anti-miR. Relative firefly luciferase activity was calculated and normalized to the constitutively expressed Renilla luciferase.

3′-UTR reporter assay for miR target validation.

Cells were transfected with luciferase reporter plasmids harboring the complete 3′-UTR of the desired gene (SwitchGear Genomics), and the relevant treatment of anti-miR or miR-mimic. Luminescence was assayed 24 hours later using Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. Results were normalized to a signal from a control vector harboring nonrelevant sequence of 2,500 bp (R01 control from SwitchGear) and shown as the fold change between miR-191 and a negative control treatment for both the mimic and the anti-miR treatments. t test was performed for wells from multiple experiments, and we compared populations of the mimic-treated cells with a mimic control and anti-miR–treated cells with anti-miR control for each gene vector.

Chromatin immunoprecipitation assay.

HepG2 cells were treated with TCDD at 10 nmol/L. Cells were than fixed and prepared for chromatin immunoprecipitation (ChIP). The immunoprecipitation was performed at Genepathway, and the binding of chromatin to the precipitated transcription factor (TF) was quantified by quantitative reverse transcription-PCR (qRT-PCR).

Affymetrix arrays.

RNA was extracted from HepG2 cells transfected with anti–miR-191 or negative control anti-miR, and from untreated cells. mRNA expression was measured onto GeneChip Affymetrix arrays at the Biological Services Unit, Weizmann Institute.

In vivo orthotopic model.

Animal experiments were conducted at Harlan Biotech Israel. The study was performed following an application form review and approval by the Committee for Ethical Conduct in the Care and Use of Laboratory Animals. Mice were provided with ad libitum diet and free access to water. HepG2 cells were mixed with Matrigel Basement Membrane Matrix (BD Biosciences) and injected s.c. to BALB/c nude male mice. Subcutaneous tumors were harvested and implanted intrahepatically. Anti-miR administration (50 mg/kg) was done by a total of 19 repeated i.p. injections every other day, starting 2 days after induction and continued throughout the entire observation period. At day 40 after orthotopic tumor implantation, the study was terminated; tumor mass, liver, and spleen were excised and weighed. The significance of the differences of tumor sizes was calculated by a two-sided rank sum test.

Immunohistochemistry.

Formalin-fixed, paraffin-embedded tumor sections were immunostained using rabbit monoclonal antibody to Ki67 (Abcam). Three nonoverlapping fields per section/sample were photographed, and Ki67-positive and Ki67-negative tumor cell nuclei were counted. Proliferation index was calculated as the ratio of Ki67-positive cells from the total number of cells counted per each field.

Expression of miRs in HCC, selecting the potential miR targets

Comparing miR expression profiles in biopsy samples of HCC and adjacent noncancerous liver tissues from patients (Table 1A) revealed several differentially expressed miRs (Supplementary Fig. S1; Table 1B and C). The miRs that were upregulated or highly expressed in tumors were selected for screening in in vitro proliferation assays in cell lines using anti-miRs with MOE chemical modification. IC50 values were calculated from proliferation assays in two HCC cell lines: Hep3B and SNU423 (Table 1B). Among the miRs with significant differential expression, only a few miRs showed potential as drug targets for HCC therapy. The inhibition of these miRs by MOE-modified anti-miRs caused changes in cellular phenotype such as reduced proliferation and increased apoptotic response in a dose-dependent manner. One of the promising miRs was miR-191, which was found to be upregulated in HCC and expressed at a higher level in HCC cell lines compared with immortalized normal hepatocytes (THLE-2; data not shown).

Table 1.

Expression of microRNA in tissues from HCC patients

A. Patient information (37 patients)
Origin 81% Southeast Asia 
19% Caucasians 
Age, y (average, min–max) 61, 34–82 
Gender 84% M 
16% F 
T1-T2 59% 
T3-T4 41% 
Etiology HBV 70% 
HCV 11% 
No viral infection 19% 
B. Upregulated miRs 
miR Fold change P IC50 
SNU423 Hep3B 
hsa-miR-222 3.25 <0.0001 150 250 
hsa-miR-221 2.83 <0.0001 ND >300 
hsa-miR-21 2.81 <0.0001 200 250 
hsa-miR-331 1.96 <0.0001 >300 >300 
hsa-miR-15b 1.93 0.0004 ND ND 
hsa-miR-105 1.93 <0.0001 ND ND 
hsa-miR-107 1.93 0.0009 ND ND 
hsa-miR-638 1.91 0.023 250 70 
hsa-miR-103 1.85 0.0055 >300 >300 
hsa-miR-93 1.80 0.0001 >300 ∼300 
hsa-let-7d 1.75 0.0006 ND ND 
hsa-miR-191 1.72 0.0061 75 100 
hsa-let-7a 1.68 0.0108 ND ND 
hsa-miR-210 1.66 0.0003 300 >300 
hsa-miR-193a 1.60 0.011 ND ND 
hsa-miR-181b 1.54 0.0012 120 >300 
hsa-miR-17-3p 1.54 0.004 >300 >300 
hsa-miR-16 1.53 0.0381 >300 ∼300 
hsa-miR-30d 1.51 0.003 ND ND 
hsa-miR-339 1.49 0.0002 ND ND 
hsa-miR-181a 1.48 0.0381 >300 >300 
hsa-miR-18a 1.43 0.0082 ND ND 
hsa-miR-345 1.43 0.0004 ND ND 
hsa-miR-423-5p 1.43 0.0208 ND ND 
hsa-miR-423-3p 1.43 0.0398 50 ∼300 
hsa-miR-185 1.43 0.0049 120 >300 
hsa-miR-483 1.38 0.0148 ND ND 
 
C. Downregulated miRs 
miR Fold change P 
hsa-miR-199a 3.25 <0.0001 
hsa-miR-199a* 2.14 0.0001 
hsa-miR-22 1.69 0.0002 
hsa-miR-99a 1.61 0.0120 
hsa-miR-130a 1.52 0.0063 
hsa-miR-195 1.45 0.0029 
hsa-miR-378 1.45 0.0231 
hsa-miR-497 1.45 0.0213 
A. Patient information (37 patients)
Origin 81% Southeast Asia 
19% Caucasians 
Age, y (average, min–max) 61, 34–82 
Gender 84% M 
16% F 
T1-T2 59% 
T3-T4 41% 
Etiology HBV 70% 
HCV 11% 
No viral infection 19% 
B. Upregulated miRs 
miR Fold change P IC50 
SNU423 Hep3B 
hsa-miR-222 3.25 <0.0001 150 250 
hsa-miR-221 2.83 <0.0001 ND >300 
hsa-miR-21 2.81 <0.0001 200 250 
hsa-miR-331 1.96 <0.0001 >300 >300 
hsa-miR-15b 1.93 0.0004 ND ND 
hsa-miR-105 1.93 <0.0001 ND ND 
hsa-miR-107 1.93 0.0009 ND ND 
hsa-miR-638 1.91 0.023 250 70 
hsa-miR-103 1.85 0.0055 >300 >300 
hsa-miR-93 1.80 0.0001 >300 ∼300 
hsa-let-7d 1.75 0.0006 ND ND 
hsa-miR-191 1.72 0.0061 75 100 
hsa-let-7a 1.68 0.0108 ND ND 
hsa-miR-210 1.66 0.0003 300 >300 
hsa-miR-193a 1.60 0.011 ND ND 
hsa-miR-181b 1.54 0.0012 120 >300 
hsa-miR-17-3p 1.54 0.004 >300 >300 
hsa-miR-16 1.53 0.0381 >300 ∼300 
hsa-miR-30d 1.51 0.003 ND ND 
hsa-miR-339 1.49 0.0002 ND ND 
hsa-miR-181a 1.48 0.0381 >300 >300 
hsa-miR-18a 1.43 0.0082 ND ND 
hsa-miR-345 1.43 0.0004 ND ND 
hsa-miR-423-5p 1.43 0.0208 ND ND 
hsa-miR-423-3p 1.43 0.0398 50 ∼300 
hsa-miR-185 1.43 0.0049 120 >300 
hsa-miR-483 1.38 0.0148 ND ND 
 
C. Downregulated miRs 
miR Fold change P 
hsa-miR-199a 3.25 <0.0001 
hsa-miR-199a* 2.14 0.0001 
hsa-miR-22 1.69 0.0002 
hsa-miR-99a 1.61 0.0120 
hsa-miR-130a 1.52 0.0063 
hsa-miR-195 1.45 0.0029 
hsa-miR-378 1.45 0.0231 
hsa-miR-497 1.45 0.0213 

In vitro activity of anti–miR-191

The reduction of miR-191 level following its inhibition was tested in Hep3B cells treated with an anti-miR specific for miR-191. miR expression was studied using total RNA extracted from anti-miR–treated and control-treated cells by custom-made miR microarray. Detecting miRs in anti-miR–treated cells or tissues can lead to artifactual results because of anti-miR presence. Hence, we performed control experiments that show that the MOE anti-miR was not simply blocking detection of miR-191. Only minor changes in the expression of other miRs were observed, whereas miR-191 levels were reduced in the treated cells (Fig. 1A). Similar results obtained for SNU423 cells are shown in Supplementary Data.

Figure 1.

In vitro activity of anti–miR-191. A, miR microarray data following miR-191 inhibition by anti-miR in Hep3B cells showing a downregulation of miR-191, with small change in all other miRs. B, Hep3B cells treated with anti–miR-191 showed increase in activation of caspase-3/7 compared with cells treated with negative control anti-miR. C, cells treated with increasing amounts of anti–miR-191 exhibited reduction in proliferation compared with the negative control anti-miR. D, dual-luciferase system using plasmid with modified Renilla 3′-UTR of reverse complement sequence to miR-191 and a negative control–modified plasmid. Cells were cotransfected with plasmid and anti–miR-191, negative control anti-miR, mimic of miR-191, or a mimic negative control. Signals were normalized to firefly luciferase and calculated as the ratio of the unmodified plasmid psiCHECK-2.

Figure 1.

In vitro activity of anti–miR-191. A, miR microarray data following miR-191 inhibition by anti-miR in Hep3B cells showing a downregulation of miR-191, with small change in all other miRs. B, Hep3B cells treated with anti–miR-191 showed increase in activation of caspase-3/7 compared with cells treated with negative control anti-miR. C, cells treated with increasing amounts of anti–miR-191 exhibited reduction in proliferation compared with the negative control anti-miR. D, dual-luciferase system using plasmid with modified Renilla 3′-UTR of reverse complement sequence to miR-191 and a negative control–modified plasmid. Cells were cotransfected with plasmid and anti–miR-191, negative control anti-miR, mimic of miR-191, or a mimic negative control. Signals were normalized to firefly luciferase and calculated as the ratio of the unmodified plasmid psiCHECK-2.

Close modal

Changes of cellular phenotypes such as increased caspase activation and reduced proliferation after miR-191 inhibition are shown in Fig. 1B and C. Hep3B cells were transfected with increasing amounts of anti–miR-191 or a negative control anti-miR. Cells exhibited reduction in proliferation following anti–miR-191 transfection, but not in the presence of a negative control anti-miR, indicating no general toxic effect associated with anti-miRs of this type or the transfection reagents. The proliferation inhibition of anti–miR-191 showed an IC50 of 100 and 75 nmol/L for Hep3B and SNU423, respectively. Caspase-3/7 activation also increased with increasing concentration of anti–miR-191, indicating apoptosis induction following miR inhibition.

To verify that the anti-miR specifically inhibits miR-191, a reporter assay using dual-luciferase vectors was performed in which the reverse complement sequence of miR-191 was cloned into the 3′-UTR of the reporter. Endogenous miR-191 represses the reporter expression by ∼40% (Fig. 1E), and the cotransfection of the reporter vector together with anti–miR-191 causes derepression of the reporter. The response is specific because the control anti-miR could not abolish the miR regulation of the reporter. Moreover, the endogenous miR-191 did not change the expression of the reporter transcribed from a control plasmid harboring an altered 3′-UTR with a nonrelevant sequence. The same system was also tested with a miR-mimic for miR-191, which completely repressed reporter expression, whereas a control mimic did not. These results show the specificity of the miR activity and the specificity of the inhibition of miR-191 by anti–miR-191.

Transcriptional regulation of miR-191 by dioxin

To elucidate possible pathways underlying miR-191 upregulation in HCC patients, we studied the transcriptional regulation of this miR by examining its transcription unit and the TFs that can in part govern it transcription. Studies to date have shown that mature miR expression can be altered by regulation of its biogenesis steps (e.g., Drosha and Dicer activity; refs. 17, 18), as well as by transcriptional activation (19, 20).

Location of the transcription start site (TSS) was predicted according to known transcripts, expressed sequence tags, and CpG islands, and it was found that miR-191 is transcribed at an intronic region of the gene DALR anti-codon binding domain containing 3 (DALRD3; RefSeq NM_018114). We searched for TF binding sites (TFBS) in a region covering ±2,000 bp from the TSS, and the aryl hydrocarbon receptor (AhR)/AhR nuclear translocator (Arnt) TFBS motif (21) was predicted at location chr3:49034919-49034937. ChIP assay was conducted to validate the TFBS and the involvement of this TF in the transcriptional regulation of this miR. TCDD that belongs to a family of environmental pollutants (dioxins; Fig. 2A) was used as an activator for the TF because it is a known ligand for AhR (22) and activates this TF to induce the expression of CYP1 proteins (Fig. 2B; ref. 23). CYP1A1 was chosen as a positive control gene in the ChIP assay. This gene has two TFBS for the AhR/Arnt TF in its promoter, and therefore, both were tested in the assay.

Figure 2.

Transcriptional regulation of miR-191. A, molecular structure of TCDD, activator of the AhR pathway. B, a schematic representation of cytoplasmic AhR activation by TCDD. C, ChIP assay for AhR validated the binding of the TF to the promoter of miR-191. Two binding domains for CYP1A1 served as positive control. D, HepG2 cells treated with 10 nmol/L TCDD exhibited increased miR-191 and miR-181 cluster expression compared with untreated cells.

Figure 2.

Transcriptional regulation of miR-191. A, molecular structure of TCDD, activator of the AhR pathway. B, a schematic representation of cytoplasmic AhR activation by TCDD. C, ChIP assay for AhR validated the binding of the TF to the promoter of miR-191. Two binding domains for CYP1A1 served as positive control. D, HepG2 cells treated with 10 nmol/L TCDD exhibited increased miR-191 and miR-181 cluster expression compared with untreated cells.

Close modal

Figure 2C summarizes the results of the ChIP assay using a specific antibody for AhR. AhR was found to bind the promoter of miR-191 transcript, with or without the TCDD activation; hence, it is suggested that miR-191 upregulation can be regulated by this promoter. When HepG2 cells treated with TCDD were studied for their miR expression by miR microarray, miR-191 expression was shown to be elevated 2.4-fold in treated cells after 48 hours, as seen in Fig. 2D. miR-181a, miR-181b, and miR-181a*, all found in one genomic cluster, were also upregulated, and studying their promoter revealed an AhR/Arnt TFBS on one of the genomic loci of this cluster. This is the first demonstration of miR involvement in the toxicology of dioxins.

Pathway and miR target modulation by anti–miR-191

RNA from cells transfected with anti–miR-191 was studied for mRNA changes using GeneChip array (Affymetrix) that includes 28K annotated genes. Upregulated genes from cells treated with anti–miR-191 were compared with both untreated cells and cells that were treated with a negative control oligonucleotide (both controls showed similar expression results). The false detection rate was set stringently at 0.05 and resulted with 184 genes significantly upregulated. The list of upregulated genes is added to Supplementary Data. Looking at the top list of upregulated genes, 4-fold and up (Table 2), showed enrichment of 8.8-fold (P = 0.0145) for miR-191 predicted targets (predicted by TargetScan).

Table 2.

Upregulated genes after miR-191 inhibition

AccessionGene symbolFold changePPredicted target for miR-191Description
ENST00000386760 — 15.7 0.002   
NM_000499 CYP1A1 15.0 0.001  Cytochrome P450, family 1, subfamily A, polypeptide 1 
NM_020801 ARRDC3 9.8 <0.001 Yes Arrestin domain containing 3 
NM_004417 DUSP1 9.4 0.001  Dual specificity phosphatase 1 
EU126604 KPNA7 8.7 0.002  Karyopherin 7 
ENST00000314371 — 8.4 <0.001   
NM_001945 HBEGF 7.4 0.001 Yes Heparin-binding EGF-like growth factor 
NM_002229 JUNB 7.3 0.002  Jun B proto-oncogene 
ENST00000379981 LOC388022 7.0 0.001   
NM_001031716 OBFC2A 6.7 0.002 Yes Oligonucleotide/oligosaccharide-binding fold containing 2A 
NM_145039 CENPBD1 6.7 <0.001  CENPB DNA-binding domains containing 1 
NM_002309 LIF 6.7 0.001  Leukemia inhibitory factor (cholinergic differentiation factor) 
NM_001124 ADM 6.5 <0.001  Adrenomedullin 
NM_001040619 ATF3 6.5 0.001  Activating transcription factor 3 
NM_024847 TMC7 6.1 <0.001 Yes Transmembrane channel-like 7 
NM_019096 GTPBP2 5.8 0.002  GTP binding protein 2 
NM_003548 HIST2H4A 5.7 0.002  Histone cluster 2, H4a 
NM_031459 SESN2 5.6 0.002  Sestrin 2 
NM_001300 KLF6 5.4 <0.001  Kruppel-like factor 6 
AK023048 AK023048 5.1 0.003  SubName: Full = cDNA FLJ50766; 
NM_021724 NR1D1 4.9 0.002 Yes Nuclear receptor subfamily 1, group D, member 1 
BC039295 FAM126B 4.9 0.001  Hypothetical protein LOC285172 
NM_001964 EGR1 4.6 0.001 Yes Early growth response 1 
NM_020307 CCNL1 4.5 0.002  Cyclin L1 
NM_004040 RHOB 4.4 <0.001  Ras homologue gene family, member B 
NM_020127 TUFT1 4.3 0.002  Tuftelin 1 
NM_005904 SMAD7 4.3 0.001  SMAD family member 7 
NM_015508 TIPARP 4.3 <0.001  TCDD-inducible poly(ADP-ribose) polymerase 
NM_004723 ARHGEF2 4.3 <0.001  rho/rac guanine nucleotide exchange factor 
NM_016201 AMOTL2 4.2 0.002 Yes Angiomotin-like 2 
NM_001002914 KCTD11 4.2 0.002  Potassium channel tetramerization domain containing 11 
NM_004925 AQP3 4.1 0.001  Aquaporin 3 (Gill blood group) 
AccessionGene symbolFold changePPredicted target for miR-191Description
ENST00000386760 — 15.7 0.002   
NM_000499 CYP1A1 15.0 0.001  Cytochrome P450, family 1, subfamily A, polypeptide 1 
NM_020801 ARRDC3 9.8 <0.001 Yes Arrestin domain containing 3 
NM_004417 DUSP1 9.4 0.001  Dual specificity phosphatase 1 
EU126604 KPNA7 8.7 0.002  Karyopherin 7 
ENST00000314371 — 8.4 <0.001   
NM_001945 HBEGF 7.4 0.001 Yes Heparin-binding EGF-like growth factor 
NM_002229 JUNB 7.3 0.002  Jun B proto-oncogene 
ENST00000379981 LOC388022 7.0 0.001   
NM_001031716 OBFC2A 6.7 0.002 Yes Oligonucleotide/oligosaccharide-binding fold containing 2A 
NM_145039 CENPBD1 6.7 <0.001  CENPB DNA-binding domains containing 1 
NM_002309 LIF 6.7 0.001  Leukemia inhibitory factor (cholinergic differentiation factor) 
NM_001124 ADM 6.5 <0.001  Adrenomedullin 
NM_001040619 ATF3 6.5 0.001  Activating transcription factor 3 
NM_024847 TMC7 6.1 <0.001 Yes Transmembrane channel-like 7 
NM_019096 GTPBP2 5.8 0.002  GTP binding protein 2 
NM_003548 HIST2H4A 5.7 0.002  Histone cluster 2, H4a 
NM_031459 SESN2 5.6 0.002  Sestrin 2 
NM_001300 KLF6 5.4 <0.001  Kruppel-like factor 6 
AK023048 AK023048 5.1 0.003  SubName: Full = cDNA FLJ50766; 
NM_021724 NR1D1 4.9 0.002 Yes Nuclear receptor subfamily 1, group D, member 1 
BC039295 FAM126B 4.9 0.001  Hypothetical protein LOC285172 
NM_001964 EGR1 4.6 0.001 Yes Early growth response 1 
NM_020307 CCNL1 4.5 0.002  Cyclin L1 
NM_004040 RHOB 4.4 <0.001  Ras homologue gene family, member B 
NM_020127 TUFT1 4.3 0.002  Tuftelin 1 
NM_005904 SMAD7 4.3 0.001  SMAD family member 7 
NM_015508 TIPARP 4.3 <0.001  TCDD-inducible poly(ADP-ribose) polymerase 
NM_004723 ARHGEF2 4.3 <0.001  rho/rac guanine nucleotide exchange factor 
NM_016201 AMOTL2 4.2 0.002 Yes Angiomotin-like 2 
NM_001002914 KCTD11 4.2 0.002  Potassium channel tetramerization domain containing 11 
NM_004925 AQP3 4.1 0.001  Aquaporin 3 (Gill blood group) 

We then studied the consequences of treating cells with anti–miR-191 on 10 major cancer-related pathways using a dual-luciferase reporter system (SABiosciences), consisting of vectors with regulatory elements for key genes downstream in those pathways. Figure 3A shows the reporter relative expression between cells treated with anti–miR-191 and a negative control oligonucleotide. The pathways most influenced were mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (P < 0.0007), transforming growth factor-β (TGF-β; P < 0.01), and MAPK/c-Jun NH2-terminal kinase (P < 0.03). Those pathways are important for human hepatocarcinogenesis (24) and are part of the control of cellular proliferation and differentiation. Because the inhibition of miR-191 led to changes in those pathways, we searched for direct targets among the genes related to those pathways. Figure 3B shows overlap of genes from populations of mRNA upregulated 2-fold or more after miR-191 inhibition (from the Affymetrix GeneChip), predicted targets of miR-191 (from the union of TargetScan and Miranda), and genes in affected pathways (from KEGG and NetPath). Four overlapping genes were found from the three populations: SOX4, CRK, IRAK2, and PDGFB. We have constructed luciferase plasmids with the complete 3′-UTR of each gene at the 3′ end of firefly luciferase (SwitchGear), for those four genes and for additional potential genes from those populations, to search for a direct miR-191 target. Each plasmid was cotransfected into cells with either treatment of anti–miR-191 or miR-191 mimetic and relevant controls. Reporter signal that increased with anti-miR and decreased with miR mimetic relative to the same effect on a negative control plasmid was considered direct miR-191 targets. Figure 3C is a heat map of the results showing fold change in the reporter assay for the selected genes, for the mimic and anti-miR treatments, comparing with same treatments with the negative control vector. Of the four overlapping genes, only SOX4 reporter was significantly upregulated after anti-miR (P = 0.01) treatment and downregulated after miR-mimic treatment (P = 0.004). However, IL1A and TMC7 were also significantly changed in the same manner (P = 2 × 10−6 and P = 0.004 for anti-miR treatment and P = 0.04 and P = 0.001 for the miR-mimic treatment, respectively). Those genes are therefore considered to be direct miR-191 target genes.

Figure 3.

Target modulation by anti–miR-191 by monitoring gene expression. A, reporter assay of key response elements in major cancer-related pathways. The ratio of reporter signals between cells treated with anti–miR-191 and negative control is shown as increased or decreased fold change. B, overlap of genes from three populations of (a) upregulated genes after miR-191 inhibition (upregulated 2-fold and up in Affymetrix GeneChip), (b) predicted miR-191 targets (from union of TargetScan and Miranda), and (c) genes in affected pathways (from union of KEGG and NetPath). C, reporter fold change signals for vectors harboring full 3′-UTR of selected genes for both anti–miR-191 treatment and miR-191-mimic treatment. D, schematic representation of the affected pathways and genes after miR-191 inhibition, and the cellular response that leads toward apoptosis and inhibits the survival and proliferation paths.

Figure 3.

Target modulation by anti–miR-191 by monitoring gene expression. A, reporter assay of key response elements in major cancer-related pathways. The ratio of reporter signals between cells treated with anti–miR-191 and negative control is shown as increased or decreased fold change. B, overlap of genes from three populations of (a) upregulated genes after miR-191 inhibition (upregulated 2-fold and up in Affymetrix GeneChip), (b) predicted miR-191 targets (from union of TargetScan and Miranda), and (c) genes in affected pathways (from union of KEGG and NetPath). C, reporter fold change signals for vectors harboring full 3′-UTR of selected genes for both anti–miR-191 treatment and miR-191-mimic treatment. D, schematic representation of the affected pathways and genes after miR-191 inhibition, and the cellular response that leads toward apoptosis and inhibits the survival and proliferation paths.

Close modal

In vivo efficacy of anti–miR-191 in orthotopic HCC model

An orthotopic liver xenograft model was established to test the activity of anti–miR-191 in vivo and evaluate its potential as a therapeutic agent in HCC. HepG2 cells were used to create subcutaneous xenografts in donor nude mice. Those subcutaneous tumors were harvested and fragmented, and pieces were implanted into livers of acceptor nude mice to generate orthotopic tumor xenografts. Two days after surgery (tumor implant), the mice were subjected to every other day i.p. injections of oligonucleotide. Two groups of 15 mice each were treated with either anti–miR-191 or a negative control anti-miR. The experiment was conducted for 40 days, after which livers, tumors, and spleens were harvested and weighed. Figure 4A shows the significant decrease of tumor mass at day 40 in animals treated with anti–miR-191, in comparison with the group that received the negative control anti-miR. Liver and spleen weights showed no significant difference between the groups (Fig. 4B and C). This experiment was conducted in two independent in vivo studies, both resulting with a statistically significant tumor reduction in animals treated with anti–miR-191 (data of second experiment are added to Supplementary Data). miR-191 expression was decreased in the tumors harvested from animals treated with anti–miR-191 (Fig. 4D). These tumors showed a significant reduction of the fraction of proliferating cells revealed by Ki67 (MKI67; RefSeq NM_002417) immunostaining (Fig. 4E; images are added to Supplementary Data).

Figure 4.

In vivo efficacy of anti–miR-191 in an orthotopic xenograft model. A, tumor mass reduction in orthotopic implanted mice treated with anti–miR-191 is significant compared with mice treated with negative control anti-miR (P = 0.00014) seen on day 40 of the experiment after organ harvesting and weighing. B and C, liver and spleen weight are not changed between the two groups, meaning no obvious toxicity is seen. D, miR-191 expression measured by qRT-PCR in the harvested tumors shows a significant reduction in miR-191 expression (P = 1.7 × 10−7) in the tumor tissue of the treated mice. Expression is calculated as 50 − normalized Ct. E, proliferation index measured by the ratio of Ki67 positively stained cells from total cells is shown to be reduced in tumors taken from anti–miR-191–treated animals (P = 0.026).

Figure 4.

In vivo efficacy of anti–miR-191 in an orthotopic xenograft model. A, tumor mass reduction in orthotopic implanted mice treated with anti–miR-191 is significant compared with mice treated with negative control anti-miR (P = 0.00014) seen on day 40 of the experiment after organ harvesting and weighing. B and C, liver and spleen weight are not changed between the two groups, meaning no obvious toxicity is seen. D, miR-191 expression measured by qRT-PCR in the harvested tumors shows a significant reduction in miR-191 expression (P = 1.7 × 10−7) in the tumor tissue of the treated mice. Expression is calculated as 50 − normalized Ct. E, proliferation index measured by the ratio of Ki67 positively stained cells from total cells is shown to be reduced in tumors taken from anti–miR-191–treated animals (P = 0.026).

Close modal

miRs are considered to have great potential as therapeutic targets because by nature they are master regulators of gene expression and therefore of cellular pathways (25, 26). Deregulation of miRs was shown to be present in different disease conditions. Inhibition of one miR can result in a vast effect within a cell and can alter significantly the cellular phenotype because it can change several genes that are direct targets of the miR, as well as genes influenced by those direct targets. Therefore, miR inhibition or replacement can be a key factor in the treatment of various disease conditions (26).

HCC is the fifth most common cancer worldwide. It occurs predominantly in developing countries, but nevertheless, incidence is on the rise in Western countries as well (27). The pathophysiology of HCC is not yet fully understood because the hepatocarcinogenesis process is complex and HCC has a heterogeneous nature. Many pathways may be involved in the carcinogenic process of HCC, and as miRs were shown to be deregulated in HCC in many previous studies, we investigated the involvement of miRs in this process.

The inhibition of one of the upregulated miRs in HCC, miR-191, was found to induce cellular changes in HCC cell lines that triggered proliferation inhibition and apoptosis. The inhibition of the miR was found to be potent and specific. We also found that miR-191 is upregulated after TCDD activation, a carcinogen from the dioxin family. The involvement of miRs in the mechanism of TCDD activity can explain the downregulation of several genes seen on expression arrays performed on cells following TCDD treatment (28, 29). This is in contrast to the study by Moffat and colleagues (30) that showed only moderate changes in miR expression in response to TCDD, in rodent models, and concluded that miRs do not play a role in dioxin toxicity. Dioxins are a family of environmental pollutants that are known to have multiple hazardous effects. TCDD is a very potent carcinogen, causing adverse biological responses such as developmental defects, immunotoxicity, and more (31). The mechanism for the carcinogenic effect of dioxin is not yet fully understood. It is an AhR ligand, and its effects are thought to be mediated through the activation of AhR (22). On ligand binding, the AhR translocates to the nucleus and associates with Arnt to form a heterodimer that binds to an enhancer site on the DNA designated as xenobiotic-responsive element and is responsible for transcriptional activation of a variety of enzymes involved in xenobiotic metabolism (Fig. 2B; ref. 32). This response presumably evolved to be able to detect a wide range of chemicals and facilitate their biotransformation and elimination in the detoxification process. However, toxic responses are also elicited by AhR activation, either by the production of toxic intermediate metabolites or by aberrant changes in global gene expression that lead to adverse changes in cellular processes. Microarray analysis showed that TCDD induces changes in epidermal growth factor receptor and MAPK pathways that can explain part of its toxicities and carcinogenicity (28, 33). Although the induction of the AhR by dioxins is well characterized, the function and mechanism of some of its toxicities are still unknown and require further study.

The downstream effect of miR-191 inhibition was studied to elucidate the pathways miR-191 is involved in and to study the mechanism in which miR inhibition can alter the pathway to induce a potential curative effect in HCC. We studied those effects in several stages. First, we analyzed the differences in gene expression at the mRNA level using GeneChip array by Affymetrix, comparing the expression of anti–miR-191–treated cells with cells treated with a negative control anti-miR. Extensive changes in gene expression were observed, with a significant enrichment in genes that are predicted targets of miR-191. We also looked for changes at protein levels using reporter systems because miRs also alter gene expression at the protein level by translation inhibition without major changes in mRNA level (34, 35). To identify the major pathways that are affected by miR-191, a reporter assay was used. TGF-β and MAPK pathways were found to be most affected. These pathways play a significant role in hepatocarcinogenesis (24). The TGF-β pathway regulates cell proliferation, differentiation, and adhesion (36). The MAPK signaling pathway is also involved in diverse cellular processes such as cell survival, differentiation, and proliferation (27), and the overexpression of members of this pathway was found to be correlated to HCC (37). Interestingly, the MAPK pathway, altered by anti–miR-191, was the one reported to be mostly influenced by dioxins (33), strengthening the findings of involvement of miR-191 as a key regulator of this pathway.

Analyzing the overlapping genes from the affected pathways together with the mRNA upregulated after miR-191 inhibition in the Affymetrix array and predicted target genes for miR-191 resulted with a list of potential direct target genes for miR-191. We have tested the genes from this list using a luciferase reporter assay with constructs harboring the full 3′-UTR of those potential targets. It is important to note that because miRs are considered master regulators of gene expression, the expectation is that more than one or even just a few genes would be affected directly. This is also exemplified in our enrichment of miR-191 predicted targets in the upregulated genes in anti–miR-191–treated cells. Therefore, the miR-191 targets that we validated are believed to be only part of the complex response to miR-191 regulation and the first attempt to identify its direct targets that are involved in HCC. It is our view that the concerted action of a vast number of genes whose expression is affected by miR-191 inhibition is the cause for the phenotype change and the efficacy we are witnessing after anti–miR-191 treatment. Among the genes we have tested, three genes were shown to be direct miR-191 targets.

SOX4 (RefSeq NM_003107) is a TF responsible for embryonic cell development and regulates cell differentiation, proliferation, and survival. SOX4 was found to be upregulated in many cancers and was even thought to induce metastasis in HCC (38). However, it was recently found that SOX4 acts as a DNA damage sensor and is required for p53 tumor suppressor activation (39). By this mechanism, SOX4 promotes cell cycle arrest and apoptosis, and inhibits tumorigenesis in a p53-dependant manner. This activity can be the reason for the beneficial outcome we have observed by its upregulation after miR-191 inhibition. IL1A (RefSeq NM_000575), which was also validated as being a direct target of the miR, is a member of the interleukin-1 cytokine family. This gene is involved in various immune responses, inflammatory processes, and hematopoiesis and is known to induce apoptosis. It was found to be polymorphic in many diseases. Interestingly, polymorphism in its miR-122 binding site at the 3′-UTR was found to be related to HCC (40). TMC7 (RefSeq NM_024847) belongs to a family of ion channels and has two predicted binding sites for miR-191 in its 3′-UTR. However, not much is known about the activity of this gene in HCC. CRK, IRAK2, and PDGFB, all of which have predicted binding sites for the miR and were shown to be upregulated at the mRNA level after miR-191 inhibition, did not show any reporter expression changes with either anti-miR or miR-mimic treatments. We concluded that these genes participate in the changes anti–miR-191 induces in an indirect way. Hence, the orchestration of all those cellular changes is the cause of the efficacy achieved by miR-191 inhibition. Figure 3D shows a schematic representation of how the involvement of both the direct targets of miR-191 and the genes that are changed indirectly leads the cancerous cells into apoptotic fate, and how the survival and proliferation paths are inhibited.

The effectiveness of in vivo miR inhibition in cancer models was already shown, but studies to date showed only changes in tumor size when cells were transfected with anti-miR ex vivo and then injected to produce the tumor model. Such studies were done in glioma (41) or breast cancer (41, 42). In a model for prostate cancer, miR inhibition was shown to be effective after intratumoral injections of anti-miR (43). This was also seen with intratumoral injections of anti–miR-21 in a subcutaneous xenograft of tongue squamous cell carcinomas (44). In a model of glioblastoma, miR inhibition was shown to effect angiogenesis, but no change in tumor mass was observed (45). Adeno-associated virus–mediated replacement of miR-26a was shown to be effective in a murine liver cancer model (46).

In our study, we established an orthotopic human liver xenograft model where tumor fragments are implanted in the liver of mice and the anti-miR is administered systemically (i.p.), therefore reaching the tumor after entering the bloodstream and thus imitating the delivery methods used with human cancer therapeutics. We show that with repeated injections of the anti-miR, a significant inhibition of tumor growth was observed at day 40, without observed toxicity. The level of the endogenous miR-191 in the tumors of anti–miR-191–treated mice was decreased, as well as the cell proliferation marker Ki67. To our knowledge, this is the first study that uses a systemic route of administration of an anti-miR to show therapeutic effects on the growth of a primary solid tumor.

This study shows the identification of a specific miR that is upregulated in HCC as a potential therapeutic target for this disease. We propose that miR-191 is relevant for HCC treatment because its inhibition caused decreased cell proliferation and tumor growth. Furthermore, the study also extended our understanding on how this miR can be involved in TCDD toxicity. In addition, miR-191 was found to be involved in pathways known to be important for tumor progression and growth, showing the potential of anti–miR-191 as a cancer therapeutic. There are currently many MOE-modified antisense oligonucleotides in human clinical trials (47). Therefore, the MOE-modified anti–miR-191 serves as a potential therapeutic compound, as it passively reaches the liver and tumor implant, inhibiting miR-191 efficiently and causing no observed toxicity in the animals. We conclude that miR-191 inhibition using a MOE-modified anti-miR is of high potential for the treatment of HCC patients.

All authors are full-time employees of and hold options to equity in their respective companies.

We thank workers at Rosetta Genomics, Regulus Therapeutics, and Isis Pharmaceuticals for their assistance and contributions.

Grant Support: Israel-U.S. Binational Industrial Research and Development Foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Bartel
DP
. 
MicroRNAs: genomics, biogenesis, mechanism, and function
.
Cell
2004
;
116
:
281
97
.
2
Calin
GA
,
Croce
CM
. 
MicroRNA signatures in human cancers
.
Nat Rev Cancer
2006
;
6
:
857
66
.
3
Ladeiro
Y
,
Couchy
G
,
Balabaud
C
, et al
. 
MicroRNA profiling in hepatocellular tumors is associated with clinical features and oncogene/tumor suppressor gene mutations
.
Hepatology
2008
;
47
:
1955
63
.
4
Varnholt
H
,
Drebber
U
,
Schulze
F
, et al
. 
MicroRNA gene expression profile of hepatitis C virus-associated hepatocellular carcinoma
.
Hepatology
2008
;
47
:
1223
32
.
5
Wang
Y
,
Lee
AT
,
Ma
JZ
, et al
. 
Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target
.
J Biol Chem
2008
;
283
:
13205
15
.
6
Jiang
J
,
Gusev
Y
,
Aderca
I
, et al
. 
Association of microRNA expression in hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival
.
Clin Cancer Res
2008
;
14
:
419
27
.
7
Kutay
H
,
Bai
S
,
Datta
J
, et al
. 
Downregulation of miR-122 in the rodent and human hepatocellular carcinomas
.
J Cell Biochem
2006
;
99
:
671
8
.
8
Meng
F
,
Henson
R
,
Wehbe-Janek
H
,
Ghoshal
K
,
Jacob
ST
,
Patel
T
. 
MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer
.
Gastroenterology
2007
;
133
:
647
58
.
9
Murakami
Y
,
Yasuda
T
,
Saigo
K
, et al
. 
Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues
.
Oncogene
2006
;
25
:
2537
45
.
10
Wong
QW
,
Ching
AK
,
Chan
AW
, et al
. 
MiR-222 overexpression confers cell migratory advantages in hepatocellular carcinoma through enhancing AKT signaling
.
Clin Cancer Res
16
:
867
75
.
11
Llovet
JM
,
Ricci
S
,
Mazzaferro
V
, et al
. 
Sorafenib in advanced hepatocellular carcinoma
.
N Engl J Med
2008
;
359
:
378
90
.
12
Xi
Y
,
Formentini
A
,
Chien
M
, et al
. 
Prognostic values of microRNAs in colorectal cancer
.
Biomark Insights
2006
;
2
:
113
21
.
13
Volinia
S
,
Calin
GA
,
Liu
CG
, et al
. 
A microRNA expression signature of human solid tumors defines cancer gene targets
.
Proc Natl Acad Sci U S A
2006
;
103
:
2257
61
.
14
Raver-Shapira
N
,
Marciano
E
,
Meiri
E
, et al
. 
Transcriptional activation of miR-34a contributes to p53-mediated apoptosis
.
Mol Cell
2007
;
26
:
731
43
.
15
Gilad
S
,
Meiri
E
,
Yogev
Y
, et al
. 
Serum microRNAs are promising novel biomarkers
.
PLoS One
2008
;
3
:
e3148
.
16
Esau
C
,
Davis
S
,
Murray
SF
, et al
. 
miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting
.
Cell Metab
2006
;
3
:
87
98
.
17
Jiang
J
,
Lee
EJ
,
Gusev
Y
,
Schmittgen
TD
. 
Real-time expression profiling of microRNA precursors in human cancer cell lines
.
Nucleic Acids Res
2005
;
33
:
5394
403
.
18
Viswanathan
SR
,
Daley
GQ
,
Gregory
RI
. 
Selective blockade of microRNA processing by Lin28
.
Science
2008
;
320
:
97
100
.
19
Turner
MJ
,
Slack
FJ
. 
Transcriptional control of microRNA expression in C. elegans: promoting better understanding
.
RNA Biol
2009
;
6
:
49
53
.
20
Ding
XC
,
Weiler
J
,
Grosshans
H
. 
Regulating the regulators: mechanisms controlling the maturation of microRNAs
.
Trends Biotechnol
2009
;
27
:
27
36
.
21
Dong
L
,
Ma
Q
,
Whitlock
JP
 Jr.
DNA binding by the heterodimeric Ah receptor. Relationship to dioxin-induced CYP1A1 transcription in vivo
.
J Biol Chem
1996
;
271
:
7942
8
.
22
Nebert
DW
,
Dalton
TP
,
Okey
AB
,
Gonzalez
FJ
. 
Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer
.
J Biol Chem
2004
;
279
:
23847
50
.
23
Mimura
J
,
Fujii-Kuriyama
Y
. 
Functional role of AhR in the expression of toxic effects by TCDD
.
Biochim Biophys Acta
2003
;
1619
:
263
8
.
24
Calvisi
DF
,
Pascale
RM
,
Feo
F
. 
Dissection of signal transduction pathways as a tool for the development of targeted therapies of hepatocellular carcinoma
.
Rev Recent Clin Trials
2007
;
2
:
217
36
.
25
Nelson
KM
,
Weiss
GJ
. 
MicroRNAs and cancer: past, present, and potential future
.
Mol Cancer Ther
2008
;
7
:
3655
60
.
26
Liu
Z
,
Sall
A
,
Yang
D
. 
MicroRNA: an emerging therapeutic target and intervention tool
.
Int J Mol Sci
2008
;
9
:
978
99
.
27
Aravalli
RN
,
Steer
CJ
,
Cressman
EN
. 
Molecular mechanisms of hepatocellular carcinoma
.
Hepatology
2008
;
48
:
2047
63
.
28
Frueh
FW
,
Hayashibara
KC
,
Brown
PO
,
Whitlock
JP
 Jr.
Use of cDNA microarrays to analyze dioxin-induced changes in human liver gene expression
.
Toxicol Lett
2001
;
122
:
189
203
.
29
Hanlon
PR
,
Zheng
W
,
Ko
AY
,
Jefcoate
CR
. 
Identification of novel TCDD-regulated genes by microarray analysis
.
Toxicol Appl Pharmacol
2005
;
202
:
215
28
.
30
Moffat
ID
,
Boutros
PC
,
Celius
T
,
Linden
J
,
Pohjanvirta
R
,
Okey
AB
. 
microRNAs in adult rodent liver are refractory to dioxin treatment
.
Toxicol Sci
2007
;
99
:
470
87
.
31
Moennikes
O
,
Loeppen
S
,
Buchmann
A
, et al
. 
A constitutively active dioxin/aryl hydrocarbon receptor promotes hepatocarcinogenesis in mice
.
Cancer Res
2004
;
64
:
4707
10
.
32
Schwarz
M
,
Buchmann
A
,
Stinchcombe
S
,
Kalkuhl
A
,
Bock
K
. 
Ah receptor ligands and tumor promotion: survival of neoplastic cells
.
Toxicol Lett
2000
;
112–113
:
69
77
.
33
Marlowe
JL
,
Puga
A
. 
Aryl hydrocarbon receptor, cell cycle regulation, toxicity, and tumorigenesis
.
J Cell Biochem
2005
;
96
:
1174
84
.
34
Selbach
M
,
Schwanhausser
B
,
Thierfelder
N
,
Fang
Z
,
Khanin
R
,
Rajewsky
N
. 
Widespread changes in protein synthesis induced by microRNAs
.
Nature
2008
;
455
:
58
63
.
35
Mathonnet
G
,
Fabian
MR
,
Svitkin
YV
, et al
. 
MicroRNA inhibition of translation initiation in vitro by targeting the cap-binding complex eIF4F
.
Science
2007
;
317
:
1764
7
.
36
Massague
J
. 
TGFβ in cancer
.
Cell
2008
;
134
:
215
30
.
37
Huynh
H
,
Nguyen
TT
,
Chow
KH
,
Tan
PH
,
Soo
KC
,
Tran
E
. 
Over-expression of the mitogen-activated protein kinase (MAPK) kinase (MEK)-MAPK in hepatocellular carcinoma: its role in tumor progression and apoptosis
.
BMC Gastroenterol
2003
;
3
:
19
.
38
Liao
YL
,
Sun
YM
,
Chau
GY
, et al
. 
Identification of SOX4 target genes using phylogenetic footprinting-based prediction from expression microarrays suggests that overexpression of SOX4 potentiates metastasis in hepatocellular carcinoma
.
Oncogene
2008
;
27
:
5578
89
.
39
Pan
X
,
Zhao
J
,
Zhang
WN
, et al
. 
Induction of SOX4 by DNA damage is critical for p53 stabilization and function
.
Proc Natl Acad Sci U S A
2009
;
106
:
3788
93
.
40
Gao
Y
,
He
Y
,
Ding
J
, et al
. 
An insertion/deletion polymorphism at miRNA-122-binding site in the interleukin-1α 3′ untranslated region confers risk for hepatocellular carcinoma
.
Carcinogenesis
2009
;
30
:
2064
9
.
41
Corsten
MF
,
Miranda
R
,
Kasmieh
R
,
Krichevsky
AM
,
Weissleder
R
,
Shah
K
. 
MicroRNA-21 knockdown disrupts glioma growth in vivo and displays synergistic cytotoxicity with neural precursor cell delivered S-TRAIL in human gliomas
.
Cancer Res
2007
;
67
:
8994
9000
.
42
Si
ML
,
Zhu
S
,
Wu
H
,
Lu
Z
,
Wu
F
,
Mo
YY
. 
miR-21-mediated tumor growth
.
Oncogene
2007
;
26
:
2799
803
.
43
Mercatelli
N
,
Coppola
V
,
Bonci
D
, et al
. 
The inhibition of the highly expressed miR-221 and miR-222 impairs the growth of prostate carcinoma xenografts in mice
.
PLoS One
2008
;
3
:
e4029
.
44
Li
J
,
Huang
H
,
Sun
L
, et al
. 
MiR-21 indicates poor prognosis in tongue squamous cell carcinomas as an apoptosis inhibitor
.
Clin Cancer Res
2009
;
15
:
3998
4008
.
45
Wurdinger
T
,
Tannous
BA
,
Saydam
O
, et al
. 
miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells
.
Cancer Cell
2008
;
14
:
382
93
.
46
Kota
J
,
Chivukula
RR
,
O'Donnell
KA
, et al
. 
Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model
.
Cell
2009
;
137
:
1005
17
.
47
Gleave
ME
,
Monia
BP
. 
Antisense therapy for cancer
.
Nat Rev Cancer
2005
;
5
:
468
79
.

Supplementary data