Cancer cells manage to divide in the context of gross chromosomal abnormalities. These abnormalities can promote bypass of normal restraints on cell proliferation but at a cost of mitotic vulnerabilities that can be attacked by chemotherapy. Determining how cancer cells balance these issues may permit chemotherapeutic sensitivity to be leveraged more efficiently. From a pan-genomic small interfering RNA screen for modifiers of chemoresponsiveness, we identified the tumor antigen acrosin binding protein (ACRBP)/OY-TES-1 as a specifier of paclitaxel resistance. ACRBP expression is normally restricted to the testes but is detected in a wide variety of cancers, including most ovarian cancers. We found that ACRBP is both necessary and sufficient for paclitaxel resistance in ovarian cancer cell lines and ovarian tumor explants. Moreover, high ACRBP expression correlated with reduced survival time and faster relapse among ovarian cancer patients. We identified the mitotic spindle protein NuMA as an ACRBP-interacting protein that could account for the effects of ACRBP on paclitaxel sensitivity. In cancer cells, ACRBP restricted a NuMA-dependent abrogation of a mitotic spindle assembly that is otherwise pathologic. As a consequence, ACRBP depletion resulted in mitotic errors and reduced proliferative fitness that could be rescued by NuMA codepletion. We propose that the codependent relationship of ACRBP and NuMA in cancer cells reflects their passage through a selection bottleneck during tumor evolution, one which requires the acquisition of traits that normalize mitotic perturbations that originally drove the plasticity of a preneoplastic genome. The molecular definition of such traits as defined by the ACRBP-NuMA complex may represent conceptually ideal intervention targets based on the wide therapeutic windows they may offer. Cancer Res; 70(19); 7652–61. ©2010 AACR.

Despite the widespread use as a chemotherapeutic intervention for cancer treatment, the molecular underpinnings specifying tumor cell–selective sensitivity to microtubule poisons are enigmatic (1, 2). Whereas clinically effective, patient responses are notoriously variable and associated with significant toxicity (37). From a pan-genomic small interfering RNA (siRNA) screen for cell autonomous specifiers of chemoresponsiveness, we isolated a cohort of gene products that, when depleted, significantly sensitized lung cancer cells to paclitaxel-induced cell death (8). An intriguing subclass of this cohort was previously recognized, through immunoreactive serum profiling, as encoding cancer testes tumor antigens with no known function (9). A member of this subclass, acrosin binding protein (ACRBP; also known as OY-TES-1; refs. 1012), is normally expressed in developing and adult testis and anomalously expressed in a variety of tumor types, including lung, breast, and liver (13). Significantly, gain of ACRBP/OY-TES-1 expression was reported in 69% of ovarian tumors (12).

Given the extensive expression correlation with cancer, together with the robust functional interaction with chemotherapeutic agents, we directly examined the contribution of ACRBP to the proliferative fitness of cancer cells. We found that anomalous ACRBP expression was both required and sufficient to support mitotic spindle assembly and function in the face of microtubule perturbagens. The mechanistic basis of this contribution to robust mitotic progression is at least in part through restriction of NuMA-dependent centrosomal fragmentation in cancer cells. The recapitulation of this functional relationship in ovarian tumor explants and the correlation of ACRBP expression with poor patient response to therapy suggest that ACRBP represents an acquired dependency within the pathologic regulatory framework of cancer cell mitosis.

Cell culture

H1155 and ES-2 cells were obtained from the American Type Culture Collection. PEO1 and PEO4 cells were a gift from Hani Gabra (University of Edinburgh Cancer Research Center). H1155, PEO1, and PEO4 cell lines were validated by Powerplex genotyping before use.

Tumor tissue and primary tumor explants

Normal ovarian tissue RNA samples were obtained with consent from patients under IRB 092004-010 (University of Texas Southwestern Medical Center Tissue Resource). Patient ovarian tumor samples were isolated from ascites obtained during surgical removal of tumors (LCOV2 and LCOV17) or paracentesis (LCOV4) under appropriate HIPAA procedures [IRB 09-0412 at University of North Carolina (UNC) at Chapel Hill, “Identification of Linchpin Proteins Supporting Ovarian Tumorigenesis”]. All numbers used to refer to samples are dummy identifiers that cannot be traceable back to individual patients. LCOV2 was derived from a patient with serous, stage IIIC ovarian cancer who had received four cycles of paclitaxel and carboplatin. LCOV4 was derived from a patient with primary peritoneal carcinosarcoma who had received three cycles of ifosfamide/carboplatin, single-agent carboplatin, Taxotere, and GEMZAR, followed by weekly paclitaxel. LCOV17 was from a newly diagnosed patient with Stage IIIC serous papillary ovarian cancer, who had not received prior treatment. Ascites were plated in flasks, and medium was changed weekly until cells were confluent. Cells were maintained in RPMI + 10% fetal bovine serum (FBS; PEO1, PEO4, and ES-2) or RPMI + 5% FBS (LCOV2, LCOV4, and LCOV17).

Live-cell imaging and quantitation

Green fluorescent protein (GFP)-histone H2B expressing lines were produced by transduction with pCLNCX-GFP-H2B retrovirus. Retrovirus was prepared by Fugene (Roche) transfection of 293gp cells with pCLNCX-GFP-H2B and VSVG according to the manufacturer's instructions. At 24 hours posttransfection, the medium was replaced, and at 48 hours posttransfection, supernatant was collected, centrifuged, and filtered. H1155 cells were then transduced at 50% confluence in conjunction with 4 μg/mL polybrene. At 1 day of posttransduction, the cells were selected with 600 μg/mL geneticin (Life Technologies) until a homogenously expressing population was obtained. For imaging of siRNA-treated cells, the H1155-GFP-histone H2B line was reverse transfected as described below and plated in a 96-well format followed by carrier or paclitaxel treatment at 48 hours posttransfection. At 72 hours posttransfection, imaging began on a BD Pathway 855 bioimager using a 40× objective. Images were collected at 15-minute intervals for the next 48 hours. Image sequences were generated using ImageJ. Image sequences were then evaluated for indicated parameters manually.

siRNA transfections

All transfections were performed with 50 nmol/L final concentration of siGENOME SMART pools and individual siRNA oligonucleotides obtained from ThermoFisher. Reverse transfections were performed by mixing appropriate Dharmafect (ThermoFisher) with siRNA pools and incubating for 20 minutes followed by delivery of trypsin-derived single-cell suspensions. Cells were transfected for a minimum of 72 hours and a maximum of 96 hours before analysis, as indicated in figure legends. To optimize cell lines, cells were reverse transfected with control (DLNB14) or a toxic siGENOME pool (targeting ubiquitin B) using a panel of Dharmafect reagents and concentrations in 96-well format. At 96 hours posttransfection, cells were evaluated for viability using the Cell Titer Glo Assay (Promega). ACRBP off-target validation was performed by using six individual siRNAs representing two independent siRNA pools obtained from Dharmacon (siGENOME and ON-TARGETplus) in H1155 cells. Each individual siRNA from the original pool and one from the ON-TARGETplus pool effectively depleted ACRBP mRNA and resulted in paclitaxel-dependent mitotic delay. The target sequences for these siRNAs are GGAGAATACCTGCATCATATT, TGGAAGAGCTCCTACAATCTT, CCAAGAGAGTCCTGTGTTCTT, GCCAAGGCCTGGAAGTACATT, and TTTACGGGCTGGATTTGTATT. In subsequent assays, the siGENOME pool was used. An ACRBP depletion-induced phenotype was also validated in PEO1 cells using a lentivirus-based system (TRC clone set, OpenBiosystems catalog RHS4533). Clones TRCN0000115843 and TRCN0000115844 were effective.

cDNA transient transfections

H1155 or PE01 cells were transfected with cDNA expression vectors using Fugene according to the manufacturer's protocol for a 35 mm2 dish format. At 24 hours posttransfection, medium was replaced with paclitaxel or vehicle-containing medium for an additional 24-hour incubation. Cells were then processed for immunofluorescence.

Quantitative real-time reverse transcription-PCR

Total RNA was isolated from tissue culture cells using the Sigma RNA isolation kit. The high-capacity cDNA reverse transcription kit (Applied Biosystems) was used to synthesize cDNA from 3 μg of total RNA. Real-time reverse transcription-PCR (RT-PCR) was performed on diluted cDNA using the Applied Biosystems 7500 Fast real-time PCR system (standard program) and inventoried TaqMan gene expression assays. Human β-actin served as an endogenous control, and “control transfected” was the calibrator for calculating differences in expression levels using the 2-ΔΔCT method. Glyceraldehyde-3-phosphate dehydrogenase was also used for normalization in many cases and consistently returned the same biological observation. Final results represent the pooling of two test experiments, and error bars represent average deviation from the mean.

Immunoblotting and immunofluorescence

Monoclonal antibody raised in mouse against ACRBP was a gift from Kunle Odunsi and is previously described. Anti-NuMA rabbit antibody was obtained from Novus Biologicals. A monoclonal antibody against bromodeoxyuridine (BrdUrd) was obtained from Becton Dickinson. β-Tubulin III, γ-tubulin, and Aurora-A antibodies were obtained from Sigma. Anti-pericentrin was obtained from Abcam. Alexa 488 and Alexa 546 (Invitrogen) were used as secondary antibodies for fluorescent labeling. Immunoblot assays were performed with proteins transferred to polyvinylidene difluoride membrane according to the manufacturer's protocol for each antibody. For BrdUrd visualization, cells were treated with 30 μmol/L BrdUrd for 14 hours and then fixed in 3.7% HCHO. Cells were permeabilized with acetone for 10 minutes at −20°C. DNA was denatured with 1 mmol/L HCl for 10 minutes and then blocked in PBS-5% bovine serum albumin-1% Tween for a minimum of 15 minutes. Anti-BrdUrd was used at a dilution of 1:4. For β-tubulin/pericentrin staining, cells were fixed as described above, permeabilized for 10 minutes with 0.5% Triton X-100, and blocked as above. Cells were stained with monoclonal β-tubulin III and pericentrin at a dilution of 1:100 or 1:200, respectively, for 1 hour. Following extensive washes, an Alexa 488 or Alexa 546 secondary antibody was applied for 30 minutes at 37°C. For γ-tubulin staining, cells were fixed as above and permeabilized for 10 minutes in methanol at −20°C. For ACRBP staining, cells were fixed and permeabilized as for β-tubulin, and UA199 antibody was used at a 1:100 dilution. Cytokeratin-16 staining was performed using a monoclonal cytokeratin-16 antibody obtained from Dako Laboratories. All cells were visualized with an Axiovert or Axioimager upright microscope (Zeiss) equipped with a Hamamatsu or Zeiss CCD camera.

Immunoprecipitation

PEO4 cells grown to confluence on 100 mm2 dishes were lysed in a buffer containing 0.5% Triton X-100, 150 mmol/L NaCl, and 0.5% deoxycholate. Soluble lysate was incubated overnight with anti-ACRBP monoclonal antibody UA199 or mouse IgG precoupled to cyanogen-bromide agarose beads. Beads were washed three times in lysis buffer with 500 mmol/L NaCl. Following washes, sample buffer was added, and lysates were boiled and separated by 10% SDS-PAGE. High-performance liquid chromatography (HPLC)–mediated tandem mass spectroscopy of ACRBP immunoprecipitates was performed by the University of Texas Southwestern Protein Chemistry Core Research Facility in Mass Spectrometry. Multiple peptides corresponding to NuMA were identified in a 180-kDa silver-stained band.

Gene expression association studies

Fresh tumor was collected from 29 advanced epithelial ovarian cancer patients between 2001 and 2006 as part of an ongoing Early Detection Research Network collaboration. All patients were treated with taxane/platinum-based chemotherapy. Specimens were immediately flash frozen and stored at −80°C. The clinical course and outcome of the patients were prospectively determined as sample collection was ongoing. Genomic mRNA expression profiles were generated using the Affy Plus2 GeneChip. The robust multiarray averaging method was used to process microarray data, and expression values were log2 transformed (14, 15). Patients were dichotomized to high ACRBP and low ACRBP groups based on a Gaussian mixture model (16). ACRBP and NuMA expression values were used to parse patient populations to high ACRBP-NuMA and low ACRBP-NuMA groups based on a hierarchical clustering analysis. Similar results are observed if median values were used to dichotomize expression values. Disease-free survival time, defined as the time interval between chemotherapy conclusion and disease recurrence date or the last follow-up date, was used to measure the patient's response to chemotherapy. Survival curves were estimated using the product limit method of Kaplan-Meier (17) and were compared using the log-rank test. Univariate cyclooxygenase (COX) proportional hazards model was also performed, with survival as the dependent variable (18).

ACRBP copy number is amplified in tumors and confers paclitaxel resistance

The mechanisms driving the anomalous ACRBP expression in a variety of cancers are unknown (9). However, ACRBP genomic gain was recently detected in ovarian serous adenocarcinoma by The Cancer Genome Atlas (TCGA) consortium (Fig. 1A). Perhaps more clinically significant, gain of ACRBP/OY-TES-1 expression was reported in 69% of ovarian tumors (12). This relationship is iterated in ovarian tumor–derived cell lines and represents an attractive setting for the analysis of the ACRBP function in cancer. We examined the serous adenocarcinoma cell lines PEO1 and PEO4, which were sequentially derived from a chemotherapy-responsive tumor and a chemotherapy-resistant relapse from the same patient (19). Of note, whereas ACRBP expression is activated in both lines relative to normal tissue, it is highest in the chemoresistant PEO4 cells (Fig. 1B). Ectopic expression of ACRBP in PEO1 and in the original siRNA screen host non–small cell lung carcinoma line H1155 (8) was sufficient to confer resistance to paclitaxel-induced mitotic arrest relative to controls (Fig. 1C and D).

Figure 1.

ACRBP gain of function in cancer. A, box plot of ACRBP copy number from the TCGA data set. Oncomine (Compendia Bioscience) was used for analysis and visualization. B, quantitative RT-PCR analysis of ACRBP expression is shown for indicated normal ovarian tissue samples and ovarian tumor cell lines. H1155 (C) or PEO1 (D, right) cells were transfected with the indicated expression vectors. At 24 h posttransfection, cells were treated with indicated concentration of paclitaxel for 12 h. Mitotic figures were scored microscopically following 4′,6-diamidino-2-phenylindole (DAPI) staining and are expressed as the percentage of total cells counted. Error bars represent average deviation from the mean of two independent experiments.

Figure 1.

ACRBP gain of function in cancer. A, box plot of ACRBP copy number from the TCGA data set. Oncomine (Compendia Bioscience) was used for analysis and visualization. B, quantitative RT-PCR analysis of ACRBP expression is shown for indicated normal ovarian tissue samples and ovarian tumor cell lines. H1155 (C) or PEO1 (D, right) cells were transfected with the indicated expression vectors. At 24 h posttransfection, cells were treated with indicated concentration of paclitaxel for 12 h. Mitotic figures were scored microscopically following 4′,6-diamidino-2-phenylindole (DAPI) staining and are expressed as the percentage of total cells counted. Error bars represent average deviation from the mean of two independent experiments.

Close modal

ACRBP physically and functionally interacts with NuMA

The gain-of-function activity of ACRBP indicates that this molecule likely interacts with cellular components that otherwise promote paclitaxel responsiveness. To explore this, we examined ACRBP-associated proteins by nano-HPLC mass spectrometry analysis of endogenous ACRBP complexes. A number of candidates were returned including the nuclear and mitotic apparatus protein NuMA, which was validated by immunoblotting anti-ACRBP immunoprecipitates from PEO4 cells with an anti-NuMA antibody (Fig. 2A). In normal cells, NuMA is an essential component of the mitotic spindle, promoting spindle pole focusing and, when overexpressed, microtubule bundling (2028). The NuMA locus is in the 11q13 chromosomal band, which is frequently amplified in many tumors and includes tumor-promoting genes such as cyclin D1, EMSY, and MEN1. The overexpression of NuMA in cancers disrupts centrosome integrity and increases genomic instability (21). The manifestation of spindle defects upon either loss or gain of NuMA strongly suggests that a balance of effective NuMA concentrations must be maintained for robust mitotic progression (2022). Upon depletion of ACRBP, we found that NuMA protein levels were significantly elevated, suggesting that ACRBP expression restrains NuMA protein accumulation (Fig. 2B). Remarkably, codepletion of ACRBP and NuMA rescued the enhanced sensitivity to paclitaxel observed upon ACRBP depletion alone (Fig. 2C). This effect was not observed upon codepletion of other modulators of microtubule dynamics, including the microtubule stabilizing protein mitogen-activated protein 4 (MAP4) and the microtubule tip-binding protein EB1 (Fig. 2C), indicating that ACRBP perturbation of paclitaxel sensitivity is NuMA dependent (22, 23).

Figure 2.

NuMA-dependent modulation of paclitaxel sensitivity by ACRBP. A, endogenous ACRBP was immunoprecipitated from PEO4 cell lysates as indicated and probed for coprecipitated NuMA. Normal mouse IgG was used as a negative control. Identical lysates were split for ACRBP and control IgG immunoprecipitations. Immunoprecipitations were performed in the presence and absence of 100 nmol/L paclitaxel indicated as +/− Pac. B, whole-cell extracts from PEO4 cells transfected with the indicated siRNAs were immunoblotted to detect the accumulation of native NuMA. C, H1155 cells were transfected with indicated siRNAs. At 48 h posttransfection, cells were exposed to the indicated paclitaxel concentrations for 24 h. Microtubules, genomic DNA, and centrosomes were visualized by β-tubulin, DAPI, and pericentrin immunostaining, respectively. Mitotic figures were scored microscopically and are expressed as the percentage of total cells counted. MAD2 and BubR1-positive kinetochores in mitotic figures were used as an indication of failure to satisfy the spindle assembly checkpoint (representative panels are shown below the arrow). A minimum of 100 cells over at least five fields of view was scored for each group in each of three independent experiments. Error bars represent average error from the mean. NuMA protein depletion was evaluated by immunoblot (top right), and ACRBP, EBI1, and MAP4 mRNA depletion were evaluated by quantitative RT-PCR (bottom right).

Figure 2.

NuMA-dependent modulation of paclitaxel sensitivity by ACRBP. A, endogenous ACRBP was immunoprecipitated from PEO4 cell lysates as indicated and probed for coprecipitated NuMA. Normal mouse IgG was used as a negative control. Identical lysates were split for ACRBP and control IgG immunoprecipitations. Immunoprecipitations were performed in the presence and absence of 100 nmol/L paclitaxel indicated as +/− Pac. B, whole-cell extracts from PEO4 cells transfected with the indicated siRNAs were immunoblotted to detect the accumulation of native NuMA. C, H1155 cells were transfected with indicated siRNAs. At 48 h posttransfection, cells were exposed to the indicated paclitaxel concentrations for 24 h. Microtubules, genomic DNA, and centrosomes were visualized by β-tubulin, DAPI, and pericentrin immunostaining, respectively. Mitotic figures were scored microscopically and are expressed as the percentage of total cells counted. MAD2 and BubR1-positive kinetochores in mitotic figures were used as an indication of failure to satisfy the spindle assembly checkpoint (representative panels are shown below the arrow). A minimum of 100 cells over at least five fields of view was scored for each group in each of three independent experiments. Error bars represent average error from the mean. NuMA protein depletion was evaluated by immunoblot (top right), and ACRBP, EBI1, and MAP4 mRNA depletion were evaluated by quantitative RT-PCR (bottom right).

Close modal

ACRBP supports high-fidelity mitosis

Given the role of NuMA in mitotic spindle assembly and function (20, 2427), we directly assessed the consequence of ACRBP depletion on mitotic progression in real time at single-cell resolution using stable expression of GFP-histone H2B. Consistent with previous observations in H1155 cells, depletion of ACRBP or exposure to 10 nmol/L paclitaxel had no measurable consequence on the timing and only slight consequences on the outcome of mitosis (Fig. 3; ref. 8). In contrast, depletion of ACRBP together with 10 nmol/L paclitaxel resulted in a significant mitotic delay compared with controls (Fig. 3A). The delay is consistent with the spindle assembly checkpoint response, as kinetochores in ACRBP-depleted cells exposed to paclitaxel are MAD2 and BUBR1 positive (Fig. 2C). Real-time single-cell lineage tracing indicated that this delay was coupled to an aberrant resolution of mitosis, which included apoptosis, micronucleation/nuclear fragmentation, premature exit to interphase, and tripolar mitosis (Fig. 3B–D). Taken together, these observations indicate that ACRBP-expressing cancer cells require this protein to support robust proper bipolar spindle formation.

Figure 3.

ACRBP is required for high-fidelity mitotic progression in tumor cells. A, H1155 cells expressing GFP-histone H2B were transfected with indicated siRNAs. At 48 h posttransfection, cells were exposed to paclitaxel or carrier and imaged live by time-lapse microscopy for 48 h. Single-cell lineage tracing for each condition was performed to measure the length of mitosis as a function of the time from prometaphase to telophase in 50 cells over two independent experiments. Quartile ranges for the condition are shown. P values were calculated with the Mann-Whitney test. B, representative examples of time-lapse sequences illustrating the heterogeneity of fates exhibited by H1155 cells following ACRBP depletion and exposure to 10 nmol/L paclitaxel. C, radar plots indicating the population distributions of mitotic fates under the indicated conditions. D, single-cell mitotic fate profiles and associated time in mitosis for H1155 cells transfected with indicated siRNAs and exposed to indicated paclitaxel concentrations. Each bar indicates the time in mitosis and the outcome for a single cell.

Figure 3.

ACRBP is required for high-fidelity mitotic progression in tumor cells. A, H1155 cells expressing GFP-histone H2B were transfected with indicated siRNAs. At 48 h posttransfection, cells were exposed to paclitaxel or carrier and imaged live by time-lapse microscopy for 48 h. Single-cell lineage tracing for each condition was performed to measure the length of mitosis as a function of the time from prometaphase to telophase in 50 cells over two independent experiments. Quartile ranges for the condition are shown. P values were calculated with the Mann-Whitney test. B, representative examples of time-lapse sequences illustrating the heterogeneity of fates exhibited by H1155 cells following ACRBP depletion and exposure to 10 nmol/L paclitaxel. C, radar plots indicating the population distributions of mitotic fates under the indicated conditions. D, single-cell mitotic fate profiles and associated time in mitosis for H1155 cells transfected with indicated siRNAs and exposed to indicated paclitaxel concentrations. Each bar indicates the time in mitosis and the outcome for a single cell.

Close modal

ACRBP restrains NuMA-driven mitotic pathology to enhance proliferative capacity

The overexpression of NuMA can promote multipolar spindle formation characterized by the presence of multiple γ-tubulin–positive spindle poles in mitotic cells. This observation has led to the hypothesis that aberrant accumulation of NuMA in cancers may promote genomic instability through inhibition of centrosomal coalescence (21, 28, 29). Close examination of mitotic spindle components in lung and ovarian cancer cell lines revealed that ACRBP depletion increased the frequency of spindle pole fragmentation upon exposure to low-dose paclitaxel, as indicated by noncolocalized supernumerary γ-tubulin and pericentrin foci (Fig. 4A and B). This phenotype is reminiscent of pathologic NuMA activity first described in esophageal cancer lines (21) and was reversed upon NuMA codepletion (Fig. 4A and B). These observations suggest that ACRBP antagonizes NuMA in cancer cells to normalize defects that would otherwise lead to aberrant spindle assembly and consequent mitotic catastrophe.

Figure 4.

ACRBP supports spindle-pole congression and proliferation in ovarian cancer cells. H1155 (A) and ES-2 (B) cells were transfected with the indicated siRNAs, incubated for 48 h, and then exposed to 10 nmol/L paclitaxel for 24 h. Following immunostaining with the indicated probes, mitotic figures were scored microscopically for fragmented centrosomes and are expressed as the percentage of total cells counted. Error bars represent the average deviation from two independent experiments.

Figure 4.

ACRBP supports spindle-pole congression and proliferation in ovarian cancer cells. H1155 (A) and ES-2 (B) cells were transfected with the indicated siRNAs, incubated for 48 h, and then exposed to 10 nmol/L paclitaxel for 24 h. Following immunostaining with the indicated probes, mitotic figures were scored microscopically for fragmented centrosomes and are expressed as the percentage of total cells counted. Error bars represent the average deviation from two independent experiments.

Close modal

As mitotic spindle dysfunction can result in the production of daughter cells with incomplete genomes and thus reduced fecundity, we next examined the contribution of ACRBP to cell cycle progression in three different ovarian cancer cell lines. Each of these lines has a unique response to paclitaxel representing a diverse response to antimitotic agents frequently observed in culture and patient populations (Fig. 5A). As shown in Fig. 5B, ACRBP depletion resulted in a NuMA-dependent inhibition of BrdUrd incorporation in all lines tested. This occurred in the absence of paclitaxel challenge, indicating that the gain of ACRBP expression confers proliferative fitness to ovarian cancer cells.

Figure 5.

ACRBP depletion inhibits DNA synthesis. A, line graph represents paclitaxel dose-response curves generated for three ovarian cancer cell lines as indicated. Bar graphs represent cell biological responses following a 48-hr exposure to the indicated paclitaxel concentrations in three different ovarian cell lines. Bars represent SD from triplicate analyses. Cells were immunostained for chromosomes, microtubules, and centrosomes and scored for the percentage of interphase cells (white bars), mitotic figures (black bars), micronucleated cells (cyan bars), and apoptotic bodies (gray bars). Over 100 cells were counted for each condition, and means are shown from 2 independent experiments. B, the indicated ovarian cancer cell lines were transfected with the indicated siRNAs. 72 h posttransfection, BrdU was added to the culture medium for 14 h. BrdU incorporation was detected with an anti-BrdU antibody, nuclei were counterstained with DAPI, and the percentage of BrdU-positive cells was quantified by microscopic observation. At least 100 cells were analyzed for each condition for each experiment across a minimum of 3 different fields of view. Values are normalized to the BrdU-incorporation frequency observed in control-transfected cells, which was set to 100%. Error bars indicate SD of 2 independent experiments each with 2 replicates. Quantitative rtPCR was performed on parallel samples to validate knockdown of ACRBP (bottom).

Figure 5.

ACRBP depletion inhibits DNA synthesis. A, line graph represents paclitaxel dose-response curves generated for three ovarian cancer cell lines as indicated. Bar graphs represent cell biological responses following a 48-hr exposure to the indicated paclitaxel concentrations in three different ovarian cell lines. Bars represent SD from triplicate analyses. Cells were immunostained for chromosomes, microtubules, and centrosomes and scored for the percentage of interphase cells (white bars), mitotic figures (black bars), micronucleated cells (cyan bars), and apoptotic bodies (gray bars). Over 100 cells were counted for each condition, and means are shown from 2 independent experiments. B, the indicated ovarian cancer cell lines were transfected with the indicated siRNAs. 72 h posttransfection, BrdU was added to the culture medium for 14 h. BrdU incorporation was detected with an anti-BrdU antibody, nuclei were counterstained with DAPI, and the percentage of BrdU-positive cells was quantified by microscopic observation. At least 100 cells were analyzed for each condition for each experiment across a minimum of 3 different fields of view. Values are normalized to the BrdU-incorporation frequency observed in control-transfected cells, which was set to 100%. Error bars indicate SD of 2 independent experiments each with 2 replicates. Quantitative rtPCR was performed on parallel samples to validate knockdown of ACRBP (bottom).

Close modal

ACRBP is a marker of clinically aggressive disease

Ovarian cancer is typically treated by surgical debulking of the tumor mass, followed by taxane and platinum-based chemotherapeutic regimens (30). Although the majority of patients respond, nearly all will relapse within 2 to 5 years, and the overall 5-year survival rate is <45% (30). To examine the correlation of ACRBP expression with patient outcome, we queried whole-genome expression array data from tumors isolated from a cohort of 29 ovarian cancer patients with associated disease histories. We found that high ACRBP expression is significantly correlated with poor prognosis, both with respect to overall survival (hazard ratio = 9.18, for high ACRBP group versus low ACRBP group; P = 0.0059, from Cox regression model) and time to disease recurrence (hazard ratio = 3.87; P = 0.0064, from Cox regression model; Fig. 6A). Remarkably, the most aggressive disease was associated with both high ACRBP and high NuMA expression (Fig. 6B). This correlation is consistent with the notion that ACRBP expression may be selected to counter the consequence of aberrantly high NuMA activity.

Figure 6.

ACRBP correlates with aggressive disease and paclitaxel resistance in tumor explants. A, Kaplan-Meier plots of disease-free survival association with ACRBP expression (left) or ACRBP and NuMA expression (right). B, primary tumor cultures derived from patient samples were immunostained with cytokeratin-16 (green) and DAPI (blue). C, siRNA transfection efficiency was monitored by measuring viability following transfection of siRNAs targeting an essential gene product (UBB). ALU, arbitrary light units (right). D, primary tumor cultures were transfected with indicated siRNAs for 48 h and then exposed to the indicated paclitaxel concentrations for 24 h. For LCOV2 and LCOV4, paclitaxel doses were chosen as those which were at least 10-fold below that required to significantly increase the mitotic index of the parental cultures. For LCOV17, 30 nmol/L was the lowest dose at which any defect, in control or ACRBP-transfected cells, was detected. Following immunostaining with anti–β-tubulin and DAPI, mitotic figures were scored microscopically and are expressed as the percentage of total cells counted. A minimum of 200 cells were counted for each condition in each of the two independent experiments. Error bars represent SEM from the mean from multiple, different fields of view. Quantitative RT-PCR was performed to validate ACRBP mRNA depletion. E, cartoon representation of epithelial tumor evolution indicating the selection bottleneck that can promote acquisition of anomalous components that normalize mitotic dysfunction and thus support clonal expansion.

Figure 6.

ACRBP correlates with aggressive disease and paclitaxel resistance in tumor explants. A, Kaplan-Meier plots of disease-free survival association with ACRBP expression (left) or ACRBP and NuMA expression (right). B, primary tumor cultures derived from patient samples were immunostained with cytokeratin-16 (green) and DAPI (blue). C, siRNA transfection efficiency was monitored by measuring viability following transfection of siRNAs targeting an essential gene product (UBB). ALU, arbitrary light units (right). D, primary tumor cultures were transfected with indicated siRNAs for 48 h and then exposed to the indicated paclitaxel concentrations for 24 h. For LCOV2 and LCOV4, paclitaxel doses were chosen as those which were at least 10-fold below that required to significantly increase the mitotic index of the parental cultures. For LCOV17, 30 nmol/L was the lowest dose at which any defect, in control or ACRBP-transfected cells, was detected. Following immunostaining with anti–β-tubulin and DAPI, mitotic figures were scored microscopically and are expressed as the percentage of total cells counted. A minimum of 200 cells were counted for each condition in each of the two independent experiments. Error bars represent SEM from the mean from multiple, different fields of view. Quantitative RT-PCR was performed to validate ACRBP mRNA depletion. E, cartoon representation of epithelial tumor evolution indicating the selection bottleneck that can promote acquisition of anomalous components that normalize mitotic dysfunction and thus support clonal expansion.

Close modal

Given the capacity of anomalous ACRBP expression to support robust mitotic progression in tumor-derived ovarian cancer cell lines, we next examined the consequence of ACRBP depletion on the mitotic progression of minimally cultured ascites-derived tumor explant cultures. Samples were obtained at the UNC Lineberger Cancer Hospital from the ascites of three patients: two had previously undergone multiple rounds of taxane-based chemotherapeutic regimens (LCOV2 and LCOV4) and one was chemonaïve (LCOV17; see Materials and Methods). The derivation of epithelial tumor cells from these samples was validated by cytokeratin 16 staining (Fig. 6C), and high-efficiency siRNA transfection protocols were derived using cytotoxic siRNAs targeting ubiquitin B (UBB; Fig. 6D). Upon ACRBP depletion, LCOV2 and LCOV4 displayed a significant increase in mitotic figures following exposure to doses of paclitaxel that had little to no effect on controls (Fig. 6E). LCOV17s respond to paclitaxel by micronucleation, as we have previously observed in ES-2 cells (Fig. 4C). This response was also sensitized upon ACRBP depletion (Fig. 6D). Thus, inhibition of ACRBP expression increased the sensitivity of all samples to paclitaxel-induced mitotic defects.

Here, we have uncovered a selective dependency of ovarian cancer cells on ACRBP for robust mitotic progression. Of note, the ACRBP locus is predominantly expressed in the spermatocyte lineage and is not detected in normal lung or ovarian epithelia. As a consequence of expression in a sex-specific immune-privileged site, the gene product is not recognized as a “self” antigen and can evoke a humoral response when displayed by cancer cells (13). The activation of ACRBP expression seems to counter what would otherwise be a NuMA-dependent pathologic perturbation of microtubule dynamics and centrosome function. The detection of native ACRBP/NuMA complexes suggests that this antagonistic relationship is relatively direct. Centrosome overduplication is a common characteristic of tumors that can be normalized by a centrosome coalescence process that occurs in metaphase. Aberrant accumulation of NuMA impairs centrosome coalescence and can therefore promote gross chromosomal instability. This type of spindle malfunction has been assigned as an early lesion in many tumor settings and is a source of “heritable” variation that can both drive the emergence of adaptive traits as well as restrict population expansion through high-frequency mitotic death (3134). This intermediate state in tumor evolution likely selects for acquisition of traits, such as ACRBP expression, that restore mitotic fidelity and allow clonal expansion of variants with robust proliferative and survival capacity (35, 36). We suggest that the antagonistic relationship uncovered here is a consequence of the historical genomic instability that promotes stochastic acquisition of tumorigenic traits during the evolution of disease (Fig. 6E). Thus, ACRBP is a member of a class of tumor-specific vulnerabilities that emerge as a consequence of tumor evolution, not as components that drive disrespect of proliferation or survival checkpoints but rather as components that normalize the perturbed mitotic infrastructure responsible for disease-promoting genetic variation. Such “emergent dependencies,” if druggable, likely represent therapeutic intervention targets with large therapeutic windows.

No potential conflicts of interest were disclosed.

We thank Paola Gehrig (Division of Gynecological Oncology) for aid in obtaining live tumor explants, Kunle Odunsi for ACRBP monoclonal antibody, and Ben Neel for helpful discussions.

Grant Support: Robert Welch Foundation grant I-1414 and National Cancer Institute grants CA71443 (M.A. White) and CA128926 (A.W. Whitehurst). Y. Xie was supported by UL1 RR024982, K.M. Cappell was supported by National Cancer Institute training grant CA071341-14, and A.W. Whitehurst was supported in part by the American Cancer Society grant PF-07-120-01-GMC.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Rieder
CL
,
Maiato
H
. 
Stuck in division or passing through: what happens when cells cannot satisfy the spindle assembly checkpoint
.
Dev Cell
2004
;
7
:
637
51
.
2
Gascoigne
KE
,
Taylor
SS
. 
How do anti-mitotic drugs kill cancer cells?
J Cell Sci
2009
;
122
:
2579
85
.
3
Zalcberg
J
,
Millward
M
,
Bishop
J
, et al
. 
Phase II study of docetaxel and cisplatin in advanced non-small cell lung cancer
.
J Clin Oncol
1998
;
16
:
1948
53
.
4
Schiller
JH
,
Harrington
D
,
Belani
CP
, et al
. 
Comparison of four chemotherapy regimens for advanced non-small cell lung cancer
.
N Engl J Med
2002
;
346
:
92
8
.
5
Ichiki
M
,
Kawasaki
M
,
Takayama
K
, et al
. 
A multicenter phase II study of carboplatin and paclitaxel with a biweekly schedule in patients with advanced non-small cell lung cancer: Kyushu thoracic oncology group trial
.
Cancer Chemother Pharmacol
2006
;
58
:
368
73
.
6
Yumuk
PF
,
Turhal
NS
,
Gumus
M
, et al
. 
Results of paclitaxel (day 1 and 8) and carboplatin given on every three weeks in advanced (stage III-IV) non-small cell lung cancer
.
BMC Cancer
2005
;
5
:
10
.
7
Ramaswamy
S
. 
Rational design of cancer-drug combinations
.
N Engl J Med
2007
;
357
:
299
300
.
8
Whitehurst
AW
,
Bodemann
BO
,
Cardenas
J
, et al
. 
Synthetic lethal screen identification of chemosensitizer loci in cancer cells
.
Nature
2007
;
446
:
815
9
.
9
Simpson
A
,
Caballero
OL
,
Jungbluth
A
,
Chen
Y-T
,
Old
LJ
. 
Cancer/testis antigens, gametogenesis and cancer
.
Nat Rev Cancer
2005
;
5
:
615
25
.
10
Okumura
H
,
Noguchi
Y
,
Uenaka
A
, et al
. 
Identification of an HLA-A24-restricted OY-TES-1 epitope recognized by cytotoxic T-cells
.
Microbiol Immunol
2005
;
49
:
1009
16
.
11
Ono
T
,
Kurashige
T
,
Harada
N
, et al
. 
Identification of proacrosin binding protein sp32 precursor as a human cancer/testis antigen
.
Proc Natl Acad Sci U S A
2001
;
98
:
3282
7
.
12
Tammela
J
,
Uenaka
A
,
Ono
T
, et al
. 
OY-TES-1 expression and serum immunoreactivity in epithelial ovarian cancer
.
Int J Oncol
2006
;
29
:
903
10
.
13
Scanlan
MJ
,
Simpson
AJ
,
Old
LJ
. 
The cancer/testis genes: review, standardization, and commentary
.
Cancer Immun
2004
;
4
:
1
.
14
Irizarry
RA
,
Bolstad
BM
,
Collin
F
,
Cope
LM
,
Hobbs
B
,
Speed
TP
. 
Summaries of affymetrix GeneChip probe level data
.
Nucleic Acids Res
2003
;
31
:
e15
.
15
Irizarry
RA
,
Hobbs
B
,
Collin
F
, et al
. 
Exploration, normalization, and summaries of high density oligonucleotide array probe level data
.
Biostatistics
2003
;
4
:
249
64
.
16
Yeung
KY
,
Fraley
C
,
Murua
A
,
Raftery
AE
,
Ruzzo
WL
. 
Model-based clustering and data transformations for gene expression data
.
Bioinformatics
2001
;
17
:
977
87
.
17
Kaplan
EL
,
Meier
P
. 
Nonparametric estimation from incomplete observations
.
J Am Stat Assoc
1958
;
53
:
457
81
.
18
Collett
D
.
Modelling survival data in medical research
.
Chapman & Hall/CRC
; 
2003
.
19
Langdon
SP
,
Lawrie
SS
,
Hay
FG
, et al
. 
Characterization and properties of nine human ovarian adenocarcinoma cell lines
.
Cancer Res
1988
;
48
:
6166
72
.
20
Ban
KH
,
Torres
JZ
,
Miller
JJ
, et al
. 
The END network couples spindle pole assembly to inhibition of the anaphase-promoting complex/cyclosome in early mitosis
.
Dev Cell
2007
;
13
:
29
42
.
21
Quintyne
NJ
,
Reing
JE
,
Hoffelder
DR
,
Gollin
SM
,
Saunders
WS
. 
Spindle multipolarity is prevented by centrosomal clustering
.
Science
2005
;
307
:
127
9
.
22
Kremer
BE
,
Haystead
T
,
Macara
IG
. 
Mammalian septins regulate microtubule stability through interaction with the microtubule-binding protein MAP4
.
Mol Biol Cell
2005
;
16
:
4648
59
.
23
Tirnauer
JS
,
Bierer
BE
. 
EB1 proteins regulate microtubule dynamics, cell polarity, and chromosome stability
.
J Cell Biol
2000
;
149
:
761
6
.
24
Compton
DA
,
Luo
C
. 
Mutation of the predicted p34cdc2 phosphorylation sites in NuMA impair the assembly of the mitotic spindle and block mitosis
.
J Cell Sci
1995
;
108
:
621
33
.
25
Gaglio
T
,
Saredi
A
,
Compton
DA
. 
NuMA is required for the organization of microtubules into aster-like mitotic arrays
.
J Cell Biol
1995
;
131
:
693
708
.
26
Merdes
A
,
Heald
R
,
Samejima
K
,
Earnshaw
WC
,
Cleveland
DW
. 
Formation of spindle poles by dynein/dynactin-dependent transport of NuMA
.
J Cell Biol
2000
;
149
:
851
62
.
27
Merdes
A
,
Ramyar
K
,
Vechio
JD
,
Cleveland
DW
. 
A complex of NuMA and cytoplasmic dynein is essential for mitotic spindle assembly
.
Cell
1996
;
87
:
447
58
.
28
Silkworth
WT
,
Nardi
IK
,
Scholl
LM
,
Cimini
D
. 
Multipolar spindle pole coalescence is a major source of kinetochore mis-attachment and chromosome mis-segregation in cancer cells
.
PLoS ONE
2009
;
4
:
e6564
.
29
Ganem
NJ
,
Godinho
SA
,
Pellman
D
. 
A mechanism linking extra centrosomes to chromosomal instability
.
Nature
2009
;
460
:
278
82
.
30
Bast
RC
 Jr.
,
Hennessy
B
,
Mills
GB
. 
The biology of ovarian cancer: new opportunities for translation
.
Nat Rev Cancer
2009
;
9
:
415
28
.
31
Weaver
BA
,
Bonday
ZQ
,
Putkey
FR
,
Kops
GJ
,
Silk
AD
,
Cleveland
DW
. 
Centromere-associated protein-E is essential for the mammalian mitotic checkpoint to prevent aneuploidy due to single chromosome loss
.
J Cell Biol
2003
;
162
:
551
63
.
32
Weaver
BA
,
Silk
AD
,
Montagna
C
,
Verdier-Pinard
P
,
Cleveland
DW
. 
Aneuploidy acts both oncogenically and as a tumor suppressor
.
Cancer Cell
2007
;
11
:
25
36
.
33
Lengauer
C
,
Kinzler
KW
,
Vogelstein
B
. 
Genetic instabilities in human cancers
.
Nature
1998
;
396
:
643
9
.
34
Baker
DJ
,
Jin
F
,
Jeganathan
KB
,
van Deursen
JM
. 
Whole chromosome instability caused by Bub1 insufficiency drives tumorigenesis through tumor suppressor gene loss of heterozygosity
.
Cancer Cell
2009
;
16
:
475
86
.
35
Kwon
M
,
Godinho
SA
,
Chandhok
NS
, et al
. 
Mechanisms to suppress multipolar divisions in cancer cells with extra centrosomes
.
Genes Dev
2008
;
22
:
2189
203
.
36
Rancati
G
,
Pavelka
N
,
Fleharty
B
, et al
. 
Aneuploidy underlies rapid adaptive evolution of yeast cells deprived of a conserved cytokinesis motor
.
Cell
2008
;
135
:
879
93
.