During childhood, the thyroid gland is one of the most sensitive organs to the carcinogenetic effects of ionizing radiation that may lead to papillary thyroid carcinoma (PTC) associated with RET/PTC oncogene rearrangement. Exposure to ionizing radiation induces a transient “oxidative burst” through radiolysis of water, which can cause DNA damage and mediates part of the radiation effects. H2O2 is a potent DNA-damaging agent that induces DNA double-strand breaks, and consequently, chromosomal aberrations. Irradiation by 5 Gy X-ray increased extracellular H2O2. Therefore, we investigated the implication of H2O2 in the generation of RET/PTC1 rearrangement after X-ray exposure. We developed a highly specific and sensitive nested reverse transcription-PCR method. By using the human thyroid cell line HTori-3, previously found to produce RET/PTC1 after γ-irradiation, we showed that H2O2, generated during a 5 Gy X-ray irradiation, causes DNA double-strand breaks and contributes to RET/PTC1 formation. Pretreatment of cells with catalase, a scavenger of H2O2, significantly decreased RET/PTC1 rearrangement formation. Finally, RET/PTC chromosomal rearrangement was detected in HTori-3.1 cells after exposure of cells to H2O2 (25 μmol/L), at a dose that did not affect the cell viability. This study shows for the first time that H2O2 is able to cause RET/PTC1 rearrangement in thyroid cells and consequently highlights that oxidative stress could be responsible for the occurrence of RET/PTC1 rearrangement found in thyroid lesions even in the absence of radiation exposure. Cancer Res; 70(10); 4123–32. ©2010 AACR.

Chromosomal rearrangements involving the RET gene (REarranged during Transfection) are highly prevalent in papillary thyroid carcinomas (PTC) occurring after childhood exposure either to environmental radiation after the Chernobyl accident or to medical external radiation (14). In the normal thyroid gland, RET which encodes the tyrosine kinase receptor for growth factors belonging to the glial-derived neurotrophilic factor family, is expressed only in parafollicular thyroid cells. The recombination of the intracellular kinase encoding domain of the RET gene with a heterologous gene expressed ubiquitously generates RET/PTC chimeric oncogene proteins that are expressed in follicular thyroid cells. These chimeric proteins are constitutively active (1, 2). RET/PTC1, which is the most frequent rearrangement, is the result of the fusion of RET and CCDC6 genes from a paracentric inversion of the long arm of chromosome 10 with breakpoints in q11.2 and q21 [inv(10) (q11.2q21); ref. 5]. Despite the fact that RET and CCDC6 genes are 30 mb apart, their high spatial proximity in interphase nuclei in normal thyroid cells was thought to promote their recombination (6, 7).

External radiation during childhood increases the risk of thyroid tumors, either benign or malignant (14, 8). More than 90% of these cancers are papillary, presenting a RET/PTC rearrangement in 70% of cases. Several in vitro and in vivo studies have shown that exposure to ionizing radiation induces RET/PTC rearrangement. Thus, using a nested PCR assay, RET/PTC1 transcripts were detected in a human undifferentiated thyroid carcinoma cell line (8505C) after exposure to 50 Gy of X-rays (9). RET/PTC1 and RET/PTC3 were detected in human thyroid tissues transplanted in severe combined immunodeficiency mice and submitted to X-ray irradiation (10). More recently, RET/PTC rearrangements were induced in immortalized human thyroid cells (HTori-3) after exposure to γ-radiation in a dose-dependent manner (11). These results strongly support the direct role of radiation exposure in RET/PTC generation.

Ionizing radiation exposure induces a transient “oxidative burst” through water radiolysis (12) that generates H2O2, and in turn, H2O2 could cause DNA damage and mediate part of the radiation effects (12). H2O2 can induce DNA double-strand breaks (DSB) and consequently chromosomal aberrations (1316).

In this study, we show for the first time that H2O2 produced during irradiation but also when it is added to the cell medium, causes RET/PTC1 chromosomal rearrangements in human thyroid cells. Consequently, oxidative stress could be responsible through the generation of H2O2 for the occurrence of RET/PTC1 rearrangements that may lead to thyroid tumors, even in the absence of radiation exposure.

Cell culture conditions

The human thyroid epithelial cell line (HTori-3), purchased from the European Tissue Culture collection, was grown in phenol red–free RPMI 1640 (Invitrogen, Inc.), supplemented with 1% (v/v) antibiotics/antimycotics (Invitrogen), 2 mmol/L of l-glutamine (Invitrogen), and 10% (v/v) FCS (PAA Laboratories). The human thyroid papillary carcinoma cell line (TPC-1) was cultured in the same medium. The human embryo lung fibroblast (MRC5) cell line, kindly given by Dr. Fillippo Rosselli (FRE 2939, Centre National de la Recherche Scientifique, Villejuif, France), was cultured in phenol red–free DMEM (Invitrogen) supplemented with 1% (v/v) antibiotics/antimycotics, 2 mmol/L of l-glutamine, 1 mmol/L of sodium pyruvate (Invitrogen), and 10% FCS. Normal human thyroid tissue specimens were collected at Institut Gustave Roussy in accordance with local and national ethics laws. Informed consent was obtained from all patients. Primary human thyrocytes were cultured as previously described (17).

Expression of thyroid differentiation markers

Total RNA from cells was extracted using Trizol reagent (Invitrogen) according to the instructions of the manufacturer and reverse transcription was done as previously described (17). cDNA was then amplified by 40 temperature cycles (95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute) in a GeneAmp 9600 apparatus and AmpliTaq Gold's protocol (Applied Biosystems). The housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (G3PDH) cDNA was amplified as a control. Selected primers are listed in Table 1.

Table 1.

Sequence of the selected primers and predicted size of PCR product

PrimersSenseSequence 5′–3′PCR products
Human TPO CGGGTCATCTGTGACAACAC 448 bp 
− CGGAGTCTACGCAGGTTCTC 
Human Tg AGGCCCTGCTCTCTAACTCC 445 bp 
− GCCAAAGGAGTGCTGAAGTC 
Human TSH-receptor CTTGCTGGACGTGTCTCAAA 418 bp 
− CTGGCCAAAACCAATGATCT 
Human G3PDH ACCACAGTCCATGCCATCAC 452 bp 
− TCCACCACCCTGTTGCTGTA 
Human external RET/PTC1 CAAGAGAACAAGGTGCTGAAG (CCDC6 exon 2) 283 bp 
− GCAGGTCTCGAAGCTCACTC (RET exon 12) 
Human internal RET/PTC1 GGTGCTGAAGATAGAGCTGGA (CCDC6 exon 2) 212 bp 
− TGTACCCTCCTCTGCCTTTC (RET exon 2) 
RT-RET-994 CACTTTGCGTGGTGTAGATATG  
PrimersSenseSequence 5′–3′PCR products
Human TPO CGGGTCATCTGTGACAACAC 448 bp 
− CGGAGTCTACGCAGGTTCTC 
Human Tg AGGCCCTGCTCTCTAACTCC 445 bp 
− GCCAAAGGAGTGCTGAAGTC 
Human TSH-receptor CTTGCTGGACGTGTCTCAAA 418 bp 
− CTGGCCAAAACCAATGATCT 
Human G3PDH ACCACAGTCCATGCCATCAC 452 bp 
− TCCACCACCCTGTTGCTGTA 
Human external RET/PTC1 CAAGAGAACAAGGTGCTGAAG (CCDC6 exon 2) 283 bp 
− GCAGGTCTCGAAGCTCACTC (RET exon 12) 
Human internal RET/PTC1 GGTGCTGAAGATAGAGCTGGA (CCDC6 exon 2) 212 bp 
− TGTACCCTCCTCTGCCTTTC (RET exon 2) 
RT-RET-994 CACTTTGCGTGGTGTAGATATG  

NOTE: +/− means that the oligonucleotide is sense or antisense in relation to cDNA.

Transient cell transfection

HTori-3 cells reaching 50% to 60% confluence were transfected using JetPEI transfection reagent and the Polyplus transfection protocol (Ozyme) with pHyPer-nuc or pHyPer-Cyto vector (Evrogen JSC). After 48 hours, the cells were visualized by confocal microscopy.

Confocal fluorescence microscopy

pHyPer-transfected cells were plated on glass-bottomed dishes, exposed to 5 Gy of X-ray irradiation or to 25 μmol/L of H2O2, and immediately analyzed by confocal microscopy. The fluorescence (excitation/emission, 488/530 nm) was examined under an LSM 510 confocal microscope (Zeiss).

Cell treatment

X-ray irradiation

In most experiments, 5 × 106 cells were plated in a 175 cm2 flask and 16 hours later exposed to a single dose of X-irradiation from an X-ray Generator operating at 200 KVe and 15 mA at a dose rate of 1 Gy/min. Just before irradiation at room temperature, the cell medium was replaced with fresh medium. Four hours after irradiation, cells were collected by trypsinization and split into 10 six-well plates at a density of ∼2.2 × 104 cells per well, grown for 15 days, and harvested.

Hydrogen peroxide

For RET/PTC1 detection, 5 × 106 cells were plated in a 175 cm2 flask and 16 hours later exposed to 25 μmol/L of H2O2 in serum-free medium for 1 hour at 37°C. Four hours later, cells were collected by trypsinization and split into 10 six-well plates at a density of ∼2.2 × 104 cells per well, grown for 15 days, and harvested.

Detection of RET/PTC1 rearrangements

The Total RNA from irradiated cells cultured in six-well plates was extracted using a NucleoSpin RNA II kit (Macherey-Nagel) according to the protocols of the manufacturer. The integrity and purity of each RNA sample was verified with the Agilent 2100 Bioanalyzer (Agilent Biotechnologies). The RET-specific reverse transcription was achieved by using a gene-specific primer (RT-RET-994) in the presence of Moloney murine leukemia virus reverse transcriptase (Invitrogen). The first and the nested PCR were carried out with 35 cycles in the respective conditions (95°C for 30 seconds, 58°C for 1 minute, and 72°C for 1 minute) and (95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds) in a GeneAmp 9600 apparatus using a protocol from AmpliTaq (Applied Biosystems). For optimization of the first-round PCR conditions, three target reverse transcriptions from each sample were followed by three first PCRs. Briefly, 6 μg of RNA from each sample was divided into 2 μg aliquots, dispensed in 10 μL of reverse transcription buffer, and incubated for 120 minutes at 37°C according to the protocols of the manufacturer. Each reaction mixture was then diluted with 14 μL of the PCR buffer containing 0.5 units of Taq DNA polymerase (Applied Biosystems, Roche). The first-round reverse transcription-PCR (RT-PCR) products were pooled, diluted 1:5, and then 5 μL were used for one nested PCR. The PCR amplification products were analyzed with 1.5% agarose gel electrophoresis and ethidium bromide staining. The specificity of the amplification product with predicted size was confirmed by EcoRI digestion. The primers used are listed in Table 1.

Measurement of H2O2 generation

Production of H2O2 was determined by reaction with cell-impermeable 10-acetyl-3,7-dihydroxyphenoxazine (Amplex Red reagent, Invitrogen) in the presence of excess peroxidase, producing fluorescent resorufin. Briefly, HTori-3 cells were plated into six-well plates at a density of 2.5 × 105 per well in complete medium. Sixteen hours later, the cells were washed twice with warm Dulbecco's PBS (D-PBS) without CaCl2 and MgCl2 (Invitrogen) and irradiated by 5 Gy of X-ray in D-PBS with CaCl2 and MgCl2 (Invitrogen). Cell-free assay was also performed in D-PBS with CaCl2 and MgCl2. At regular time intervals, 100 μL of irradiated medium aliquots were removed and kept on ice in the dark until H2O2 quantification. For H2O2 quantification, 100-μL aliquots were mixed with 100 μL of a working solution of D-PBS with CaCl2 and MgCl2 containing 1 unit/mL of horseradish peroxidase, 2 mg/mL d-glucose and 100 μmol/L of Amplex Red and incubated for 30 minutes at room temperature. Relative fluorescence units (excitation/emission, 544/595 nm) measured in a multiwell fluorescence plate reader (Wallac 1420 Victor2, Perkin-Elmer) were converted into H2O2 concentrations using a calibration curve.

Detection of intracellular reactive oxygen species

The peroxide-sensitive fluorescent probe 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA; Molecular Probes) was used to assess the generation of intracellular reactive oxygen species (ROS). This compound is converted by intracellular esterases to 2′,7′-dichlorodihydrofluorescein, which is then oxidized by intracellular ROS to the highly fluorescent 2′,7′-dichlorodihydrofluorescein (DCF). HTori-3 cells were plated at a density of 2.5 × 105 cells per well into six-well plates in complete culture medium. Sixteen hours later, the cells were harvested by trypsinization, resuspended in 0.5 mL of serum-free medium and incubated with 10 μmol/L of DCFH-DA and with increased concentration of H2O2 for 1 hour at 37°C in serum-free medium in the dark. Fluorescence was recorded on FL-1 channel of FACSVantage SE (Becton Dickinson). The cellular viability was assessed by propidium iodide staining. For experiments with catalase, HTori-3 cells were plated at a density of 105 cells per well into 24-well plates in complete culture medium as described above. Sixteen hours later, the cell culture medium was removed and the cells were treated or not with 100 units/mL of catalase for 2 and 4 hours at 37°C in serum-free medium. The cells were then washed twice with warm D-PBS without CaCl2 and MgCl2 to remove residual catalase, and incubated with 10 μmol/L of CM-H2DCFDA for 1 hour at 37°C in serum-free medium in the dark before being treated with 25 μmol/L of H2O2. Relative fluorescence units (excitation/emission, 485/535 nm) were measured in a multiwell fluorescence plate reader (Wallac 1420 Victor2, Perkin-Elmer).

Cell survival test

Cell proliferation/viability of HTori-3 cells (96-well plates; 3 × 104 cells/well) was quantified by means of a colorimetric assay based on the reduction of the colorless tetrazolium salt 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (WST-1, Roche Applied Science) to formazan, according to the instructions of the manufacturer.

SDS-PAGE and Western blotting procedures

Western blot analysis was performed with lysates prepared as previously described (17). Primary antibody against phosphorylated Ser139 of histone H2AX (γH2AX) was purchased from Millipore whereas total histone H2AX was purchased from Abcam. The secondary antibodies used were, respectively, horseradish peroxidase–conjugated anti-mouse (Santa Cruz) and horseradish peroxidase–conjugated goat anti-rabbit (Southern Biotech). Specific binding was detected by the Enhancer Chemiluminescence system.

Statistical analysis

Data are means ± SEM. Student's t test was used with P < 0.05 as the significant threshold.

In vitro irradiation of the HTori-3 cells induced RET/PTC1 formation

The human thyroid epithelial cell line

The HTori-3 cell line has been successfully used (11) to study the occurrence of RET/PTC rearrangement after in vitro radiation exposure. In spite of the presence of multiple numerical and structural chromosomal abnormalities, these cells present some advantages: they have three intact copies of chromosome 10 with undisrupted RET locus and a high proliferation rate, both increasing the probability of RET/PTC formation after radiation exposure (11, 18). As previously shown, the HTori-3 cell line expresses mRNA of thyroid differentiation markers such as thyroglobulin (Tg), thyroperoxidase (TPO), and TSH receptor, which are positively regulated by TSH (Fig. 1A). Primary cultures of human thyrocytes were used as a control. Unlike thyrocytes, HTori-3 cells did not produce extracellular H2O2 under stimulated and nonstimulated conditions (data not shown).

Figure 1.

Expression of thyroid-specific gene transcripts in human HTori-3 cells and RET/PTC1 molecular method detection. A, RT-PCR analysis demonstrating the expression of thyroid differentiation genes Tg, TPO, TSH receptor, and control gene G3PDH in human HTori-3. The cells were cultured for 24 hours in the presence or absence of 1 mU/mL of TSH. Primary human thyrocytes were used as positive controls. B, detection of RET/PTC1 rearrangements in serial dilutions of cells positive for the rearrangement (TPC-1) in nonirradiated HTori-3 cells. C, the specificity of PCR amplification product was ascertained by EcoRI digestion. D, the inducibility of RET/PTC1 rearrangements by X-irradiation at a dose of 5 Gy in human HTori-3 cells. TPC1 cells were used as positive controls. P1, first PCR; P2, nested PCR indicates negative controls done during the different steps without cDNA; ★, specific amplification product verified by EcoRI digestion. G3PDH was used for normalization. Lane numbers correspond with cell wells.

Figure 1.

Expression of thyroid-specific gene transcripts in human HTori-3 cells and RET/PTC1 molecular method detection. A, RT-PCR analysis demonstrating the expression of thyroid differentiation genes Tg, TPO, TSH receptor, and control gene G3PDH in human HTori-3. The cells were cultured for 24 hours in the presence or absence of 1 mU/mL of TSH. Primary human thyrocytes were used as positive controls. B, detection of RET/PTC1 rearrangements in serial dilutions of cells positive for the rearrangement (TPC-1) in nonirradiated HTori-3 cells. C, the specificity of PCR amplification product was ascertained by EcoRI digestion. D, the inducibility of RET/PTC1 rearrangements by X-irradiation at a dose of 5 Gy in human HTori-3 cells. TPC1 cells were used as positive controls. P1, first PCR; P2, nested PCR indicates negative controls done during the different steps without cDNA; ★, specific amplification product verified by EcoRI digestion. G3PDH was used for normalization. Lane numbers correspond with cell wells.

Close modal

Detection of RET/PTC1 rearrangement

To detect RET/PTC1, we developed a highly specific and sensitive nested RT-PCR method by using first a gene-specific primer for reverse transcription and second two couples of primers designed, respectively, from CCDC6 exon 2 and RET exon 12 (Table 1). Dilution experiments were carried out mixing TPC-1 cells bearing the RET/PTC1 rearrangement with untreated HTori-3 cells in which RET/PTC1 rearrangement was undetectable (Table 2) to evaluate the sensitivity of the method. RNA was extracted from the mixture and subjected to nested RT-PCR. A 212 bp product could be detected from the TPC-1 cells when mixed with HTori-3 cells at a ratio of 1:106 (Fig. 1B). The specificity of RET/PTC1-positive amplified product was ascertained by EcoRI digestion of the PCR products that resulted in the predicted fragments (Fig. 1C). Then, RET/PTC1 rearrangement was sought in HTori-3 cells after X-ray exposure. Representative ethidium bromide-stained gels of RT-PCR products are shown in Fig. 1D. To exclude the possibility of degradation of extracted RNA, G3PDH was amplified from each sample using RT-PCR as a control. Because the highest number of RET/PTC1 was observed after 5 Gy of γ-radiation in cells grown for 9 days after irradiation (11), the cells were irradiated with a single dose of 5 Gy X-ray, 4 hours later, seeded in six-well plates and collected after 15 days. In these conditions, RET/PTC1 rearrangement was detected in ∼20% of cell-containing wells (mean, 20.53 ± 1.98; Table 2). Thus, we confirmed that the HTori-3 cell line is a valuable in vitro model for studying the mechanisms of RET/PTC1 generation. The RET/PTC1 signal intensity in the positive wells seemed comparable to the signal in TPC1 lanes because the nested PCR conditions were not compatible with quantification. Indeed, the initial, outer primer PCR phase was not conducted in the exponential phase. No transcripts of RET/PTC1 rearrangement were detectable in the nonthyroid irradiated MRC5 cell line and were analyzed in the same experimental conditions of radiation exposure (Table 2), showing that RET/PTC1 rearrangement does not occur in fibroblasts.

Table 2.

RET/PTC1 transcript formation in irradiated and surviving HTori-3 and MRC5 cells

TreatmentsWells testedWells RET/PTC1 positiveRET/PTC1 (%)
HTori-3 Experience 1 Control 60 
Experience 1 5 Gy 51 11 21.6 
Experience 2 5 Gy 60 14 23.3 
Experience 3 5 Gy 30 16.7 
MRC5 Experience 1 Control 30 
Experience 1 5 Gy 60 
HTori-3 Experience 1 5 Gy + catalase 30 6.7 
Experience 2 5 Gy + catalase 30 
Experience 3 5 Gy + catalase 30 
HTori-3 Experience 1 H2O2 25 μmol/L 60 13 21.7 
Experience 2 H2O2 25 μmol/L 60 8.33 
Experience 3 H2O2 25 μmol/L 60 13.3 
TreatmentsWells testedWells RET/PTC1 positiveRET/PTC1 (%)
HTori-3 Experience 1 Control 60 
Experience 1 5 Gy 51 11 21.6 
Experience 2 5 Gy 60 14 23.3 
Experience 3 5 Gy 30 16.7 
MRC5 Experience 1 Control 30 
Experience 1 5 Gy 60 
HTori-3 Experience 1 5 Gy + catalase 30 6.7 
Experience 2 5 Gy + catalase 30 
Experience 3 5 Gy + catalase 30 
HTori-3 Experience 1 H2O2 25 μmol/L 60 13 21.7 
Experience 2 H2O2 25 μmol/L 60 8.33 
Experience 3 H2O2 25 μmol/L 60 13.3 

NOTE: Effect of the catalase pretreatment on the RET/PTC1 incidence in irradiated surviving HTori-3 cells. RET/PTC1 incidence in HTori-3 cells exposed to H2O2.

Ionizing radiation exposure produces H2O2 in the extracellular medium through radiolysis of water

Ionizing radiation exposure is known to induce a transient oxidative burst through radiolysis of water (12). The concentration of H2O2 produced in the medium through radiolysis of water after irradiation with 5 Gy of X-ray was measured at different time intervals. In the absence of cells, the concentration estimated at 12 μmol/L remained unchanged 30 minutes after irradiation (Fig. 2A). On the other hand, in the presence of cells, H2O2 rapidly disappeared and only 50% remained at 10 minutes after irradiation. The addition of 100 units/mL of catalase, a scavenger of H2O2, suppressed radiation-induced H2O2 formation in the cell medium.

Figure 2.

A, measurement of H2O2 production after 5 Gy of X-irradiation at different time intervals. The H2O2 quantification was performed in the serum-free D-PBS medium by using an H2O2 (0–2 μmol/L) standard curve as described in Materials and Methods. Catalase (100 units/mL) was added to the cell medium during irradiation. B, DNA DSBs evaluated by phosphorylation of histone H2AX in HTori-3 cells irradiated with 5 Gy of X-rays. γH2AX and total H2AX were detected by Western blotting with specific antibodies. This Western blot is representative of four independent experiments. C, HyPer response to 5 Gy of X-ray irradiation. Confocal analysis of H2O2-dependent fluorescence in HTori-3 cells expressing pHyPer-cyto or pHyPer-nuc. D, effect of pretreatment with 100 units/mL catalase on DNA DSB formation. Catalase was also added in the cell medium during the 5-Gy irradiation.

Figure 2.

A, measurement of H2O2 production after 5 Gy of X-irradiation at different time intervals. The H2O2 quantification was performed in the serum-free D-PBS medium by using an H2O2 (0–2 μmol/L) standard curve as described in Materials and Methods. Catalase (100 units/mL) was added to the cell medium during irradiation. B, DNA DSBs evaluated by phosphorylation of histone H2AX in HTori-3 cells irradiated with 5 Gy of X-rays. γH2AX and total H2AX were detected by Western blotting with specific antibodies. This Western blot is representative of four independent experiments. C, HyPer response to 5 Gy of X-ray irradiation. Confocal analysis of H2O2-dependent fluorescence in HTori-3 cells expressing pHyPer-cyto or pHyPer-nuc. D, effect of pretreatment with 100 units/mL catalase on DNA DSB formation. Catalase was also added in the cell medium during the 5-Gy irradiation.

Close modal

Pretreatment of thyroid cells by catalase decreases the occurrence of DNA DSBs and of RET/PTC1 rearrangement after exposure to ionizing radiation

Ionizing radiation exposure is known to induce several kinds of DNA damage. DNA DSBs is the main cytotoxic lesion induced by ionizing radiation. The phosphorylated form of histone H2AX (γH2AX) at Ser139 is generally used as a marker of DNA DSBs (19, 20). As shown in Fig. 2B, HTori-3 cells displayed phosphorylation of histone H2AX at 5 minutes after exposure to 5 Gy of X-ray irradiation that increased up to 1 hour. A genetically encoded highly specific fluorescent probe has been recently developed for detecting H2O2 inside living cells (21). This indicator, named HyPer, has been shown to have submicromolar affinity to H2O2 and to be insensitive to other oxidants. Using the mammalian expression vectors encoding, respectively, cytosolic- and nuclear-targeted HyPer, we visualized changes in the fluorescence of HyPer in both the cytosol and the nucleus upon irradiation of the cells, suggesting that an increase of the H2O2 levels occurred following radiation exposure and might be responsible for some of the effects of radiation (Fig. 2C). To confirm the potential role of H2O2, protection of DNA from oxidative damage was evaluated by pretreating HTori-3 cells with catalase at different times before irradiation. Whereas the presence of catalase in the culture medium during irradiation partially protected the cells from DNA damage, preincubation of the cells for 4 hours with catalase significantly decreased the level of phosphorylated H2AX as shown by Western blotting (Fig. 2D). This result confirmed by pulse-field gel electrophoresis, a sensitive assay for DNA DSBs, showed that preincubation of HTori-3 cells for 4 hours with catalase protected DNA from the occurrence of DSBs and significantly decreased the occurrence of RET/PTC1 rearrangements (Table 2).

Extracellular H2O2 is able to cause RET/PTC1 rearrangements in thyroid cells

The effect of H2O2 concentrations from 1 to 25 μmol/L on the intracellular ROS level was determined by flow cytometry analysis of DCFHDA oxidation. One hour after treatment with H2O2, we measured a concentration-dependent increase of fluorescence, reflecting an increased level of intracellular ROS (Fig. 3A). Preincubation of HTori-3 cells with catalase for at least 4 hours was necessary to produce a significant decrease in intracellular level of ROS induced after 25 μmol/L of H2O2 treatment (Fig. 3B). Using confocal microscopy, after the addition of 25 μmol/L of H2O2 in the cell culture medium, we followed the changes in fluorescence of HyPer expressed in the nucleus. After 2 minutes, we observed an increase in fluorescence indicating an H2O2-induced signal in the nucleus (Fig. 3C). Preincubation of cells for 4 hours with catalase significantly decreased the nuclear fluorescence.

Figure 3.

Effect of extracellular H2O2 exposure on intracellular ROS levels. A, effect of H2O2 on ROS levels measured as DCF fluorescence by flow cytometry in HTori-3 cells incubated after 1 hour with different concentrations of H2O2. B, effect of catalase on ROS levels in HTori-3 cells treated with 25 μmol/L of H2O2. Catalase (100 units/mL) was preincubated for 2 and 4 hours before irradiation. ROS levels were measured as DCF fluorescence in a multiwell fluorescence plate reader as described in Materials and Methods. C, nuclear fluorescence intensities of HyPer in cells exposed to 25 μmol/L of H2O2 as measured by confocal microscopy.

Figure 3.

Effect of extracellular H2O2 exposure on intracellular ROS levels. A, effect of H2O2 on ROS levels measured as DCF fluorescence by flow cytometry in HTori-3 cells incubated after 1 hour with different concentrations of H2O2. B, effect of catalase on ROS levels in HTori-3 cells treated with 25 μmol/L of H2O2. Catalase (100 units/mL) was preincubated for 2 and 4 hours before irradiation. ROS levels were measured as DCF fluorescence in a multiwell fluorescence plate reader as described in Materials and Methods. C, nuclear fluorescence intensities of HyPer in cells exposed to 25 μmol/L of H2O2 as measured by confocal microscopy.

Close modal

As shown in Fig. 4A, H2O2 concentrations ≤25 μmol/L did not induce any significant cell death after 24 hours. Time course analysis of γH2AX in response to 12 and 25 μmol/L of H2O2 in HTori-3 cells showed that H2AX was highly phosphorylated after 1 hour (Fig. 4B). The phosphorylation of H2AX at Ser139, which was correlated to the H2O2 concentration, confirmed that 12 μmol/L of H2O2, corresponding to the concentration measured after radiation exposure, was able to cause DNA damages. As observed for 5 Gy of X-ray irradiation, preincubation of cells with catalase for 4 hours protected DNA from DSBs produced after exposure to 12 μmol/L of H2O2 for 1 hour (Fig. 4C).

Figure 4.

Effect of extracellular H2O2 exposure on cell viability and DNA DSBs formation. A, cell survival was evaluated by WST-1 assay as described in Materials and Methods. B, DNA DSBs evaluation by phosphorylation of histone H2AX in HTori-3 cells exposed to 12 and 25 μmol/L of H2O2 for 1 hour. C, effect of catalase on DNA DSBs induced by 12 μmol/L of H2O2 incubation. HTori-3 cells were preincubated with 100 units/mL of catalase for 4 hours before being exposed to 12 μmol/L of H2O2. Phosphorylation of histone H2AX was detected after 1 hour. D, the inducibility of RET/PTC1 rearrangements by H2O2 exposure in human HTori-3 cells. TPC1 cells were used as positive controls. The specificity of RET/PTC1-positive amplified product was verified by EcoRI digestion. M, DNA size markers; H2O, negative controls without cDNA; ★, specific amplification product. G3PDH was used for normalization. Lane numbers correspond with cell wells.

Figure 4.

Effect of extracellular H2O2 exposure on cell viability and DNA DSBs formation. A, cell survival was evaluated by WST-1 assay as described in Materials and Methods. B, DNA DSBs evaluation by phosphorylation of histone H2AX in HTori-3 cells exposed to 12 and 25 μmol/L of H2O2 for 1 hour. C, effect of catalase on DNA DSBs induced by 12 μmol/L of H2O2 incubation. HTori-3 cells were preincubated with 100 units/mL of catalase for 4 hours before being exposed to 12 μmol/L of H2O2. Phosphorylation of histone H2AX was detected after 1 hour. D, the inducibility of RET/PTC1 rearrangements by H2O2 exposure in human HTori-3 cells. TPC1 cells were used as positive controls. The specificity of RET/PTC1-positive amplified product was verified by EcoRI digestion. M, DNA size markers; H2O, negative controls without cDNA; ★, specific amplification product. G3PDH was used for normalization. Lane numbers correspond with cell wells.

Close modal

In the light of these findings, we treated the cells with 25 μmol/L of H2O2 for 1 hour, which was found to cause the highest level of DNA DSBs without affecting the cell viability and evaluated the occurrence of RET/PTC1 rearrangements in HTori-3 cells 2 weeks later by nested RT-PCR. As shown in Table 2 and Fig. 4D, 25 μmol/L of H2O2 was able to produce RET/PTC1 chromosomal rearrangements.

To our knowledge, this is the first report showing that H2O2 promotes RET/PTC1 rearrangements in thyroid cells, and consequently, these data confirm that H2O2 might play an important role in the initiation of PTCs. The direct link between ionizing radiation, RET/PTC rearrangements and PTC occurrence has been supported by the observation that RET/PTC rearrangements are frequently found in PTC samples from patients who had been exposed during childhood to external radiation or who lived in highly contaminated regions after the Chernobyl accident (22). In addition, several studies have shown that in vitro irradiation of thyroid cells is able to cause RET/PTC1 rearrangements (9, 10). In a recent study, RET/PTC rearrangements were induced in differentiated human thyroid cells by a range of γ-radiation doses (0.1–10 Gy), that were equivalent to those received by patients who developed a thyroid cancer (11). By using the same experimental model, we also identified RET/PTC1 rearrangements in thyroid cells grown for 15 days after in vitro exposure to a single X-radiation dose of 5 Gy.

Chronic oxidative stress may disrupt the genomic integrity of cells and might induce chromosomal instability (1416, 23). For many years, H2O2, considered a DNA genotoxic agent, was suspected to play a mutagenic role in the thyroid gland and to be responsible for the thyroid nodules that were frequently found (24). Several observations strengthen this hypothesis: in mice, the spontaneous mutation frequency is higher in the thyroid gland than in any other organ (25), somatic mutations of the TSH receptor are frequent in human thyroid tissue (24), and thyroid glands of mice transgenic for the mutant a1B-adrenergic receptor (Tg-a1BAR mice) that have increased H2O2 generation develop malignant nodules with a high frequency (26). H2O2 causes DNA damage, such as guanine oxidation, single-strand breaks and DSBs leading to mutagenesis and genomic instability. DNA DSBs (27) that can lead to chromosomal aberrations (28) result from both a direct effect of irradiation on DNA and from the generation of ROS by radiolysis of water (12). Although DSBs induced by H2O2 are considered rare events, it has been shown that H2O2 induces DSBs with a ratio of DSBs to single-strand breaks similar to that caused by X-rays (13, 29). This induction of DSBs by H2O2 was also observed in rat thyroid cell line (PCCl3), in human thyroid primary culture and pig thyroid slices (13). However, in these experiments, the H2O2 concentrations used were at least five times higher than those used herein to generate DSBs in the human thyroid cell line HTori-3. This difference is probably due to the models used, which have different cell membrane permeability and antioxidant capacities. HTori-3 cells seem to be particularly sensitive to H2O2, because 50 μmol/L of H2O2 treatment affected the viability of these cells. Our results showed that extracellular H2O2 produced through water radiolysis significantly contributes to the appearance of DSBs, and importantly, to RET/PTC1 generation. The extracellular concentration of H2O2 measured after 5 Gy of irradiation was estimated at 12 μmol/L and was shown to cause DNA damage. This result was in disagreement with the recent report of very low H2O2 concentrations after irradiation of the cell medium by similar γ-ray doses and of the absence of a potentiating effect of L-buthionine-sulphoximine on DNA damage, a drug that decreases intracellular glutathione, and consequently, induces a protective effect for H2O2 against degradation (13). This discrepancy could be due to our experimental conditions, because serum was withdrawn from the cell medium before irradiation to avoid H2O2 produced during radiation exposure to be degraded by the catalase activity of the serum (30).

It was previously observed that extracellular H2O2 rapidly disappeared (13, 31). We also found that 90% of the extracellular H2O2 measured in the cell medium after irradiation had disappeared after 20 minutes. As measured by DCF fluorescence in the cells, the intracellular production of ROS was correlated with the concentrations of exogenous H2O2 added in the medium. Importantly, these H2O2 concentrations ranged from 1 to 25 μmol/L and were of the same order as those measured in the medium after radiation exposure, and were shown to produce DNA damage. Using HyPer, a specific probe for H2O2, we detected a temporal increase in H2O2 in the nucleus of cells treated with exogenous H2O2. These results confirm that extracellular H2O2 diffuses into the cells, reach the nucleus, and consequently, might cause DNA damage. Catalase was able to protect cells from the toxic effects of H2O2, demonstrating for the first time that H2O2 produced during irradiation contributes to the generation of RET/PTC1 in thyroid cells. In the present study, we observed that pretreatment of the cells with catalase for at least 4 hours produced a significant inhibition of DNA DSBs induced by irradiation as shown by phosphorylation of histone H2AX. The protective effect of pretreatment with catalase was associated with a significant decrease in intracellular and intranuclear levels of H2O2. As the oxidative-sensitive fluorescence dye (DCF) is not specific for H2O2 and could also be oxidized by other radicals produced in these conditions, the decrease observed was partial (32, 33). Thus, as observed in other studies (34), exogenous catalase could enter the cells by endocytosis, scavenge intracellular H2O2, and protect the cells from oxidative damage. However, it could also interact with the cell membranes in a time-dependent manner and scavenge extracellular H2O2 before its diffusion into the cells. These results corroborate previous results showing a protective effect of antioxidant treatments from ionizing radiation–induced malignant transformation and tumorigenicity of HTori-3 cells (35, 36).

The thyroid gland, in normal conditions, produces large amounts of H2O2 (37), that was estimated in stimulated rat thyroid cell lines and in rat thyroid cells in primary cultures to be ∼10 nmol/100 mg/h (38). The thyrocytes have two H2O2-generating systems located at the apical membrane: DUOX1 and DUOX2, which are NADPH oxidases (39, 40). Besides being important for hormone synthesis, DUOX could be a major source of free radicals and ROS that could cause substantial DNA damage. Recently, we showed that NOX4, another NADPH oxidase, is expressed in normal and cancer thyroid tissues and might be an H2O2 generator located inside the thyroid cell (17).

In this study, we show that H2O2 is able to cause RET/PTC1 chromosomal rearrangement, the most prevalent mutation detected in PTC. However, we cannot exclude that H2O2 could also cause other specific mutations found in the thyroid cancers as BRAF, Ras, and PAX8/PPARγ.

No potential conflicts of interest were disclosed.

Grant Support: Electricité de France, Association pour la Recherche sur le Cancer, Ligue Contre le Cancer (comité du Val-de Marne), and Agence Nationale de la Recherche.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Suarez
HG
. 
Molecular basis of epithelial thyroid tumorigenesis
.
C R Acad Sci III
2000
;
323
:
519
28
.
2
Ciampi
R
,
Nikiforov
YE
. 
RET/PTC rearrangements and BRAF mutations in thyroid tumorigenesis
.
Endocrinology
2007
;
148
:
936
41
.
3
Bounacer
A
,
Wicker
R
,
Caillou
B
, et al
. 
High prevalence of activating ret proto-oncogene rearrangements, in thyroid tumors from patients who had received external radiation
.
Oncogene
1997
;
15
:
1263
73
.
4
Smida
J
,
Salassidis
K
,
Hieber
L
, et al
. 
Distinct frequency of ret rearrangements in papillary thyroid carcinomas of children and adults from Belarus
.
Int J Cancer
1999
;
80
:
32
8
.
5
Pierotti
MA
,
Santoro
M
,
Jenkins
RB
, et al
. 
Characterization of an inversion on the long arm of chromosome 10 juxtaposing D10S170 and RET and creating the oncogenic sequence RET/PTC
.
Proc Natl Acad Sci U S A
1992
;
89
:
1616
20
.
6
Nikiforova
MN
,
Stringer
JR
,
Blough
R
,
Medvedovic
M
,
Fagin
JA
,
Nikiforov
YE
. 
Proximity of chromosomal loci that participate in radiation-induced rearrangements in human cells
.
Science
2000
;
290
:
138
41
.
7
Gandhi
M
,
Medvedovic
M
,
Stringer
JR
,
Nikiforov
YE
. 
Interphase chromosome folding determines spatial proximity of genes participating in carcinogenic RET/PTC rearrangements
.
Oncogene
2006
;
25
:
2360
6
.
8
Unger
K
,
Zurnadzhy
L
,
Walch
A
, et al
. 
RET rearrangements in post-Chernobyl papillary thyroid carcinomas with a short latency analysed by interphase FISH
.
Br J Cancer
2006
;
94
:
1472
7
.
9
Ito
T
,
Seyama
T
,
Iwamoto
KS
, et al
. 
In vitro irradiation is able to cause RET oncogene rearrangement
.
Cancer Res
1993
;
53
:
2940
3
.
10
Mizuno
T
,
Iwamoto
KS
,
Kyoizumi
S
, et al
. 
Preferential induction of RET/PTC1 rearrangement by X-ray irradiation
.
Oncogene
2000
;
19
:
438
43
.
11
Caudill
CM
,
Zhu
Z
,
Ciampi
R
,
Stringer
JR
,
Nikiforov
YE
. 
Dose-dependent generation of RET/PTC in human thyroid cells after in vitro exposure to γ-radiation: a model of carcinogenic chromosomal rearrangement induced by ionizing radiation
.
J Clin Endocrinol Metab
2005
;
90
:
2364
9
.
12
Narayanan
PK
,
Goodwin
EH
,
Lehnert
BE
. 
Alpha particles initiate biological production of superoxide anions and hydrogen peroxide in human cells
.
Cancer Res
1997
;
57
:
3963
71
.
13
Driessens
N
,
Versteyhe
S
,
Ghaddhab
C
, et al
. 
Hydrogen peroxide induces DNA single- and double-strand breaks in thyroid cells and is therefore a potential mutagen for this organ
.
Endocr Relat Cancer
2009
;
16
:
845
56
.
14
Dayal
D
,
Martin
SM
,
Limoli
CL
,
Spitz
DR
. 
Hydrogen peroxide mediates the radiation-induced mutator phenotype in mammalian cells
.
Biochem J
2008
;
413
:
185
91
.
15
Limoli
CL
,
Giedzinski
E
. 
Induction of chromosomal instability by chronic oxidative stress
.
Neoplasia
2003
;
5
:
339
46
.
16
Roy
K
,
Kodama
S
,
Suzuki
K
,
Fukase
K
,
Watanabe
M
. 
Hypoxia relieves X-ray-induced delayed effects in normal human embryo cells
.
Radiat Res
2000
;
154
:
659
66
.
17
Weyemi
U
,
Caillou
B
,
Talbot
M
, et al
. 
Intracellular expression of ROS-generating NADPH oxidase NOX4 in normal and cancer thyroid tissues
.
Endocr Relat Cancer
2010
;
17
:
27
37
.
18
Lemoine
NR
,
Mayall
ES
,
Jones
T
, et al
. 
Characterisation of human thyroid epithelial cells immortalised in vitro by simian virus 40 DNA transfection
.
Br J Cancer
1989
;
60
:
897
903
.
19
Rogakou
EP
,
Pilch
DR
,
Orr
AH
,
Ivanova
VS
,
Bonner
WM
. 
DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139
.
J Biol Chem
1998
;
273
:
5858
68
.
20
Rothkamm
K
,
Lobrich
M
. 
Evidence for a lack of DNA double-strand break repair in human cells exposed to very low X-ray doses
.
Proc Natl Acad Sci U S A
2003
;
100
:
5057
62
.
21
Belousov
VV
,
Fradkov
AF
,
Lukyanov
KA
, et al
. 
Genetically encoded fluorescent indicator for intracellular hydrogen peroxide
.
Nat Methods
2006
;
3
:
281
6
.
22
Detours
V
,
Delys
L
,
Libert
F
, et al
. 
Genome-wide gene expression profiling suggests distinct radiation susceptibilities in sporadic and post-Chernobyl papillary thyroid cancers
.
Br J Cancer
2007
;
97
:
818
25
.
23
Clutton
SM
,
Townsend
KM
,
Walker
C
,
Ansell
JD
,
Wright
EG
. 
Radiation-induced genomic instability and persisting oxidative stress in primary bone marrow cultures
.
Carcinogenesis
1996
;
17
:
1633
9
.
24
Krohn
K
,
Maier
J
,
Paschke
R
. 
Mechanisms of disease: hydrogen peroxide, DNA damage and mutagenesis in the development of thyroid tumors
.
Nat Clin Pract Endocrinol Metab
2007
;
3
:
713
20
.
25
Maier
J
,
van Steeg
H
,
van Oostrom
C
,
Karger
S
,
Paschke
R
,
Krohn
K
. 
Deoxyribonucleic acid damage and spontaneous mutagenesis in the thyroid gland of rats and mice
.
Endocrinology
2006
;
147
:
3391
7
.
26
Ledent
C
,
Denef
JF
,
Cottecchia
S
, et al
. 
Costimulation of adenylyl cyclase and phospholipase C by a mutant α 1B-adrenergic receptor transgene promotes malignant transformation of thyroid follicular cells
.
Endocrinology
1997
;
138
:
369
78
.
27
Sarasin
A
,
Bounacer
A
,
Lepage
F
,
Schlumberger
M
,
Suarez
HG
. 
Mechanisms of mutagenesis in mammalian cells. Application to human thyroid tumours
.
C R Acad Sci III
1999
;
322
:
143
9
.
28
Richardson
C
,
Jasin
M
. 
Frequent chromosomal translocations induced by DNA double-strand breaks
.
Nature
2000
;
405
:
697
700
.
29
Bradley
MO
,
Kohn
KW
. 
X-ray induced DNA double strand break production and repair in mammalian cells as measured by neutral filter elution
.
Nucleic Acids Res
1979
;
7
:
793
804
.
30
Korystov
YN
,
Shaposhnikova
VV
,
Korystova
AF
,
Emel'yanov
MO
. 
Detection of reactive oxygen species induced by radiation in cells using the dichlorofluorescein assay
.
Radiat Res
2007
;
168
:
226
32
.
31
Song
Y
,
Driessens
N
,
Costa
M
, et al
. 
Roles of hydrogen peroxide in thyroid physiology and disease
.
J Clin Endocrinol Metab
2007
;
92
:
3764
73
.
32
Walrand
S
,
Valeix
S
,
Rodriguez
C
,
Ligot
P
,
Chassagne
J
,
Vasson
MP
. 
Flow cytometry study of polymorphonuclear neutrophil oxidative burst: a comparison of three fluorescent probes
.
Clin Chim Acta
2003
;
331
:
103
10
.
33
Mikkelsen
RB
,
Wardman
P
. 
Biological chemistry of reactive oxygen and nitrogen and radiation-induced signal transduction mechanisms
.
Oncogene
2003
;
22
:
5734
54
.
34
Shin
MH
,
Rhie
GE
,
Kim
YK
, et al
. 
H2O2 accumulation by catalase reduction changes MAP kinase signaling in aged human skin in vivo
.
J Invest Dermatol
2005
;
125
:
221
9
.
35
Kennedy
AR
,
Ware
JH
,
Guan
J
, et al
. 
Selenomethionine protects against adverse biological effects induced by space radiation
.
Free Radic Biol Med
2004
;
36
:
259
66
.
36
Kennedy
AR
,
Zhou
Z
,
Donahue
JJ
,
Ware
JH
. 
Protection against adverse biological effects induced by space radiation by the Bowman-Birk inhibitor and antioxidants
.
Radiat Res
2006
;
166
:
327
32
.
37
Bjorkman
U
,
Ekholm
R
. 
Accelerated exocytosis and H2O2 generation in isolated thyroid follicles enhance protein iodination
.
Endocrinology
1988
;
122
:
488
94
.
38
Corvilain
B
,
Collyn
L
,
van Sande
J
,
Dumont
JE
. 
Stimulation by iodide of H(2)O(2) generation in thyroid slices from several species
.
Am J Physiol Endocrinol Metab
2000
;
278
:
E692
9
.
39
Dupuy
C
,
Ohayon
R
,
Valent
A
,
Noel-Hudson
MS
,
Deme
D
,
Virion
A
. 
Purification of a novel flavoprotein involved in the thyroid NADPH oxidase. Cloning of the porcine and human cdnas
.
J Biol Chem
1999
;
274
:
37265
9
.
40
De Deken
X
,
Wang
D
,
Many
MC
, et al
. 
Cloning of two human thyroid cDNAs encoding new members of the NADPH oxidase family
.
J Biol Chem
2000
;
275
:
23227
33
.