Ligand-Dependent Platelet-Derived Growth Factor Receptor (PDGFR)-α Activation Sensitizes Rare Lung Cancer and Sarcoma Cells to PDGFR Kinase Inhibitors

Sunitinib is a multitargeted tyrosine kinase inhibitor that potently inhibits vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), and c-KIT receptor kinases (1). In renal cell carcinoma, sunitinib showed superiority over standard IFN-α therapy (2); sunitinib is now recommended for previously untreated patients with advanced renal cell carcinoma. Sunitinib is also approved for treatment of imatinib-refractory gastrointestinal stromal tumors (GIST), many of which harbor activating c-KIT or PDGF receptor (PDGFR) kinase domain mutations (3). A recent phase II clinical study has revealed efficacy of single-agent sunitinib in advanced non–small-cell lung cancer (NSCLC) patients (4). Accumulating evidence indicates that inhibition of VEGF signaling using various antiangiogenic agents can suppress tumor growth and improve patient survival (2, 5, 6); however, it is unclear from studies involving multikinase inhibitors, such as sunitinib, as to the relative contribution of VEGF receptor inhibition in suppressing tumor growth.

The PDGFR/PDGF system includes two receptors (PDGFRA and PDGFRB) and four ligands (PDGFA, PDGFB, PDGFC, and PDGFD; ref. 7). Ligand binding induces receptor dimerization, enabling autophosphorylation of specific tyrosine residues and subsequent recruitment of a variety of signal transduction molecules (8). PDGFR regulates normal cellular growth and differentiation (9), and expression of activated PDGFR promotes oncogenic transformation (10), suggesting that activating mutations or gene rearrangements could play a role in human tumorigenesis. Numerous in vitro and in vivo studies showed that inhibition of PDGFRA signaling disrupts cancer cell survival in the subset of GISTs with activating PDGFRA mutations (11, 12). In a recent study of 150 NSCLC patient samples, activated PDGFRA was detected in 13% of cases (13), suggesting that a subset of these patients might benefit from therapies directed against PDGFRA. Moreover, PDGFRA overexpression has been observed in metastatic versus nonmetastatic medulloblastoma patient samples, and disrupting PDGFRA function inhibited the metastatic potential of medulloblastoma cells in vitro (14).

We recently reported the development of a high-throughput platform for profiling a large panel of human cancer cell lines with molecularly targeted inhibitors to identify subsets with significant sensitivity (15). That analysis revealed several examples of genotype-associated sensitivities to selective kinase inhibitors, showing the utility of this strategy to reveal cell autonomous tumor cell responses to anticancer agents. Here, we describe the profiling of 637 cancer cell lines for sensitivity to single-agent sunitinib, using a monoculture format that precludes any contribution of drug effects on angiogenesis. Our studies revealed that the majority of tested cell lines are highly refractory to sunitinib. Of the two cell lines showing sunitinib sensitivity, both were found to express high levels of PDGFRA and PDGFC mRNA and phosphorylated PDGFRA protein. ShRNA knockdown of PDGFRA was as effective as sunitinib in decreasing cell proliferation in both cell lines, and targeting the PDGFC ligand alone was similarly effective.

Our findings suggest that whereas antiangiogenesis activity probably accounts for the majority of the clinical benefit associated with sunitinib treatment in solid tumors, in rare cases, beyond PDGFRA-mutant GISTs, activated PDGFRA may be the critical target, and that selective PDGFRA inhibitors may be useful in the clinical management of a subset of tumors that exhibit PDGFRA activation. Moreover, in tumors with evidence of PDGFC ligand overexpression, neutralizing antibodies may be an equally effective therapeutic modality.

Human cancer cell lines and cell viability assays. Human cancer cell lines were obtained from commercial vendors and were maintained and tested for viability using an automated platform, as previously described (15). Cells were treated for 72 h with 1 μmol/L sunitinib and then assayed for cytostatic or cytotoxic responses. We elected to use this concentration based on steady-state plasma concentrations of ∼0.2 μmol/L at clinically recommended doses of sunitinib in patients and based on the experimental time points addressed in the studies.

Protein detection. Immunodetection of proteins following SDS-PAGE was done using standard protocols. Equal protein loading was assessed using a β-tubulin antibody (Sigma). Akt, extracellular signal–regulated kinase 1/2 (Erk1/2), phospho-Erk1/2 (T202/Y204), PDGFRA, phospho-PDGFRA (Y720), phospho-PDGFRA (Y754), signal transducer and activator of transcription 3 (STAT3), and phospho-STAT3 (S727) antibodies were from Cell Signaling Technology. The phospho-Akt (S473) antibody was from BioSource International. All antibodies were used at 1:1,000 dilution, except β-tubulin (1:10,000).

Kinase inhibitors. Sunitinib was obtained from MGH pharmacy. Sorafenib and imatinib were purchased from American Custom Chemicals Corporation. The in vitro kinase specificity profile of all three compounds is listed in Supplementary Table S1.

Fluorescence in situ hybridization. Fluorescence in situ hybridization (FISH) was done as described previously (16). Probes for PDGFRA and c-KIT were derived from BAC clones RP11-58C6 (PDGFRA) and RP11-977G3 (c-KIT) and purchased from Invitrogen.

DNA sequencing. Genomic DNA was isolated using the Gentra purification system. PDGFRA, PDGFRB, and c-KIT coding sequences were amplified from genomic DNA by PCR. PCR products were purified and subjected to bidirectional sequencing by using BigDye v1.1 (Applied Biosystems) in combination with an ABI3100 sequencer (Applied Biosystems). Primers used for sequencing are listed in Supplementary Table S2. Electropherograms were analyzed by using Sequence Navigator software (Applied Biosystems). All mutations were confirmed by at least two independent PCR amplifications.

Cell cycle analysis. Cells were pulsed with 10 μmol/L bromodeoxyuridine (BrdUrd) for 1 to 2 h before collection, centrifuged, and fixed in ice-cold 70% ethanol. Cells were washed with PBS/0.5% bovine serum albumin (BSA) and incubated in denaturing solution (2 mol/L HCl) for 20 min at room temperature. After a further wash with PBS/0.5% BSA, the cells were resuspended in 0.1 mol/L sodium borate for 2 min at room temperature. After an additional wash, cells were suspended with anti-BrdUrd monoclonal antibody for 20 min (1:500; Becton Dickinson). Cells were washed in PBS/0.5% BSA and the pellet was resuspended in FITC-conjugated antimouse IgG (1:50; Vector Laboratories) for 20 min. After an additional wash in PBS/0.5% BSA, cells were stained with 10 μg/mL propidium iodide (Sigma) and treated with RNase A (Sigma) before two-dimensional fluorescence-activated cell sorting analysis using CellQuest software (Becton Dickinson).

SNP and gene expression analyses. Gene copy numbers were determined as previously described using the GeneChip Human Mapping 250K. The array was then scanned on the GeneChip Scanner 3000 7G and analyzed using GTYPE version 4.0 with the Dynamic Model Mapping Algorithm and the GeneChip Human Mapping 500K Set library files (Mapping 250K_Nsp).

For gene expression studies, RNA was extracted using the Qiagen RNA easy kit (P/N 74106) and amplified and biotin labeled with the Arcturus RiboAmp RNA Amplification Kit using biotinylated ribonucleotides (Perkin-Elmer PN Biotin-11-UTP, NEL543001EA/Biotin-11-CTP, NEL542001EA) during in vitro transcription. Labeled aRNA was hybridized to Affymetric GeneChip Human X3P (GPL1352) using protocols described within the Affymetrix GeneChip Expression Analysis Technical Manual (PN701021 Rev. 3). Data were acquired using the Affymetrix GeneChip 3000 Scanner with autoloader and 7G upgrade. GCOS ver 1.4 software was used to run the scanner and analyze the data. The expression value for each gene was calculated using Affymetrix GeneChip software and data were analyzed using dChip software⁴

Quantitative PCR. Total RNA was isolated and purified from cells using STAT-60 (Tel-Test, Inc.). cDNA was transcribed from 2 μg of total RNA using the AffinityScript Multi Temperature cDNA Synthesis kit (Stratagene). Quantitative PCR was done using the QuantiTect SYBR Green PCR kit (Qiagen) and with an ABI PRISM 7000 real-time cycler (Applied Biosystems). Quantification was based on standard curves for each primer set from a serial dilution of the NCI-H1703 cell line cDNA. All samples were analyzed in triplicate. Primers sequences were GAPDH F, GAGTCAACGGATTTGGTCGT; GAPDH R, TTGATTTTGGAGGGATCTCG; PDGFRA F, AAATTGTGTCCACCGTGATCT; PDGFRA R, AGGCCAAAGTCACAGATCTTC; PDGFC F, AACGGAGTACAAGATCCTCAGC; and PDGFC R, CCATCACTGGGTTCCTCAAC.

RNA interference studies. ShRNAs targeting sequences within the genes encoding either PDGFRA (n = 10) or its ligand PDGFC (n = 5) were expressed from the pLKO.1 lentiviral vector (Supplementary Table S3). NCI-H1703 and A-204 cells were infected in the presence of polybrene (8 μg/mL). A cell line showing sunitinib-insensitivity (A549) was used to determine infection efficiency based on puromycin resistance and to confirm specificity. Protein lysates and RNA were collected 48 h postinfection, and cell numbers were determined 72 h postinfection.

PDGFC neutralizing antibody experiments. Cells were seeded in 1% fetal bovine serum medium and treated the following day with 5 to 20 ng/mL of an anti-PDGFC neutralizing antibody (R&D Systems, Inc.). Normal goat IgG at 20 ng/mL concentration was used as a control. Cells were fixed and stained 5 d after treatment, and cell viability was measured as previously described (15).

Rare human cancer cell lines are sensitive to single-agent sunitinib treatment. Using an automated platform to examine drug sensitivity in cancer cell lines (15), we tested the sunitinib sensitivity of 637 established human cancer cell lines derived from a wide variety of solid tumor types (Supplementary Fig. S1; ref. 1). Cells were treated for 72 hours with 1 μmol/L sunitinib and then assayed for cytostatic or cytotoxic responses. Whereas the vast majority of tested cell lines were largely refractory to treatment, two cell lines (A-204 rhabdomyosarcoma and NCI-H1703 NSCLC) displayed significant sunitinib sensitivity, as indicated by a >50% reduction in cell number (Fig. 1A). We note that cell lines derived from GISTs, which show clinical sunitinib sensitivity, reflecting inhibition of mutationally activated PDGFR or c-KIT kinases, were absent from the panel of tested lines. A few additional lines showed a relatively weaker response to sunitinib.

The sunitinib-sensitive NSCLC-derived cell line harbors focal PDGFRA gene amplification. Among 103 NSCLC cell lines tested, significant sunitinib sensitivity was observed only in the adenosquamous NCI-H1703 line (Fig. 1B). SNP array data available for 88 of these lines revealed that NCI-H1703 cells harbor focal PDGFRA gene amplification (Fig. 1B). This was confirmed by interphase FISH analysis (Supplementary Fig. S2A). There was no evidence of either c-KIT or PDGFRB genomic amplification or protein expression in these cells (data not shown). Sequence analysis of the entire coding sequence of PDGFRA, PDGFRB, and c-KIT in this cell line revealed a single mutation in exon 9 of PDGFRA (S478P), within the extracellular domain, which would not be expected to result in PDGFR activation.

The SNP array data revealed similarly elevated PDGFRA gene copy number in four other NSCLC cell lines (NCI-H1693, NCI-H2085, NCI-H23, and NCI-H661); however, these lines were sunitinib insensitive (Table 1; Fig. 2A). FISH analyses of these cell lines confirmed PDGFRA amplification (Supplementary Fig. S3). However, analysis of the transcriptional expression profile of tyrosine kinase signaling pathway–associated genes in the 90 NSCLC cell line panel revealed that only NCI-H1703 showed significant expression of PDGFRA mRNA (Supplementary Fig. S4). Furthermore, when the gene expression profile of NCI-H1703 cells was compared with the other 89 NSCLC cell lines for the most significant up-regulated and down-regulated mRNA transcripts, the most highly expressed mRNA in NCI-H1703 cells corresponded to PDGFRA (fold change of 213; Table 2). When we focused on those probes involved in PDGFR signaling, none of the other four NSCLC cell lines with increased PDGFRA copy number displayed increased PDGFRA mRNA expression (Fig. 2B). The observed increase in PDGFRA mRNA expression in the NCI-H1703 cells was confirmed by quantitative PCR (Fig. 2C).

Sunitinib dose-response curves for the NCI-H1703 cell line versus a panel of NSCLC cell lines with normal (Fig. 3A) or increased PDGFRA gene copy number (Fig. 3B) confirmed the unique sensitivity in NCI-H1703 cells. Moreover, expression of phosphorylated and total PDGFRA protein was only detected in NCI-H1703 cells (Fig. 3A and B), and PDGFRA protein was not detected in any of the sunitinib-insensitive cell lines. In fact, when we extended this panel to include an additional 26 NSCLC sunitinib-insensitive cell lines, we were unable to detect expression of PDGFRA in any other lines (Supplementary Fig. S5). Therefore, the increased transcriptional expression of PDGFRA in NCI-H1703 results in increased PDGFRA protein and is associated with elevated phospho-PDGFRA, which potentially mediates sensitivity to sunitinib.

To assess PDGFRA amplification in clinical NSCLC cases, we analyzed 143 NSCLC primary tumor specimens by FISH and detected 3 of 81 (3.7%) cases of focal PDGFRA amplification in squamous cell carcinomas (Supplementary Fig. S2B). PDGFRA amplification was not detected in any of 62 adenocarcinoma cases analyzed. Thus, focal PDGFRA gene amplification arises at relatively low frequency in NSCLC and may be more common in the squamous cell setting.

Inhibition of PDGFRA activation in NCI-H1703 cells disrupts downstream signaling. Treatment of NCI-H1703 cells with sunitinib for 6 hours resulted in complete inhibition of PDGFRA protein phosphorylation as well as that of Akt, a PDGFR effector (Fig. 3C). Sunitinib had no effect on such signaling in the sunitinib-insensitive cell lines (data not shown). To verify that PDGFRA-dependent signaling was indeed the basis for the observed sunitinib sensitivity of NCI-H1703 cells, we treated the cells with two additional PDGFRA kinase inhibitors, sorafenib and imatinib. Both compounds exhibited a similar activity to that of sunitinib (Fig. 3C), whereas none of the sunitinib-insensitive NSCLC cell lines displayed sensitivity to either agent (data not shown). Furthermore, like sunitinib, both compounds suppressed Akt signaling in NCI-H1703 cells (Fig. 3C). Together, these findings suggest that the NCI-H1703 NSCLC cells are dependent on activated PDGFRA signaling.

To investigate the underlying mechanism for the ability of sunitinib to reduce cell number in NCI-H1703 cells, we examined PARP cleavage, an indicator of apoptosis, and cell cycle profile. There was no evidence of PARP cleavage following treatment with 1 μmol/L sunitinib at 24, 48, or 72 hours in this cell line (data not shown), whereas cell cycle analysis confirmed a significant S-phase arrest at each of these time points (Supplementary Fig. S6), consistent with a cytostatic response to drug exposure.

PDGFRA activation is associated with sensitivity to sunitinib in a rhabdomyosarcoma cell line. As described above, in the initial screen of 637 cell lines for sunitinib sensitivity, a rhabdomyosarcoma cell line, A-204, was the most highly drug-sensitive line detected (Fig. 1A). To determine whether the observed sensitivity could be extended to other rhabdomyosarcoma cell lines, a panel of six additional rhabdomyosarcoma lines were tested for sunitinib sensitivity (Fig. 4A). Of the tested lines, only A-204 showed sunitinib sensitivity, and in only this cell line was PDGFRA protein detectable (Fig. 4A,, lane 1). Unlike in NCI-H1703 cells, FISH analysis did not reveal PDGFRA gene amplification in any of these lines (Fig. 4B), and DNA sequence analysis of PDGFRA, PDGFRB, and c-KIT in A-204 cells did not reveal any mutations. However, as in NCI-H1703 cells, we detected a substantial (15-fold) increase in PDGFRA mRNA expression in A-204 cells (Fig. 2C). Moreover, sunitinib treatment completely abolished Akt signaling in this line compared with a sunitinib-insensitive rhabdomyosarcoma line (Fig. 4C). In addition, treatment of A-204 cells with sorafenib and imatinib also disrupted Akt signaling (Fig. 4D) and similarly inhibited proliferation (data not shown). These results suggest that rare rhabdomyosarcoma cells are dependent on activated PDGFRA signaling, associated with increased expression of PDGFRA mRNA.

Amplification of the gene encoding the PDGFRA ligand PDGFC mediates PDGFRA activation. Gene expression profiles of 90 NSCLC cell lines using a filtered list of genes involved in PDGFR signaling revealed that NCI-H1703 was the only line displaying significant transcriptional up-regulation of PDGFRA together with the gene encoding one of its ligands, PDGFC (Fig. 2B). The increased PDGFC mRNA in NCI-H1703 cells (and in A-204 cells) was confirmed by quantitative PCR (Supplementary Fig. S7A). Only the NSCLC cell line NCI-H661 (sunitinib insensitive) showed similarly elevated PDGFC mRNA, but in the absence of expression of PDGFRA mRNA or protein. Further analysis of SNP array data from 88 NSCLC lines revealed a unique coamplification of the PDGFRA (4q12) and PDGFC (4q32) genes on chromosome 4 in NCI-H1703 cells, which was not observed in any of the other cell lines (Fig. 2A).

ShRNA-mediated knockdown of PDGFRA and PDGFC was used to directly assess their functional requirement in both the NCI-H1703 and A-204 cell lines (Supplementary Fig. S7B). There was no effect of these shRNAs on a sunitinib-insensitive cell line (A549) that lacks PDGFRA expression. In contrast, knockdown of PDGFRA in NCI-H1703 and A-204 cells significantly reduced proliferation to a similar extent as sunitinib treatment (Fig. 5A). Furthermore, knockdown of PDGFC expression also reduced proliferation in both lines, and the observed decrease was of the same magnitude seen following sunitinib treatment (Fig. 5A).

We also examined the activity of a neutralizing anti-PDGFC antibody to confirm the ligand knockdown findings and to assess the potential therapeutic value of anti-PDGFC antibodies in such tumor cells. We treated three cell lines (A549, NCI-H1703, and A-204) with a concentration range of the anti-PDGFC antibody. Whereas there was no detectable effect on the proliferation of A549 cells, the antibody reduced proliferation in the NCI-H1703 and A-204 cell lines to a similar extent to that seen following sunitinib treatment (Fig. 5B). Notably, the effect was observed in A-204 cells even at the lowest antibody concentration, potentially reflecting relatively higher PDGFC expression in the NCI-H1703 cells (Supplementary Fig. S7A). Combining sunitinib and the anti-PDGFC antibody did not result in any additive inhibitory effects on these cells (data not shown). ShRNA-mediated depletion of PDGFRA and PDGFC was used to determine the effect on PDGFRA activation and downstream signaling in the NCI-H1703 cells (Fig. 5C). ShRNA-mediated depletion of both receptor and ligand resulted in decreased PDGFRA phosphorylation and inhibition of Akt and Erk1/2 phosphorylation. Together, these results indicate that both of the sunitinib-sensitive cell lines show a similar dependency on increased PDGFRA and PDGFC expression for sustained proliferation.

Our cancer cell line profiling analysis with the multikinase inhibitor sunitinib has revealed that drug sensitivity in a monoculture context is restricted to a small number of lines exhibiting activated PDGFRA signaling. Moreover, in these cells, PDGFRA activation is coupled to critical downstream effectors such as Akt, and disrupting these pathways seems to mediate the inhibitory effects of sunitinib on proliferation. Previous reports of PDGFRA activation in cancer have been largely confined to GISTs (activating PDGFRA mutations) and rare cases of idiopathic hypereosinophilic syndrome (FIP1L1-PDGFRA fusion transcripts; refs. 18, 19). Our findings suggest that in additional rare cases of NSCLC and sarcoma, PDGFRA activation may be important in maintaining the malignant phenotype.

The clinical success of sunitinib in renal cancer has been suggested to reflect its role as a VEGF receptor inhibitor and the consequent effects on angiogenesis. Notably, renal cancers are highly vascularized tumors, suggesting a potential critical requirement for angiogenesis in that disease setting. However, the ability of sunitinib to target additional kinases, such as PDGFR, might contribute to its clinical activity in renal cancer. We note that our cell line panel included 19 renal cancer cell lines, none of which showed significant sunitinib sensitivity. This suggests that PDGFR is not likely to provide a critical dependency signal in renal cancer; however, a contributing role of PDGFR inhibition in the clinical activity of sunitinib cannot be excluded. Whereas in a conventional xenograft model, any observed consequence of drug treatment on tumor growth could potentially reflect direct effects on tumor cells as well as effects on the stroma and vasculature, our monoculture-based platform provides a means to isolate the tumor cell–autonomous drug response.

In both of the sunitinib-sensitive cancer cell lines identified, PDGFRA activation seems to be mediated by increased expression of the receptor as well as one of its ligands, PDGFC. This is in contrast to other models of receptor tyrosine kinase activation associated with gene amplification, wherein ligand-independent activation is typically postulated (20, 21). In NCI-H1703 cells, activation of the PDGFRA signaling pathways is a consequence of focal PDGFRA and PDGFC gene coamplification. To our knowledge, this is the first report in NSCLCs of overexpression of both an oncogenic receptor tyrosine kinase and its ligand, although coexpression of the PDGFRA or PDGFRB receptors with their cognate ligands at higher levels than seen in adjacent normal tissue has been reported for some gliomas and osteosarcomas (22, 23). Intriguingly, targeting PDGFC had a greater effect on proliferation in both sunitinib-sensitive cell lines than targeting PDGFRA. This raises the possibility that PDGFRA is not the sole critical target of PDGFC in these cells.

Our findings also suggest that antibodies directed against PDGFR ligands may have therapeutic potential in PDGFRA-dependent cancer. Traditionally, therapeutic antibodies have been targeted to cell surface receptors implicated in tumor cell proliferation or maintenance, rather than against their cognate ligands (24). Such antibodies typically show a more favorable toxicity profile than small-molecule kinase inhibitors, and when considered in the context of significant toxicities associated with sunitinib, our findings suggest potential clinical advantages of antibody-mediated targeting of the PDGFC ligand in some cancers.

Our observation that the PDGFRA gene amplification in the NCI-H1703 adenosquamous NSCLC cell line was also seen in a subset of squamous cell NSCLC clinical samples but in none of the adenocarcinoma samples screened by FISH raises the possibility that this represents an oncogenic mechanism unique to this histologic subtype. In agreement with our findings, Rikova and colleagues (13) detected PDGFRA activation using a phospho-proteomic screen in eight NSCLC patient samples as well as in the NCI-H1703 cell line. Whereas NSCLC adenocarcinoma patients are being actively recruited into clinical trials of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (in the setting of activating EGFR mutations) and anaplastic lymphoma kinase inhibitors (ALK translocations), to date, no drug-sensitizing genotypes have been identified for squamous cell NSCLC patients (25, 26). It remains to be seen whether retrospective analyses of sunitinib-responsive NSCLC patients will reveal enrichment for PDGFRA gene amplification or expression, and whether such patients' tumors show squamous histology.

Curiously, PDGFRA expression was only detected in the NCI-H1703 NSCLC cells, despite the fact that four other cell lines showed increased PDGFRA gene copy number. Thus, focal amplification of the PDGFRA gene may uniquely yield high level PDGFR expression, potentially reflecting an additional genomic alteration within this locus that influences the regulatory regions of PDGFRA gene transcription. Similarly, it remains unclear as to the molecular mechanism underlying increased PDGFRA or PDGFC mRNA expression in the A-204 cells. Sarcomas often harbor chromosomal translocations giving rise to oncogenic activation, and these can affect PDGFR signaling. For example, dermatofibrosarcoma protuberans and giant cell fibroblastomas harbor chromosomal rearrangements involving chromosome 17 and 22, in which the collagen type Iα1 (COLIA1) gene undergoes fusion with the gene encoding PDGFB (27). In one study of 42 cases of uterine sarcoma, 70% of tumors displayed increased PDGFRA expression compared with that seen in adjacent normal tissue (28). Likewise, in a study of 54 osteosarcoma patients, increased PDGFRA and PDGFRB expression was observed in tumors in more than 75% of cases (29). Notably, most Ewing sarcomas are associated with a gene fusion that produces a transcription factor (EWS/FLI-1) that promotes PDGFC mRNA expression (30). However, imatinib therapy in this setting shows minimal clinical activity (31). In these tumors, which are notoriously refractory to chemotherapy, targeting PDGFR signaling pathways may provide a useful alternative therapy.

In summary, our findings show that ligand-mediated activation of PDGFRA signaling may be a critical mediator of cell proliferation in a small subset of NSCLCs and rhabdomyosarcomas and may sensitize these cancer cells to either selective small-molecule PDGFR kinase inhibitors or ligand-neutralizing antibodies. Our findings suggest that sunitinib as well as other PDGFR kinase inhibitors may provide genotype-associated clinical benefit beyond the setting of PDGFR-mutant or c-KIT-mutant GISTs.

No potential conflicts of interest were disclosed.

Grant support: National Cancer Institute Specialized Program of Research Excellence in Lung Cancer award P20 CA090578-06.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank the members of the Settleman laboratory for helpful discussion throughout the course of these studies, and Michelle Longworth for assistance with the cell cycle analysis.