The G Protein–Coupled Receptor 87 Is Necessary for p53-Dependent Cell Survival in Response to Genotoxic Stress

G protein–coupled receptors (GPCR) constitute the largest and most diverse family of cell surface receptors. GPCRs contain a seven-membrane spanning helix connected by three intracellular loops with an extracellular NH₂ terminus and an intracellular COOH terminus (1). All GPCRs can trigger the exchange of GDP to GTP, which in turn leads to activation and subsequent dissociation of α subunit and βγ dimer of the G protein complex (2). GPCR signaling is subject to extensive regulations through receptor desensitization and sequestration, G protein activation, and enzymatic degradation of second messengers. Additionally, protein-protein interactions modulate GPCR signaling, including the formation of GPCR homodimers and heterodimers, the interaction with receptor activity–modifying proteins, and the binding of various scaffolding proteins to intracellular receptor domains (3).

Many GPCRs are overexpressed in tumor tissues (4). In addition, several GPCR ligands, such as bioactive peptides, biogenic amines, and chemokines, are highly expressed in the tumor microenvironment (5). Thus, GPCR signaling promotes cell growth and survival, angiogenesis, metastasis, and drug resistance (6–11). Due to the large number of GPCRs, their expression on the cell surface, and their diverse biological functions, GPCRs become the prime target for therapeutic intervention, accounting for 50% of all drug targets (12).

Under the normal condition, p53 is maintained at low levels via proteasomal degradation (13, 14). In response to DNA damage and other stresses, p53 is stabilized and activated (15), which then induces a plethora of downstream target genes (16), including p21 (WAF1/CIP1), Mdm2, ASC, and HB-EGF. These p53 target genes mediate p53 tumor suppression by inducing multiple cellular responses, including cell cycle arrest, apoptosis, DNA repair, and metabolism.

Here, we found that G protein–coupled receptor (GPR87) is regulated by p53 and DNA damage in a p53-dependent manner. We also found that knockdown of GPR87 sensitizes tumor cells to DNA damage–induced growth suppression in a p53-dependent manner. Our study revealed that GPR87 mediates p53 prosurvival function. Because GPR87 is a cell surface receptor, it might be explored as a target for cancer therapy.

Cell culture. MCF7, RKO, HCT116, MCF7-p53-KD, p53-null HCT116, RKO-E6, and RKO-p53-KD were previously described (17, 18). The MCF7 cell line that inducibly expresses p53 was as previously described (19–21). RKO and MCF7 cell lines, which inducibly express GPR87, were generated as previously described (22). To generate inducible GPR87 knockdown cell lines, pBabe-H1-siGPR87 (below for detail) was transfected into MCF7 (MCF7-TR-7) or RKO (RKO-TR-13) cells in which a tetracycline repressor is expressed by pcDNA6 (23). GPR87 knockdown cell lines were selected with puromycin and confirmed by reverse transcription-PCR (RT-PCR). To generate inducible GPR87 knockdown cell lines with stable p53 knockdown, pBabe-H1-siGPR87 was cotransfected with pBabe-U6-sip53 into RKO cells in which a tetracycline repressor is expressed by pcDNA6. The dual GPR87/p53 knockdown cell lines were selected with puromycin.

Plasmids. GPR87 was amplified by PCR using an expressed sequence tag (EST) clone (Genbank BC112941) as a template with forward primer 5′-ACAAGCTTAGAATGGGGTTCAACTTGACGC-3′ and reverse primer 5′-ACCTCGAGAGGCCTACACATCAGTGTAATC-3′. The small interfering RNA (siRNA)–resistant GPR87 was generated by two-step PCR with two sets of primers. The siRNA-targeting sequence (GCATCTTGCTGAATGGTTT) in GPR87 was replaced with a sequence with five substitutions (GCATCTTGtTaAAcGGccT; lowercase letters represent substitution) without changing the sequence of amino acids. The first set of primers is 5′-AGCATCTTGtTaAAcGGccTAGCAGTGTGGATCTTCTTCC-3′ (forward) and 5′-ACCTCGAGAGGCCTACACATCAGTGTAATC-3′ (reverse). The other set of primers is 5′-ACAAGCTTAGAATGGGGTTCAACTTGACGC-3′ (forward) and 5′-ACACTGCTAggCCgTTtAaCAAGATGCTTGCCACAAATAT-3′ (reverse).

To generate inducible siRNA against GPR87 under the control of the tetracycline-regulated H1 promoter, two 64-base oligos were annealed and then cloned into pBabe-H1 siRNA expression vector, and the resulting plasmid was designed pBabe-H1-siGPR87. The sense oligo is 5′-GATCCCCGCATCTTGCTGAATGGTTTTTCAAGAGAAAACCATTCAGCAAGATGCTTTTTGGAAA and the antisense oligo is 5′-AGCTTTTCCAAAAAGCATCTTGCTGAATGGTTTTCTCTTGAAAAACCATTCAGCAAGATGCGGG-3′, with the siRNA-targeting region underlined. We would like to mention that the siRNA-targeting sequence is unique to GPR87 but not to other members of the GPR family. The pBabe-U6-sip53 was previously described (24).

The luciferase reporter under the control of the p21 promoter, pGL2-p21A, was as previously described (25). A 433-bp DNA fragment containing a potential p53-RE in the GPR87 gene (nucleotides +476 to +909) was amplified from the genomic DNA purified from MCF7 cells with forward primer 5′-AAGGATCCATTCTGATCCCTGGAGAAGTCATG-3′ and reverse primer 5′-AAAAGCTTCAACAGGGTGTCTGGCTTTTTTCC-3′. The DNA fragment was confirmed by sequencing and then cloned upstream of the minimum c-fos promoter in the luciferase reporter O-Fluc (26). The resulting plasmid is designated as GPR87-W. GPR87-M was similarly generated with four nucleotide substitutions in the p53-responsive element (C and G at nucleotides +751 and +754 were replaced with T, whereas C and G at nucleotides +761 and +764 were replaced with T and A, respectively).

PCR primers. The primers to detect GPR87 are 5′-GCCAGGAAAGAACACCACCC-3′ (forward) and 5′-CGATCAGAATCAACCAGCACG-3′ (reverse). The primers to detect actin are 5′-CTGAAGTACCCCATCGAGCACGGCA-3′ (forward) and 5′-GGATAGCACAGCCTGGATAGCAACG-3′ (reverse).

Luciferase assay. The dual-luciferase assay was done in triplicate according to the manufacturer's instructions (Promega). The luciferase activity was measured 24 h following the transfection as previously described (23). The fold increase in relative luciferase activity is a product of the luciferase activity induced by wild-type or mutant p53 divided by that induced by empty pcDNA3 vector.

Microarray assay, Northern blot analysis, and RT-PCR. Total RNA was isolated from cells using Trizol reagent (Invitrogen). The U133-plus GeneChip was purchased from Affymetrix. GeneChip analysis was performed at the University of California Davis Gene Expression Facility according to the manufacturer's instruction. Northern blot analysis and preparation of p21 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes were as previously described (27). The GPR87 probe was prepared from EST clone BC112941. cDNA was generated using iScript cDNA Synthesis kit (Bio-Rad). Real-time PCR was performed using RealMaster mix with SYBR Green and realplex2 Mastercycler (Eppendorf). The data were analyzed with the Fit Points Method of the LightCycler software.

Immunocytochemical staining. Cells seeded on a slide chamber with or without tetracycline for 24 h were fixed with 3% paraformaldehyde and permeabilized with 0.1% Triton X-100. Cells were incubated with 1% bovine serum albumin (BSA) for 30 min and then incubated with primary antibody in 1% BSA overnight followed with secondary antibody for 30 min at room temperature. The slides were mounted in 4′,6-diamidino-2-phenylindole (DAPI) mounting medium for 15 min and sealed with nail polish.

Chromatin immunoprecipitation assay. Chromatin immunoprecipitation (ChIP) assay was done as described (24, 28, 29). To amplify the potential p53-RE in the GPR87 gene, PCR was done with forward primer 5′-CCACAAAGAACAGGGCAATC-3′ and reverse primer 5′-ACTGAGATCTCCATGCTTGC-3′. The primers to amplify p53-RE in the p21 gene and the region in the GAPDH gene were previously described (17).

Colony formation assay. MCF7 (400 per well) and RKO (200 per well) cells in a six-well plate were cultured with or without tetracycline (1.0 μg/mL) along with or without doxorubicin (10 ng/mL) or camptothecin (10 nmol/L) for ∼14 d and then fixed with methanol/glacial acetic acid (7:1) followed by staining with 0.1% crystal violet.

DNA histogram analysis. Cells were induced or uninduced to knock down GPR87 for 72 h followed by mock treatment or treatment with doxorubicin (250 ng/mL) for 24 h. The preparation of cells and fluorescence-activated cell sorting analysis were carried out as previously reported (29).

Western blot analysis. Western blotting was performed as described (24, 28). Antibodies used were anti-GPR87 (Abcam), anti-p53 (DO-1, PAb1801, PAb240, and PAb421), anti-actin (Sigma), anti-GAPDH (Santa Cruz Biotechnology), anti-p21 (C-19; Santa Cruz Biotechnology), anti-Mdm2 (Santa Cruz Biotechnology), anti–poly(ADP-ribose) polymerase (PARP; BD Pharmingen), and anti-Myc (9E10; Cell Signaling).

Statistical analysis. Data were presented as mean ± SD. Statistical significance was determined by Student's t test. Values of P < 0.05 were considered significant.

GPR87 is a novel target gene of p53. To identify novel target genes regulated by p53, microarray assay was performed with RNAs purified from MCF7 cells uninduced or induced to express p53. Many well-defined p53 target genes were found to be up-regulated, including p21, Mdm2, and FDXR. Among these is GPR87. To confirm this, Northern blot analysis was performed and showed that the level of GPR87 transcript was increased by wild-type p53 in MCF7 cells (Fig. 1A,, lanes 1 and 2). The levels of the p21 and GAPDH transcripts were examined as positive and loading controls, respectively. It is well known that DNA damage stabilizes and activates p53, leading to induction of p53 target genes. Thus, we tested whether GPR87 can be induced by DNA damage in cells harboring wild-type p53. We found that, like p21, GPR87 was up-regulated in MCF7, HCT116, and RKO cells treated with camptothecin, an inhibitor of DNA topoisomerase I (Fig. 1A,, compare lanes 3, 7, and 11 with lanes 4, 8, and 12, respectively). However, little if any up-regulation of GPR87 and p21 was observed in p53 knockdown MCF7, p53-null HCT116, and p53-null–like RKO (RKO-E6) cells (Fig. 1A , compare lanes 5, 9, and 13 with lanes 6, 10, and 14, respectively).

To quantify induction of GPR87, real-time PCR was performed. To make sure that p53 was properly activated, Western blot analysis was performed and showed that the level of p53 was increased along with induction of p21 on treatment with camptothecin in p53-proficient MCF7, HCT116, and RKO cells (Fig. 1B,, compare lanes 2, 6, and 10 with lanes 1, 5, and 9, respectively). In contrast, p53 and p21 were undetectable in p53 knockdown MCF7 and RKO cells and p53-null HCT116 cells regardless of treatment with camptothecin (Fig. 1B,, lanes 3 and 4, 7 and 8, and 11 and 12). Next, real-time PCR was performed with total RNAs purified from same groups of cells as in Fig. 1B. We found that the level of GPR87 transcript was increased in p53-proficient but not p53-deficient cells on treatment with camptothecin (∼4.7 fold in MCF7 cells and ∼3.5 fold in RKO and HCT116 cells; Fig. 1C). Similarly, the level of p21 was induced in p53-proficient but not p53-deficient cells (Fig. 1C).

To determine whether the increased levels of GPR87 transcript correlate with an increase in the levels of GPR87 protein, RKO and p53-KD RKO cells were mock treated or treated with 250 ng/mL doxorubicin for 12 hours. Immunostaining was performed with anti-GPR87 to measure the expression of GPR87 because the antibody was not suitable for Western blot analysis. We found that p53 and GPR87 were detected in RKO but not p53-KD RKO cells on treatment with doxorubicin (Fig. 1D). Interestingly, GPR87 was found to be highly expressed in nucleus.

p53 regulates its targets through binding to p53-REs in the promoter or intron. Thus, we searched for p53-REs in the GPR87 genomic locus and found one potential binding site located at nucleotides +748 to +767 in intron 1 with the sequence of AGtCATGTTaAAACATGTCa (lowercase letters represent mismatch; Fig. 2A,, top). Thus, ChIP assay was performed to examine whether p53 binds to the potential p53-RE in the GPR87 gene (Fig. 2A). The binding of p53 to the p53-RE in the p21 gene was used as a control (Fig. 2A). To test this, RKO cells were untreated (−) or treated (+) with doxorubicin to activate p53 followed by cross-linking with formaldehyde and immunoprecipitation with anti-p53 or rabbit IgG as a negative control. We found that when activated, p53 bound to p53-REs in the GPR87 and p21 genes but not to the GAPDH promoter (Fig. 2B,, compare lanes 3 and 4). In contrast, no DNA fragments were detected in control IgG immunoprecipitates (Fig. 2B , control-IP, lanes 1 and 2).

To test whether the potential p53-RE in the GPR87 gene is responsive to p53, a 433-bp DNA fragment (from nucleotides +476 to +909) was cloned upstream of the minimal c-fos promoter in O-Fluc luciferase reporter (26). In addition, a mutant p53-RE was generated and similarly cloned into O-Fluc (Fig. 2C). The luciferase reporter under the control of the p21 promoter (29) was used as a control. We showed that, like p53-RE in the p21 promoter, the potential p53-RE in the GPR87 gene (GPR87-W) was responsive to wild-type but not mutant p53 (Fig. 2D). In contrast, the luciferase activity for GPR87-M was not significantly increased by wild-type p53 (Fig. 2D).

Ectopic expression of GPR87 has no effect on cell proliferation. The GPR87 gene is found to be overexpressed in lung and bladder carcinomas (30), suggesting that GPR87 is likely to promote cell growth. To test this, we generated RKO cell lines that inducibly express GPR87 as measured by RT-PCR (Fig. 3A,, right) and immunostaining (Fig. 3A,, left). RKO-TR-13 is the control parental cell line (Fig. 3A,, left). We also generated one RKO cell line that inducibly expresses HA-tagged GPR87 as measured by Western blotting (Fig. 3B,, left) and immunostaining (Fig. 3B,, right) with anti-HA. Next, colony formation assay was performed and showed that under both normal and stress conditions, GPR87 had little if any effect on the number and size of the colonies in RKO cells (Fig. 3C). Similarly, we found that GPR87 had no effect on cell proliferation in MCF7 cells (data not shown).

Lack of GPR87 sensitizes tumor cells to DNA damage–induced growth suppression. To examine the physiologic role of GPR87, we generated RKO cell lines in which endogenous GPR87 can be inducibly knocked down by siRNA under the control of a tetracycline-regulated promoter. Two representative cell lines (70 and 72) were used for further characterization. On induction of siRNA against GPR87 for 3 days, the levels of GPR87 transcript were markedly reduced (Fig. 4A,, left). In addition, on treatment with doxorubicin, which leads to p53 induction of GPR87 (Fig. 1), GPR87 was still efficiently knocked down by siRNA (Fig. 4A,, right). Next, colony formation assay was performed and showed that GPR87 knockdown alone had little effect on cell growth (Fig. 4B, Ctrl panels). However, GPR87 knockdown remarkably decreased cell survival on treatment with doxorubicin or camptothecin (Fig. 4B , Dox and CPT panels).

Because p53 is a major mediator of the DNA damage response, we examined whether p53 is involved in the GPR87 signaling pathway. On treatment with doxorubicin or camptothecin, p53 was stabilized and activated to induce p21 and Mdm2 (Fig. 4C). Interestingly, GPR87 knockdown markedly enhanced p53 stabilization, induction of p21 and Mdm2, and DNA damage–induced PARP cleavage (Fig. 4C,, compare lanes 3 and 5 with lanes 4 and 6, respectively; also compare lanes 9 and 11 with lanes 10 and 12, respectively). Consistent with this, DNA histogram analysis showed that on GPR87 knockdown, the extent of sub-G₁ cells induced by treatment with doxorubicin was increased from 0.78% to 8.65% (Fig. 4D).

To further test this, siRNA-resistant GPR87 was generated (Fig. 5A) and transfected into RKO cells. We showed that on inducible expression of siRNA against GPR87, endogenous GPR87 was knocked down (Fig. 5B,, compare lanes 1 and 3 with lanes 2 and 4, respectively), whereas exogenous siRNA-resistant GPR87 was still expressed (Fig. 5B,, compare lanes 5 and 7 with lanes 6 and 8, respectively). Interestingly, we showed that such a replacement abrogated the enhancement of p53 activation, induction of p21, and enhanced PARP cleavage by GPR87 knockdown on DNA damage (Fig. 5C , compare lanes 3 and 7 with lanes 4 and 8, respectively).

To rule out potential nonspecific effect by siRNA, we generated RKO and MCF7 cell lines that inducibly express siRNA against bacterial LacZ. The inducible expression of siRNA against LacZ was confirmed by reduced expression of HA-tagged LacZ in cells transfected with pcDNA3-HA-LacZ (Supplementary Fig. S1A, left). We showed that expression of siRNA against LacZ had no effect on GPR87 expression (Supplementary Fig. S1A, right), cell proliferation (Supplementary Fig. S1B), and p53 activation (Supplementary Fig. S1C).

To rule out potential cell type–specific effect, we generated MCF7 cell lines in that GPR87 can be inducibly knocked down. We showed that GPR87 was efficiently knocked down in mock- and doxorubicin-treated MCF7 cells (Supplementary Fig. S2A). Similarly, we found that knockdown of GPR87 alone had no significant effect on colony formation but enhanced growth suppression induced by treatment with doxorubicin or camptothecin (Supplementary Fig. S2B). Furthermore, p53 stabilization, induction of p21 and Mdm2, and PARP cleavage were enhanced by GPR87 knockdown (Supplementary Fig. S2C).

To examine whether GPR87 has similar effect in immortalized but not transformed cells, GPR87 was transiently knocked down by siRNA in MCF10A cells (Supplementary Fig. S3A). We showed that knockdown of GPR87 sensitized MCF10A cells to DNA damage–induced p53 stabilization and subsequent induction of p21 (Supplementary Fig. S3B, compare lanes 1–3 with lanes 4–6, respectively).

p53 is required for GPR87 prosurvival activity. To examine whether p53 is required for GPR87 function, we generated RKO cell lines in which GPR87 can be inducibly knocked down and endogenous wild-type p53 was stably knocked down by siRNA. Two representative cell lines (clones 163 and 177) were identified in that the levels of GPR87 transcript can be inducibly knocked down (Fig. 6A,, compare lanes 1 and 3 with lanes 2 and 4, respectively), whereas the levels of p53 protein were undetectable at both mock- and doxorubicin-treated conditions (Fig. 6B,, lanes 5–8 and 9–12). As a control, the levels of p53 protein were stabilized on DNA damage, which was further enhanced on GPR87 knockdown in RKO-GPR87-KD #70 cells (Fig. 6B,, compare lanes 1 and 3 with lanes 2 and 4, respectively). Next, colony formation assay was performed and showed that stable p53 knockdown had no significant effect on cell survival regardless of GPR87 knockdown (Fig. 6C,, Ctrl panel). However, the enhanced sensitivity to DNA damage by GPR87 knockdown was abrogated when p53 was constitutively knocked down in both clones (163 and 177; Fig. 6C,, Dox and CPT panels). We also showed that little if any induction of p21 and Mdm2 was detected in cells with stable p53 knockdown on DNA damage (Fig. 6D,, lanes 1–6). As a control, DNA damage induction of p21 and Mdm2 was enhanced by GPR87 knockdown in RKO cells (clone 70; Fig. 6D , lanes 7–12). Finally, we examined the activation of Akt, a signaling pathway shared by many GPCRs. We found that GPR87 knockdown decreased Akt activation on DNA damage (Supplementary Fig. S4, compare lanes 1, 3, 5, 7, and 9 with lanes 2, 4, 6, 8, and 10, respectively). Because Akt is known to antagonize p53 activation (31), the decreased activation of Akt may play a role in the enhanced activation of p53 by GPR87 knockdown on DNA damage.

Here, we found that GPR87 is regulated by DNA damage in a p53-dependent manner. We also found that GPR87 is required for maintaining cell viability following DNA damage. Most importantly, the requirement of GPR87 for cell survival is p53 dependent and p53 is hyperactivated by DNA damage when GPR87 is knocked down. Consistent with this, GPR87 was shown to be overexpressed in squamous cell carcinoma in the lung, bladder, and head and neck (30, 32). Interestingly, transient knockdown of overexpressed GPR87 in head and neck cancer cells was found to inhibit tumor cell survival, suggesting that GPR87 is potentially responsible for these tumor cell transformations. Together, these results indicate that GPR87 is a prosurvival factor and serves as a mediator of the p53 prosurvival pathway. However, we would like to mention that overexpression of GPR87 alone has no significant effect on cell proliferation (Fig. 3). This is not surprising because the signals elicited by GPR87 are dependent on activation of GPR87 via its ligand(s). Conversely, we found that in MCF7 and RKO cells with limited basal expression levels of GPR87, knockdown of GPR87 alone has limited effect on cell survival, suggesting that GPR87 signal is not responsible for MCF7 and RKO cell transformation.

On activation by their ligands, GPCRs elicit many growth signals via the coupled G proteins, including activation of the mitogen-activated protein kinase pathway and the phosphatidylinositol 3-kinase (PI3K) pathway (4, 33). In this study, we found that GPR87 is induced by DNA damage in a p53-dependent manner, suggesting that many survival pathways can be activated by DNA damage via GPR87. Importantly but not surprisingly, we found that knockdown of GPR87 sensitizes tumor cells to DNA damage via p53, suggesting that p53 is also a downstream effector of the GPR87 signaling pathway. Thus, how p53 is activated by lack of GPR87? Because p53 is primarily stabilized and activated posttranslationally, two major pathways are likely to be involved in p53 activation (34). First, GPR87 is considered to be a member of lysophosphatidic acid receptors, which would signal to Akt for prosurvival activity (4, 31, 33). PI3K-Akt is a negative regulator of p53 (31). Thus, on knockdown of GPR87, PI3K-Akt would not be activated, and as a result, p53 is stabilized and activated. Indeed, we found that GPR87 knockdown inhibits Akt activation on DNA damage (Supplementary Fig. S4). Alternatively, antisurvival signals that are normally repressed by GPR87 would be activated on GPR87 knockdown, such as checkpoint kinases (ATM and ChK2; ref. 16), leading to p53 stabilization and activation. Together, p53 and GPR87 seem to be involved in a feedback loop reminiscent of p53-Mdm2 relationship except that, unlike Mdm2, GPR87 does not lead p53 to degradation; instead, GPR87 knockdown up-regulates p53 activation. Thus, future studies are needed to further address p53 activation on knockdown of GPR87, especially given that an antagonist to GPR87 might be explored as an agent for cancer therapy.

GPCRs are the largest family of cell surface receptors and transduce a diverse array of signals for cell survival and death. Consequently, GPCRs have always been explored for drug targets. Indeed, ∼50% of all current therapeutic agents directly or indirectly target GPCRs (1). As a survival factor and target of p53, GPR87 might be explored as a novel target for cancer therapeutic agent. Because lack of GPR87 can sensitize DNA damage–induced growth suppression, an antagonist to GPR87 would be a good adjuvant agent for current cancer therapeutic agents, most of which are DNA damage agents.

No potential conflicts of interest were disclosed.

Grant support: NIH grants CA076069 and CA102188.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank members of the Chen laboratory for suggestions.