Genistein (4′,5,7-trihydroxyisoflavone) is the most abundant isoflavone found in the soybean. The effects of genistein on various cancer cell lines have been extensively studied but the precise molecular mechanisms are not known. We report here the epigenetic mechanism of the action of genistein on androgen-sensitive (LNCaP) and androgen-insensitive (DuPro) human prostate cancer cell lines. Genistein induced the expression of tumor suppressor genes p21 (WAF1/CIP1/KIP1) and p16 (INK4a) with a concomitant decrease in cyclins. There was a G0-G1 cell cycle arrest in LNCaP cells and a G2-M arrest in DuPro cells after genistein treatment. Genistein also induced apoptosis in DuPro cells. DNA methylation analysis revealed the absence of p21 promoter methylation in both cell lines. The effect of genistein on chromatin remodeling has not been previously reported. We found that genistein increased acetylated histones 3, 4, and H3/K4 at the p21 and p16 transcription start sites. Furthermore, we found that genistein treatment also increased the expression of histone acetyl transferases that function in transcriptional activation. This is the first report on epigenetic regulation of various genes by genistein through chromatin remodeling in prostate cancer. Altogether, our data provide new insights into the epigenetic mechanism of the action of genistein that may contribute to the chemopreventive activity of this dietary isoflavone and have important implications for epigenetic therapy. [Cancer Res 2008;68(8):2736–44]

Genistein is believed to be a potent anticancer agent and has been shown to prevent carcinogenesis in animal models for tumor development at different organ sites (1). Many mechanisms have been proposed for this activity. Some are believed to be closely related to the estrogenic and antiestrogenic activities of genistein (1). Prepubertal exposure to soy or genistein reduced mammary carcinogenesis in rats treated with carcinogens, possibly by modulating the development of the mammary end buds (2). Various soy products containing genistein have been found to inhibit the growth of transplanted human prostate carcinoma, reduce the incidence of poorly differentiated prostate adenocarcinoma in a transgenic mouse model, and inhibit 2-amino-1-methyl-6-phenylimidazo[4,5]pyridine–induced rat prostate carcinogenesis (3). Carcinogenesis or metastasis in the stomach, colon, bladder, and lung is also inhibited by genistein and related isoflavones (46).

Cell cycle progression is regulated by interactions between cyclins and cyclin-dependent kinase (CDK; ref. 7). Especially, the transition of G1 to S phase is regulated by a family of negative cell cycle regulators, CDKIs. The latter includes two families, the CIP/KIP family and the INK4 family (8). P21WAF1 is a member of the CIP/KIP family and p16INK4a belongs to INK4 family (9), and their increased expression may play a crucial role in the growth arrest induced in transformed cells (10).

p16INK4a is a component of p16INK4a-Cdk4-6/cyclin D-pRb signaling pathway, which is perturbed in many tumors. It specifically binds to and inactivates D-type CDKs, CDK4, and CDK6 (11). The binding of p16INK4a to CDK4/6 also induces redistribution of Cip/Kip family CDK inhibitors, p21WAF1 and p27KIP1, from cyclinD-CDK4/6 to cyclin E-CDK2 complexes, resulting in the inactivation of CDK2-kinase (12). Thus, induction of p16INK4a collaborates with p21WAF1 to prevent phosphorylation of pRb, leading to a stable cell cycle arrest in senescent cells (13). Importantly, the p16INK4a gene is frequently inactivated in a wide range of human cancers and is therefore recognized as a tumor suppressor gene (13). The function of p16INK4a may be lost due to mutations or suppression of transcription by promoter methylation in different types of tumors (14).

The p21 gene was first cloned and characterized as an important effector that inhibited CDK activity in p53-mediated cell cycle arrest induced by DNA damage (15). The stability of p21 mRNA can also be altered by different signals such as cell differentiation (16), oxidative stress (17), as well as other factors including decorin (18), Ras/Raf protein (19), transforming growth factor B (20), and Tax of human T-cell leukemia virus type 1 (21). In addition, two known mechanisms of epigenetic modification, gene inactivation by methylation of the promoter region and changes to inactive chromatin by histone deacetylation, may also be involved in the inactivation of the CIP/KIP family (22). P21WAF1 is frequently epigenetically silenced in human cancer, and histone deacetylase (HDAC) inhibitor–induced increase in p21 WAF1 expression is believed to play a major role in suppressing tumor growth (23). In a variety of human neoplastic cell lines, p21WAF1 was re-expressed after treatment with decitabine and both methylation-dependent and methylation-independent mechanisms have been proposed to explain this effect (24, 25). Although this gene is hypermethylated in some human lung cancer cell lines (24), it is unmethylated in most types of human cancers (26). A recent study has shown that decitabine induced remodeling of p21WAF1 promoter chromatin and gene re-expression independent of p21WAF1 promoter methylation or the presence of wild-type p53 (27). Genistein can also up-regulate mRNA expression of BRCA1 gene during mammary tumorigenesis, which is frequently inactivated by epigenetic events in breast cancer (2). In esophageal squamous cell carcinoma cell lines, genistein was found to cause reversal of hypermethylation and reactivation of p16INK4a, RARβ, and MGMT genes (28).

The precise molecular mechanism of genistein action is still not clear. We hypothesize that genistein may be involved in regulation of gene activity by modulating epigenetic events such as DNA methylation and/or histone acetylation in prostate cancer. To test this hypothesis, we investigated the effects of genistein in modulating (a) the expression of CDK inhibitors p21WAF1/CIP1/KIP1, p16INK4a, and p27KIP1; (b) cell cycle progression and (c) CpG island promoter methylation status; and (d) chromatin remodeling in human prostate cancer cell lines.

Cell lines and cell culture. Human prostate carcinoma cell lines LNCaP and DuPro and the normal epithelial prostate cell line RWPE-1 were obtained from the American Type Culture Collection. The prostate cancer cell lines were cultured as monolayers in RPMI 1640 supplemented with 10% fetal bovine serum (Hyclone), 50 μg/mL penicillin, and 50 μg/mL streptomycin (Invitrogen), and maintained in an incubator with a humidified atmosphere of 95% air and 5% CO2 at 37°C. The RWPE-1 cells were cultured in keratinocyte growth medium supplemented with 5 ng/mL human recombinant epidermal growth factor and 0.05 mg/mL bovine pituitary extract (Life Technologies/Invitrogen) and maintained in an incubator under the conditions described above. Subconfluent cells (60–70% confluent) were treated with varying concentrations of genistein (0, 10, and 25 μmol/L; Sigma) dissolved in DMSO, and the cells treated only with vehicle (DMSO) served as control. Fresh genistein was administered everyday along with change of medium, and the cells were grown for 96 h.

DNA cell cycle analysis. The cells were harvested, washed with cold PBS, and processed for cell cycle analysis. Briefly, 1 × 106 cells were resuspended in 1 mL of cold saline GM (4°C) to which cold ethanol (3 mL) was added, and the cells were then incubated for overnight at 4°C. After centrifugation, the pellet was washed with 2 mL cold PBS + 5 mmol/L EDTA, resuspended in 1 mL PBS containing 30 μg/mL propidium iodide and 0.3 mg/mL RNase A, and incubated at 25°C for 1 h in the dark. The cell cycle distribution of the cells of each sample was then determined using a FACS Caliber instrument (Becton Dickinson FACScan; Biosciences) equipped with CellQuest 3.3 software in the Fluorescence-Activated Cell Sorting (FACS) Core Facility of the Veterans Affairs Medical Center and University of California, San Francisco. CellQuest cell cycle analysis software was used to determine the percentage of cells in the different cell cycle phases.

Quantitative real-time PCR. Total RNA was isolated from 90% confluent plates of cultured cells using the RNeasy mini kit (Qiagen) according to the manufacturer's directions. First strand cDNA was prepared from total RNA (1 μg) and oligo(dT) using the Reverse Transcription System (Promega Corp.).

In the real-time PCR step, cDNA was amplified with Inventoried Gene Assay Products containing two gene-specific primers and one Taq Man MGB probe (6-FAM dye labeled) using the Taq Man Universal Fast PCR Master Mix in 7500 Fast Real Time PCR System (Applied Biosystems). Thermal cycling conditions included 95°C for 20 s, 40 cycles of 95°C for 3 s, and 60°C for 30 s according to the Taq Man Fast Universal PCR Protocol. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control, and vehicle control was used as a calibrator. Each sample was run in four wells. The comparative computed tomography method was used to calculate the relative changes in gene expression in the 7500 Fast Real Time PCR System. The relative changes of gene expression were calculated using the following formula: fold change in gene expression, 2−ΔΔCt = 2-{ΔCt (genistein-treated samples) − ΔCt (untreated control)}, where ΔCt = Ct (detected genes) − Ct (GAPDH) and Ct represents threshold cycle number.

Immunoblotting. Protein was isolated from 90% confluent plates of cultured cells using the M-PER Mammalian Protein Extraction Reagent (Pierce Biotechnology) following the manufacturer's directions. Protein concentrations were determined by the Bradford method (29). Equal amounts of protein were resolved on 10% or 15% SDS polyacrylamide gels and transferred to nitrocellulose membrane by voltage gradient transfer. The resulting blots were blocked with 2% nonfat dry milk and probed with antibodies specific for p21WAF1 (Upstate), p16INK4a (Cell Signaling), p27 (Cell Signaling), Cyc. A2 (Abcam), Cyc. B2 (Santa Cruz Biotechnology), Cyc. E2 (Santa Cruz Biotechnology), and GAPDH (Santa Cruz Biotechnology). Blots were then incubated with appropriate peroxidase-conjugated secondary antibodies and visualized using enhanced chemiluminescence (Pierce Biotechnology).

Genomic DNA extraction, sodium bisulfite modification, and sequencing. Genomic DNA was extracted from cultured cells using a DNeasy tissue kit (Qiagen) following the procedure of the manufacturer. Bisulfite modification of DNA was performed using the CpGenome DNA Modification kit (Chemicon International) following the manufacturer's directions. Modified DNA was amplified using two rounds of PCR with primers covering no CpG sites in either the forward or reverse primer and amplified a DNA fragment of the promoter region containing a number of CpG sites. Sequences of primers and PCR conditions are shown in Table 1. A second round of PCR was performed using 2 μL of the first round PCR product in a total volume of 30 μL. The amplification product was confirmed by electrophoresis on a 2% agarose gel and sequenced directly by an outside vendor (McLab).

Table 1.

Primer sequences and PCR conditions

PurposeSense primer (5′-3′)Antisense primer (5′-3′)Annealing temperature (°C; PCR cycles)Product size (bp)
Bisulfite primers     
P21 AGGAGGGAAGTGTTTTTTTGTAGTA ACAACTACTCACACCTCAACTAAC 54 (40 & 60, 35) 232 
P16 GGGGGAGATTTAATTTGGGG CTACCTAATTCCAATTCCCCTACA 54 (40) 512 
 TTTTTAGAGGATTTGAGGGATAGG TACAAACCCTCTACCCACCTAAAT 60 (35) 327 
ChIP primers     
GAPDH TACTAGCGGTTTTACGGGCGCACGT TCGAACAGGAGGAGCAGAGAGCGAA 60 (30) 166 
P16 AGCACTCGCTCACGGCGTC CTGTCCCTCAAATCCTCTGGAG 62 (30) 68 
P21-R2 GGGGCGGTTGTATATCAGG GTGAACGCAGCACACACC 60 (28) 250 
P21-R3 CGAGGCACTCAGAGGAGGTG GTCATTCACCTGCCGCAGAA 60 (28) 167 
     
QRT-PCR
 
Taq Man gene assay
 
Amplicon length
 
GAPDH Hs99999905_m 122 
p21 Hs99355782_m1 66 
p16 Hs0023365_m1 117 
p27 Hs00153277_m1 71 
Cyc-A2 Hs00153138_m1 110 
Cyc-B2 Hs00270424_m1 73 
Cyc-E1 Hs00233356_m1 101 
Cyc-E2 Hs00180319_m1 92 
Ep-300 Hs00914223_m1 85 
PCAF Hs00187332_m1 90 
CREBBP Hs00231733_m1 69 
HAT1 Hs00186320_m1 119 
PurposeSense primer (5′-3′)Antisense primer (5′-3′)Annealing temperature (°C; PCR cycles)Product size (bp)
Bisulfite primers     
P21 AGGAGGGAAGTGTTTTTTTGTAGTA ACAACTACTCACACCTCAACTAAC 54 (40 & 60, 35) 232 
P16 GGGGGAGATTTAATTTGGGG CTACCTAATTCCAATTCCCCTACA 54 (40) 512 
 TTTTTAGAGGATTTGAGGGATAGG TACAAACCCTCTACCCACCTAAAT 60 (35) 327 
ChIP primers     
GAPDH TACTAGCGGTTTTACGGGCGCACGT TCGAACAGGAGGAGCAGAGAGCGAA 60 (30) 166 
P16 AGCACTCGCTCACGGCGTC CTGTCCCTCAAATCCTCTGGAG 62 (30) 68 
P21-R2 GGGGCGGTTGTATATCAGG GTGAACGCAGCACACACC 60 (28) 250 
P21-R3 CGAGGCACTCAGAGGAGGTG GTCATTCACCTGCCGCAGAA 60 (28) 167 
     
QRT-PCR
 
Taq Man gene assay
 
Amplicon length
 
GAPDH Hs99999905_m 122 
p21 Hs99355782_m1 66 
p16 Hs0023365_m1 117 
p27 Hs00153277_m1 71 
Cyc-A2 Hs00153138_m1 110 
Cyc-B2 Hs00270424_m1 73 
Cyc-E1 Hs00233356_m1 101 
Cyc-E2 Hs00180319_m1 92 
Ep-300 Hs00914223_m1 85 
PCAF Hs00187332_m1 90 
CREBBP Hs00231733_m1 69 
HAT1 Hs00186320_m1 119 

Chromatin immunoprecipitation analysis. Chromatin immunoprecipitation ChIP analysis was performed using the EZ-ChIP kit (Upstate Biotechnology) according to the manufacturer's directions. Antibodies used in the immunoprecipitations were purchased from Upstate Biotechnology and recognized acetyl histone H3, acetyl histone H4, dimethyl-histone H3 lysine 4, and dimethyl-histone H3 lysine 9. The immunoprecipitated DNA was eluted in total volume of 50 μL, and 2 μL were used for PCR. The amplified DNA was electrophoresed in a 2% agarose gel and visualized by staining with ethidium bromide. The sequence of primers and PCR conditions are given in Table 1. Enrichment was calculated as the ratio between the net intensity of each bound sample divided by the input and the vehicle control sample divided by the input (bound/input)/(control/input).

Statistical analysis. Statistical analysis was performed using StatView version 5.0 for Windows as needed. Data were analyzed using StatView, and a statistically significant difference was considered to be at a P value of <0.05. For all the results, where applicable, the expression levels were quantified by optical densitometry using ImageJ Software version 1.36b.1

p21WAF1 and p16INK4a expression profile. To determine relative expression levels of p16INK4a and p21WAF1 in prostate cancer cells, we performed Taq Man quantitative real-time PCR analysis for androgen-dependent (LNCaP) and androgen-independent (DuPro) cell lines and compared them with normal prostate epithelial cells (RWPE-1; Fig. 1A–B). The results showed that relative mRNA expression was significantly lower in PCa cell lines when compared with normal RWPE-1 cell line. In addition, a significant difference in p21WAF1 expression was also noted between the androgen-dependent (LNCaP) and androgen-independent (DuPro) PCa cell lines.

Figure 1.

A and B, expression profile of p21WAF1 and p16INK4a in prostate cancer and normal prostate epithelial cells. C, relative expression profile of p16, p21, and p27 after treatment with 0, 10, and 25 μmol/L genistein. Relative quantification was performed by quantitative real-time PCR. Data are in triplicate from three independent experiments and were normalized to GAPDH and calibrated to levels in untreated samples. Columns, mean; bars, SE. *, statistically significant at P < 0.05. D, protein expression levels of p21WAF1, p16INK4a, and cyclins in LNCaP cells treated with 10 or 25 μmol/L genistein.

Figure 1.

A and B, expression profile of p21WAF1 and p16INK4a in prostate cancer and normal prostate epithelial cells. C, relative expression profile of p16, p21, and p27 after treatment with 0, 10, and 25 μmol/L genistein. Relative quantification was performed by quantitative real-time PCR. Data are in triplicate from three independent experiments and were normalized to GAPDH and calibrated to levels in untreated samples. Columns, mean; bars, SE. *, statistically significant at P < 0.05. D, protein expression levels of p21WAF1, p16INK4a, and cyclins in LNCaP cells treated with 10 or 25 μmol/L genistein.

Close modal

Effect of genistein treatment on the expression of cell cycle regulators. The cell cycle inhibitor p21WAF1 is a well-characterized target of genistein (30). We analyzed the expression of p21WAF1 along with other CDKIs, p16INK4a, and p27CIP1 in two prostate cancer cell lines (LNCaP and DuPro) and RWPE-1, a normal prostate epithelial cell line (Fig. 1C). Genistein significantly up-regulated the relative expression level of p21WAF1 and p16INK4a over vehicle control, whereas there was no significant change in the expression of p27CIP1 in both prostate cancer cell lines. The same effect was also observed in RWPE cells where there was also an increase in p27 mRNA levels with genistein treatment compared with controls.

To verify whether the increased transcription of these genes resulted in increased levels of their respective proteins, we did Western analysis. Western blot analysis showed that the protein levels of p21 and p16 were up-regulated in genistein-treated LNCaP cells in a dose-dependent manner, whereas that of cyclins were down-regulated with increased concentration of genistein (Fig. 1D). These results are in direct agreement with the reverse transcription-PCR data and show that genistein up-regulates transcription and translation of the p21 and p16 genes.

Induction of cell cycle arrest. FACS analysis was done to test the effect of genistein on cell cycle distribution. Cell cycle progression is regulated by interactions between cyclins, CDKs, and CDK inhibitors (31). Especially, the transition of G1 to S phase is regulated by a family of negative cell cycle regulators, CDKIs. As summarized in Fig. 2A and B, genistein treatment resulted in a significantly higher number of LNCaP cells in the G0-G1 phase at 10 μmol/L (87.6%) and 25 μmol/L (91.1%; P < 0.05), compared with vehicle-treated control (64.6%). There was concomitant reduction in the number of cells in the S and G2-M phases, suggesting that genistein induced G0-G1 cell cycle arrest in androgen-sensitive LNCaP cells. In androgen-insensitive DuPro cells, genistein treatment resulted in a dose-dependent increase in G2-M cells with a significant decrease in S phase cells. Genistein (25 μmol/L) also induced apoptosis (17%) in DuPro cells compared with vehicle control (2%). In RWPE cells, genistein treatment caused an insignificant increase in the percentage of cells in G0-G1 phase, but a significant decrease was observed in the S phase of cells treated with 10 or 25 μmol/L (8–10%) genistein over vehicle control (18%).

Figure 2.

A, effect of genistein on cell cycle progression. DNA content and cell cycle progression was analyzed by flow cytometry. The two peaks in the FACS diagrams indicate G0-G1 and G2-M cells with S phase cells between peaks. Sub-G1 fractions represent cells with fragmented DNA or apoptotic cells. The main panel shows a single representative result, whereas the numerical values are the mean + SD of three experiments. B, relative expression profile of cyclins after treatment with 0, 10, and 25 μmol/L genistein. Data are in triplicate from three independent experiments and were normalized to GAPDH and calibrated to levels in untreated samples. Columns, mean; bars, SE. *, statistically significant at a P value of <0.05.

Figure 2.

A, effect of genistein on cell cycle progression. DNA content and cell cycle progression was analyzed by flow cytometry. The two peaks in the FACS diagrams indicate G0-G1 and G2-M cells with S phase cells between peaks. Sub-G1 fractions represent cells with fragmented DNA or apoptotic cells. The main panel shows a single representative result, whereas the numerical values are the mean + SD of three experiments. B, relative expression profile of cyclins after treatment with 0, 10, and 25 μmol/L genistein. Data are in triplicate from three independent experiments and were normalized to GAPDH and calibrated to levels in untreated samples. Columns, mean; bars, SE. *, statistically significant at a P value of <0.05.

Close modal

These results are consistent with the gene expression results that showed up-regulation of p16 and p21 mRNA and protein levels in genistein-treated cells. The CDK inhibitors are known to bind with and inhibit the activity of CDK-cyclin complexes, thereby regulating both G0-G1 and G2-M arrest transitions (32, 33).

To further characterize the cell cycle arrest, we examined the level of expression of several known cyclins namely cyclin A2, B2, estrone (E1), and E2 (Fig. 2B). Real-time PCR results showed a down-regulation of all the cyclins that is consistent with up-regulated expression levels of CDK inhibitors. A nonsignificant down-regulation was also observed for cyclin D1 and D3 (data not shown).

Methylation status of p16INK4a and p21WAF1 promoter. We analyzed the status of promoter methylation for p16 and p21 in prostate cancer and RWPE cell lines by bisulfite-modified PCR followed by direct sequencing of the modified DNA samples. We used MethPrimer software (34) to select primers in the CpG rich region of the p21 and p16 promoters around the transcription start sites. Primers were designed with no CpG sites in either the forward or reverse primer and amplified a DNA fragment of the promoter region containing a number of CpG sites (Fig. 3A). DNA sequencing results revealed the absence of CpG island methylation at the p21 promoter in both cell lines and the p16 promoter in LNCaP cells. In DuPro cells, the p16 promoter was completely methylated in untreated cells (Fig. 3B). Genistein (10 or 25 μmol/L) treatment did not change the methylation status of these cells. These results suggest that genistein induced mRNA expression of the p16 and p21 genes by a methylation-independent mechanism. In RWPE cells, absence of promoter methylation was found at both the p21 and p16 promoters (Fig. 3B).

Figure 3.

DNA sequencing results showing promoter methylation status in LNCaP, DuPro, and RWPE-1 cells. MethPrimer software (34) was used to design primers around transcription start sites. Primers were designed with no CpG sites in either the forward or reverse primer and amplified a DNA fragment of the promoter region containing a number of CpG sites. Genomic DNA was extracted from genistein-treated and nontreated (DMSO treated) cells, and bisulfite modification of DNA was performed. There was no change in the methylation status after genistein treatment so the genistein data are not shown. The modified DNA was directly sequenced. A, graphical sketch of the CpG islands and position of primers. B, methylation status of the DMSO-treated (vehicle control) cells.

Figure 3.

DNA sequencing results showing promoter methylation status in LNCaP, DuPro, and RWPE-1 cells. MethPrimer software (34) was used to design primers around transcription start sites. Primers were designed with no CpG sites in either the forward or reverse primer and amplified a DNA fragment of the promoter region containing a number of CpG sites. Genomic DNA was extracted from genistein-treated and nontreated (DMSO treated) cells, and bisulfite modification of DNA was performed. There was no change in the methylation status after genistein treatment so the genistein data are not shown. The modified DNA was directly sequenced. A, graphical sketch of the CpG islands and position of primers. B, methylation status of the DMSO-treated (vehicle control) cells.

Close modal

Changes in chromatin modifications. To determine whether there were covalent chromatin changes after genistein treatment at the p16INK4a and p21WAF1 locus, we did ChIP analysis with various antibodies as described in Materials and Methods. The expression levels were quantified by optical densitometry using ImageJ Software version 1.36b. Enrichment was calculated as the ratio between the net intensity of each bound sample divided by the input and the vehicle control sample divided by the input (bound/input)/(control/input).

Genistein treatment resulted in enrichment of acetylated histones H3, H4, and H3 dimethylated at lysine 4 close to the p16 and p21 transcription start sites in LNCaP, DuPro, and RWPE cell lines (Fig. 4A–B). These changes are markers of active modifications and indicative of gene activation. Therefore, the increased levels of mRNA expression correlated with the enrichment of histone acetylation at the transcription start site in both cell lines. Furthermore, we did not find any levels of repressive modification—acetylated H3 dimethylated at lysine 9 in either cell line before or after treatments.

Figure 4.

A, effects of genistein on the histone modifications of the p16 and p21 promoter. ChIP assay was performed on LNCaP, DuPro, and RWPE cells after treatment with 10 and 25 μmol/L genistein. R2 and R3, regions around the p21 transcription start site where primers were designed. Black blocks, Exon 1; arrow, transcription start site; shaded bars, CpG island; hatched bars, position of primers. Genistein concentrations, 0, 10, 25 μmol/L. B, histone modification enrichment data calculated from the corresponding DNA fragments amplified by PCR; columns, mean; bars, SD.

Figure 4.

A, effects of genistein on the histone modifications of the p16 and p21 promoter. ChIP assay was performed on LNCaP, DuPro, and RWPE cells after treatment with 10 and 25 μmol/L genistein. R2 and R3, regions around the p21 transcription start site where primers were designed. Black blocks, Exon 1; arrow, transcription start site; shaded bars, CpG island; hatched bars, position of primers. Genistein concentrations, 0, 10, 25 μmol/L. B, histone modification enrichment data calculated from the corresponding DNA fragments amplified by PCR; columns, mean; bars, SD.

Close modal

Genistein up-regulates the expression of histone acetyltransferases. To further validate our ChIP analysis results, we analyzed the expression of histone acetyltransferases [HAT; p300, p300/CBP-associated factor (PCAF), cAMP-responsive element binding protein (CREBBP), and HAT1] that are involved in transcriptional activation. Our results showed a significant increase in the level of gene expression of these HATs in cells treated with genistein compared with vehicle control (Fig. 5). These results suggest that genistein up-regulates HATs that catalyze acetylation of specific histone lysine residues that facilitates transcriptional activation, but further functional studies need to be done to confirm the direct role of HATs in inducing chromatin remodeling.

Figure 5.

Relative expression profile of HAT mRNA after treatment with 0, 10, and 25 μmol/L genistein. Data are in triplicate from three independent experiments and were normalized to GAPDH and calibrated to levels in untreated samples. Columns, mean; bars, SE. *, statistically significant at a P value of <0.05.

Figure 5.

Relative expression profile of HAT mRNA after treatment with 0, 10, and 25 μmol/L genistein. Data are in triplicate from three independent experiments and were normalized to GAPDH and calibrated to levels in untreated samples. Columns, mean; bars, SE. *, statistically significant at a P value of <0.05.

Close modal

Genistein has been shown to induce differentiation and regulate cancer cell growth in both in vitro and in vivo models. Various mechanisms have been proposed for the action of genistein. However, the novelty of our study is that it is the first report showing epigenetic mechanism of the action of genistein through chromatin remodeling of tumor suppressor genes in human prostate cancer cell lines.

Control of cell cycle progression in cancer cells is considered to be a potentially effective strategy for the control of tumor growth as the molecular analysis of human cancers have revealed that cell cycle regulators are frequently mutated in most common malignancies (35). Our in vitro data indicated that treatment of androgen-sensitive (LNCaP) cells with genistein resulted in a significant G1 phase arrest of cell cycle progression, which indicates that genistein may inhibit cell cycle progression. We could not find any significant induction of apoptosis in LNCaP cells after genistein treatment. Our findings of decreased cyclin expression after genistein treatment suggest disruption of the uncontrolled cell cycle progression of these cells (Fig. 2B). Our results also indicate that genistein-induced G1 arrest is mediated through the up-regulation of p21/CIP1 expression, which enhances the formation of heterotrimetic complexes with the G1-S CDKs and cyclins, thereby inhibiting their activity (Fig. 1). The CDK inhibitors p21 and p27 are known to bind with and inhibit the activity of CDK-cyclin complexes and, thus, regulate both G0-G1 and G2-M arrest transitions (32, 33). Genistein has been reported to arrest mouse fibroblast cells, melanoma cells (33), and prostate cancer (LNCaP) cells (36) at the G0-G1 phase of the cell cycle.

Treatment of androgen-insensitive (DuPro) cells with genistein resulted in significant G2-M phase arrest of cell cycle progression and a significant increase in the percentage of apoptotic cells at 25 μmol/L (Fig. 2A). Genistein has been found to induce G2-M cell cycle arrest in breast, gastric, human melanoma (37, 38), PC3 prostate cancer (39), and lung cancer cells (40). Thus, it is generally accepted that genistein can cause G2-M cell cycle arrest. Genistein treatment of androgen-insensitive PC3 cells resulted in G2-M cell cycle arrest and altered expression of two cell cycle regulatory proteins, CDK inhibitor p21WAF1 and cyclin B1 (39). Our results are consistent with these reports as there was a significant reduction in cyclin B1 with a concomitant increase in p21WAF1 expression (Figs. 1B and 2B). The cyclin B1/CDK1 complex is essential for progression of cells through mitosis; therefore, a decrease in cyclin B proteins can result in G2-M arrest (41).

Genistein has been reported to up-regulate mRNA expression of BRCA1 gene during mammary tumorigenesis (2) and p16INK4a, RARβ, and MGMT genes in esophageal squamous cell carcinoma cell lines (28). Our study also showed that genistein dose dependently increased the mRNA and protein expression of tumor suppressor genes p16 and p21 in both prostate cancer cell lines (Fig. 1B–C). We further investigated the mechanism of this induction through epigenetic pathways by examining the CpG island methylation status of the p16 and p21 promoter. As shown in Fig. 3, the DNA methylation analysis revealed absence of p21 promoter methylation in both cell lines without any genistein treatment. However, p16 was completely methylated in DuPro cells even after genistein treatment. The p21WAF1 promoter is unmethylated in most types of human cancer (26). Induction of p21WAF1 expression from an unmethylated p21 WAF1 promoter has been reported in some human lung and colon cancer cell lines (24, 25) and in human acute myeloid leukemia cell lines when treated with deacitabine (25). Furthermore, Shin (22) reported that the promoter of the p21 gene was not methylated in gastric cancer cells and confirmed that methylation was not the mechanism for its inactivation. The promoter of the p16 gene has been found to be unmethylated in LNCaP cells and completely methylated in DuPro cells (42). Our results also showed the absence of p21 (LNCaP and DuPro) and p16 (LNCaP) CpG island methylation, indicating that methylation is not the mechanism involved in the induction of gene expression by genistein in these cell lines. We further investigated chromatin remodeling pathways as mechanisms of genistein action in prostate cancer through ChIP analysis. Our results showed that genistein treatment led to an increase in the acetylation of histones H3, H4, and H3dimethK4 in a dose-dependent manner (Fig. 4) around the transcription start site in LNCaP, DuPro, and RWPE cell lines. We did not detect significant levels of repressive histone modifications at the p16 or p21 promoter in either cell line. Our data suggest that induction of p16 and p21 gene expression is due to enrichment of active chromatin modification rather than a loss of repressive histone modifications.

To further confirm our ChIP data, we examined the expression of HAT, p300, CREBBP, PCAF, and HAT1 with Taq Man quantitative real-time PCR (Fig. 5). The results confirmed that genistein up-regulated the expression of all the HATs and, thus, may catalyze the histone acetylation that facilitated transcriptional activation. In this regard, both histone hyperacetylation and hypoacetylation seem to be important in carcinogenesis, and induction of gene expression by histone hyperacetylation may be a mechanism by which dietary fiber prevents carcinogenesis (43). The steady state of nucleosomal histone acetylation is established by a dynamic equilibrium between competing HAT and HDAC. In general, hyperacetylation of histone lysine residues facilitates transcriptional activation, whereas deacetylation causes transcriptional silencing (44, 45). The recent discovery that a number of transcriptional activators have HAT activity supports the idea that histone acetylation is correlated with transcriptional activation. In addition, increased core histone acetylation is thought to correlate with stimulated transcription through HAT activity of the co activators (46).

Our study shows that genistein can induce tumor suppressor genes by an epigenetic mechanism that involves an increase in the active chromatin modifications in a methylation independent pathway. To our knowledge, this is the first report showing the effect of genistein on chromatin remodeling in prostate cancer cell lines. It may contribute to the chemopreventive activity of this dietary isoflavone.

Grant support: Grants R01CA111470, RO1CA101844 T32-DK07790 from the NIH, Department of Veterans Affairs Reserve Educational Assistance Program award, and Merit Review grants (R. Dahiya).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Roger Erickson for his support and assistance with the preparation of this manuscript.

1
Dixon RA, Ferreira D. Genistein.
Phytochemistry
2002
;
60
:
205
–11.
2
Cabanes A, Wang M, Olivo S, et al. Prepubertal estradiol and genistein exposures up-regulate BRCA1 mRNA and reduce mammary tumorigenesis.
Carcinogenesis
2004
;
25
:
741
–8.
3
Hikosaka A, Asamoto M, Hokaiwado N, et al. Inhibitory effects of soy isoflavones on rat prostate carcinogenesis induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP).
Carcinogenesis
2004
;
25
:
381
–7.
4
Wietrzyk J, Boratynski J, Grynkiewicz G, Ryczynski A, Radzikowski C, Opolski A. Antiangiogenic and antitumour effects in vivo of genistein applied alone or combined with cyclophosphamide.
Anticancer Res
2001
;
21
:
3893
–6.
5
Tatsuta M, Iishi H, Baba M, Yano H, Uehara H, Nakaizumi A. Attenuation by genistein of sodium-chloride-enhanced gastric carcinogenesis induced by N-methyl-N′-nitro-N-nitrosoguanidine in Wistar rats.
Int J Cancer
1999
;
80
:
396
–9.
6
Zhou JR, Mukherjee P, Gugger ET, Tanaka T, Blackburn GL, Clinton SK. Inhibition of murine bladder tumorigenesis by soy isoflavones via alterations in the cell cycle, apoptosis, and angiogenesis.
Cancer Res
1998
;
58
:
5231
–8.
7
Marx J. How cells cycle toward cancer.
Science
1994
;
263
:
319
–21.
8
Hall M, Bates S, Peters G. Evidence for different mode of action of cyclin-dependent kinase inhibitors: p15 and p16 bind to kinase, p21 and p27 bind to cyclins.
Oncogene
1995
;
11
:
1581
–8.
9
Polyak K, Lee MH, Erdjument-Bromage H, et al. Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and potential mediator of extracellular antimitogenic signals.
Cell
1994
;
78
:
59
–66.
10
Kim JS, Lee S, Lee T, Lee YW, Trepel JB. Transcriptional activation of p21WAF1/CIP1 by apicidin, a novel histone deacetylase inhibitor.
Biochem Biophy Res Comm
2001
;
281
:
866
–71.
11
Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4.
Nature
1993
;
366
:
704
–7.
12
McConnell BB, Gregory FJ, Stott FJ, Hara E, Peters G. Induced expression of p16(INK4a) inhibits both CDK4-and CDK2-associated kinase activity by reassortment of cyclin-CDK-inhibitor complexes.
Mol Cell Biol
1999
;
19
:
1981
–9.
13
Gil J, Peters G. Regulation of the INK4b-ARF-INK4a tumor suppressor locus: all for one or one for all.
Nat Rev Mol Cell Biol
2006
;
7
:
667
–77.
14
Merlo J, Herman J, Mao L, et al. 5′ CpG island methylation is associated with transcriptional silencing of the tumor suppressor p16/CDKN2/MTS in human cancer.
Nat Med
1995
;
1
:
686
–92.
15
el-Deiry WS, Tokino T, Velculescu VE, et al. WAF1, a potential medicator of p53 tumor suppression.
Cell
1993
;
75
:
817
–25.
16
Schwaller J, Koeffler HP, Niklaus G, et al. Posttranscriptional stabilization underlies p53-independent induction of p21WAF1/CIP1 in differentiating human leukemic cells.
J Clin Invest
1995
;
95
:
973
–9.
17
Esposito F, Cuccovillo F, Vanoni M, et al. Redox-mediated regulation of p21(waf1/cip1) expression involves a post-transcriptional mechanism and activation of the mitogen-activated protein kinase pathway.
Eur J Biochem
1997
;
245
:
730
–7.
18
Stander M, Naumann U, Wick W, Weller M. Transforming growth factor and p21: multiple molecular targets of decorin-mediated suppression of neoplastic growth.
Cell Tissue Res
1999
;
296
:
221
–7.
19
Wang LG, Liu XM, Kreis W, Budman DR. The effect of antimicrotubule agents on signal transduction pathways of apoptosis: a review.
Cancer Chemother Pharmacol
1999
;
44
:
355
–61.
20
Datto MB, Yu Y, Wang XF. Functional analysis of the transforming growth factor β responsive elements in the WAF1/Cip1/p21 promoter.
J Biol Chem
1995
;
270
:
28623
–8.
21
de la Fuente C, Santiago F, Chong SY, et al. Overexpression of p21WAF1 in human T-cell lymphotropic virus type 1-infected cells and its association with cyclin A/cdk2.
J Virol
2000
;
74
:
7270
–83.
22
Shin JY, Kim HS, Park J, Park JB, Lee JY. Mechanism for inactivation of the KIP family cyclin-dependent kinase inhibitor genes in gastric cancer cells.
Cancer Res
2000
;
60
:
262
–5.
23
Gui CY, Ngo L, Xu WS, RIchon VM, Marks PA. Histone deacetylase (HDAC) inhibitor activation of p21WAF1 involves changes in promoter-associated proteins, including HDAC1.
Proc Natl Acad Sci U S A
2004
;
101
:
1241
–6.
24
Zhu WG, Srinivasan K, Dai Z, et al. Methylation of adjacent CpG sites affects Sp1/Sp3 binding and activity in the p21 (Cip) promoter.
Mol Cell Biol
2003
;
23
:
4056
–65.
25
Schmelz K, Wagner M, Dorken B, Tamm I. 5-aza-2′-deoxycitidine induces p21(WAF) expression by demethylation of p73 leading to p53-independent apoptosis in myeloid leukemia.
Int J Cancer
2005
;
114
:
683
–95.
26
Ying J, Srivastava G, Gao Z, et al. Promoter hypermethylation of the cyclin-dependent kinase inhibitor (CDKI) gene p21WAF1/CIP1/SDI1 is rare in various lymphomas and carcinomas.
Blood
2004
;
103
:
743
–6.
27
Scott SA, Dong WF, Ichinohasama R, et al. 5-aza-2′-deoxycitidine (decitabine) can relieve p1WAF1 repression in human acute myeloid leukemia by a mechanism involving release of histone deacetylase 1 (HDAC1) without requiring p21WAF1 promoter demethylation.
Leukemia Res
2006
;
30
:
69
–76.
28
Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang S. Reversal of hypermethylation and reactivation of p16INK4a, RARβ, and MGMT genes by genistein and other isoflavones form soy.
Clin Cancer Res
2005
;
11
:
7033
–41.
29
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
1976
;
72
:
248
–54.
30
Rao A, Coan A, Welsh JE, Barclay WW, Koumenis C, Cramer SD. Vitamin D receptor and p21/WAF1 are targets of genistein and 1,25-dihydroxyvitamin D3 in human prostate cancer cells.
Cancer Res
2004
;
64
:
2143
–7.
31
Grama X, Reddy P. Cell cycle control in mammalian cells: role of cyclins, cyclin-dependent kinases (CDK), growth suppressor genes and cyclin-dependent kinase inhibitors (CDKI).
Oncogene
1995
;
11
:
211
–9.
32
Deng C, Zhang P, Harper JW, Elledge SJ, Leder P. Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control.
Cell
1995
;
82
:
675
–84.
33
Kuzumaki T, Kobayashi T, Ishikawa K. Genistein induces p21 (Cip1/WAF1) expression and blocks the G1 to S phase transition in mouse fibroblast and melanoma cells.
Biochem Biophys Res Commun
1998
;
251
:
291
–5.
34
Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs.
Bioinformatics
2002
;
18
:
1427
–31.
35
Molinari M. Cell cycle checkpoints and their inactivation in human cancer.
Cell Prolif
2000
;
33
:
261
–74.
36
Shen JC, Klein RD, Wei Q, et al. Low dose gensitein induces cyclin dependent kinase inhibitors and G1 cell cycle arrest in human prostate cancer cells.
Mol Carcinog
2000
;
29
:
92
–102.
37
Casagrande F, Darbon JM. P21CIP1 is dispensable for the G2 arrest caused by genistein in human melanoma cells.
Exp Cell Res
2000
;
258
:
101
–8.
38
Davis JN, Singh B, Bhuiyan M, Sarkar FH. Induction of apoptosis in breast cancer cells MDA-MB-231 by genistein.
Oncogene
1999
;
18
:
166
–72.
39
Davis JN, Singh B, Huiyan M, Sarkar FH. Genistein induced upregulation of p21WAF1, downregulation of cyclin B, and induction of apoptosis in prostate cancer cells.
Nutr Cancer
1998
;
32
:
123
–31.
40
Lian F, Bhuiyan M, Li YW, Wall N, Kraut M, Sarkar FH. Genistein induced G2-M arrest, p21WAF1 upregulation, and apoptosis in a non-small-cell lung cancer cell line.
Nutr Cancer
1998
;
31
:
184
–91.
41
Senderowicz AM, Sausville EA. Preclinical and clinical development of cyclin dependent kinase modulators.
J Natl Cancer Inst
2000
;
92
:
376
–87.
42
Herman JG, Merlo A, Mao L, et al. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers.
Cancer Res
1995
;
55
:
4525
–30.
43
Archer S, Hodin RA. Histone acetylation and cancer.
Curr Opin Genet Dev
1999
;
9
:
171
–7.
44
Grozinger CM, Schreiber SL. Deacetylase enzymes: biological functions and the use of small molecule inhibitors.
Chem Biol
2002
;
9
:
3
–16.
45
Kristeleit R, Stimson L, Workman P, Aherne W. Histone modification enzymes: novel targets for cancer drugs.
Expert Opin Emerg Drugs
2004
;
9
:
135
–54.
46
Mizzen CA, Allis CD. Linking histone acetylation to transcriptional regulation.
Cell Mol Life Sci
1998
;
54
:
6
–20.