Adjuvant Therapy with Small Hairpin RNA Interference Prevents Non–Small Cell Lung Cancer Metastasis Development in Mice Free

Development of distant metastasis is the major reason for cancer-related deaths worldwide. Adjuvant therapy approaches after local therapies are most effective when specific targets are inhibited. Recently, we identified S100P overexpression as a strong predictor for metastasis development in early-stage non–small cell lung cancer (NSCLC) patients. Here, we show that S100P overexpression increased angiogenesis in and metastasis formation from s.c. xenotransplants of NSCLC cells. Plasmid-derived short hairpin RNAs (shRNA) were developed as specific adjuvant therapy. I.v. injected shRNA against S100P significantly decreased S100P protein expression in xenograft tumors and inhibited tumor angiogenesis in vivo. Metastasis formation 8 weeks after primary tumor resection was significantly reduced. Lung metastases developed in 31% of mice treated with S100P-targeting shRNAs compared with 64% in control shRNA–treated mice (P < 0.05). These findings suggest that RNA interference–based therapy approaches can be highly effective in the adjuvant setting. [Cancer Res 2008;68(6):1896–904]

Distant metastases are a major reason for cancer-related death in patients with solid tumors (1). Adjuvant therapy applied after local tumor therapy can prolong survival in a substantial fraction of patients with solid tumors. However, specific therapeutic approaches are currently available only for a minority of patients. Non–small cell lung cancer (NSCLC) ranks among the most common cancers and is associated with a complex pathogenesis (2). In patients with stage I and II NSCLC, ∼50% of patients are cured by surgery alone (3). The frequent use of computed tomography (CT) scanning and a renewed interest in screening by low-dose CT scanning have led to an increase in the number of patients that present with early-stage NSCLC that is potentially curable (4). Despite the absence of lymph node involvement and small tumor size, a considerable fraction of patients eventually develop metastasis. Adjuvant chemotherapy can be administered to improve outcome in this patient population. Recently, several large clinical trials showed a small but significant improvement in survival of NSCLC patients with stage Ib and II tumors treated with adjuvant chemotherapy (5, 6). However, it is clear that adjuvant chemotherapy benefits only a minor group of patients. It lacks benefit for the patients that eventually metastasize anyway and it might have adverse effects in patients that would not have developed metastasis even without adjuvant chemotherapy. Improvement of adjuvant chemotherapy can derive from a better identification of patients at risk and from more specific approaches that specifically target the metastatic process. An excellent example is the high effectivity of adjuvant trastuzumab therapy in Her2/Neu-positive breast cancer (7). To develop improved adjuvant therapy options for NSCLC, relevant targets need to be identified and gene-specific therapies need to be developed.

As a step toward this goal, we recently identified genes whose expression in primary NSCLC was associated with a high risk of metastasis development (8, 9). High levels of S100P expression were closely correlated with metastasis development and NSCLC-related death. The association between S100P expression and a more aggressive tumor phenotype was also reported for several other tumor entities (10–13). In the current study, we show that S100P induces a metastatic phenotype in NSCLC cells in vivo. Metastasis induction is associated with increased angiogenesis found in S100P-expressing tumors. In a mouse model for adjuvant NSCLC treatment, small hairpin RNA interference (RNAi) against S100P inhibited angiogenesis, reduced tumor growth, and inhibited metastasis formation by >50%. These findings show that S100P is an important metastasis mediator in NSCLC and that short hairpin RNAi can be used as adjuvant therapy to specifically target metastasis development.

Cell culture. HTB56 and HTB58 lung adenocarcinoma cells were cultured at 37°C, high humidity, and 5% CO₂ in MEM (Invitrogen). The medium was supplemented with 10% FCS, 1% streptomycin and penicillin, 1% glutamine, 1% sodium pyruvate, and 1% nonessential amino acid. HMEC-1 cells were cultured at 37°C, high humidity, and 3% CO₂ using MCDB 131 medium (Invitrogen) with 1% streptomycin and penicillin, 5% glutamine, 10% FCS Gold, and 50 μg/mL gentamicin. BXPC-3 cells were cultured at 37°C, high humidity, and 5% CO₂ in RPMI 1640 (Biochrom AG) containing 10% FCS, 1% glutamine, and 1% streptomycin and penicillin.

Cloning and transfection. Coding sequences of S100P (NM_005980), SEC61β (NM_006808), and EIF4A1 (NM_001416) were cloned into the expression vector pcDNA3.1(+), fused with the enhanced green fluorescent protein (EGFP). The cloned constructs were stably transfected into HTB56 (Calu6) with Lipofectamine reagent (Invitrogen) and selected with neomycin (G418; Sigma). To avoid clone-specific effects, bulk cultures were used for all experiments. Expression levels were determined by quantitative real-time reverse transcription-PCR (RT-PCR) and Western blotting.

Silencing of gene expression was achieved using short hairpin RNA (shRNA) technology. Oligonucleotides targeting S100P_1 (sense, TGCCGTGGATAAATTGCTCAA; antisense, TTGAGCAATTTATCCACGGCA; loop, TTGATATCCG), S100P_2 (sense, AATGGAGATGCCCAGGTGGAC; antisense, GTCCACCTGGGCATCTCCATT; loop, AAGCTT), and the scrambled control (sense, AGATCCGTATAGTGTACCTTA; antisense, TAAGGTACACTATACGGATCT; loop, TTGATATCCG) were synthesized by Invitrogen, annealed, and cloned into the shRNA expression vector pRNAT-H1.1/Neo (GenScript). HTB58 cells were transfected and selected as described above. Expression levels were verified by quantitative real-time RT-PCR. For Western blot analysis, BXPC-3 cells that express S100P at a high level were transfected as described (14).

Immunofluorescence staining. Stably transfected human HTB56 lung carcinoma cells were grown overnight on coverslips in MEM. Cells were fixed in 4% paraformaldehyde, permeabilized in 0.2% Triton X-100, stained for 15 min with tetramethylrhodamine isothiocyanate (TRITC)-phalloidin, and embedded in Mowiol 4-88 (Calbiochem). The stained slides were analyzed using the laser scanning confocal microscope Zeiss LSM-510.

Gene expression analysis. Analysis of gene expression was performed using quantitative RT-PCR as described (15). The following primer and probes (FAM and TAMRA labeled) were used for S100P: forward, 5′-GCTGATGGAGAAGGAGCTACCA; reverse, 5′-CCAGGTCCTTGAGCAATTTATCC; and probe, 5′-FAM-TCCTGCAGAGTGGAAAAGACAAGGATGC-TAMRA. The mRNA expression levels were calculated with regard to the internal standard of glyceraldehyde-3-phosphate dehydrogenase as described (16). Primer and, where applicable, probe sequences for the other S100 proteins will be provided on request.

Western blot analysis. Proteins were detected using the following antibodies: S100P,⁶

GFP (Santa Cruz Biotechnology), signal transducer and activator of transcription 5 (Stat5; Santa Cruz Biotechnology), and actin (Sigma-Aldrich) as first antibodies and goat anti-mouse and goat anti-rabbit (both from Dianova) as secondary antibodies. Western blot analysis was carried out as described (15).

Migration assay. A total of 5 × 10⁵ cells (in 100 μL MEM with 5% FCS) were seeded into the upper part of a Transwell chamber (Transwell filter inserts in 6.5-mm diameter with a pore size of 5 μm; Corning, Inc.), which was 30 min precoated with 50 μg fibronectin. In the lower part of the chamber, 600 μL MEM with 20% FCS was added and the assay was performed for 16 h at 37°C and 5% CO₂ before migrated cells were analyzed by flow cytometry. For the migration assay using transendothelial cells, Transwell filters were precoated with 2.2 × 10⁵ HMEC-1 cells for 48 h at 37°C and 3% CO₂, forming a confluent transendothelial cell layer (17). NSCLC cells (5 × 10⁵) were stained for 5 min with 5 μmol/L SNARF (1 carboxylic acid, acetate, succinimidyl ester; Molecular Probes) to avoid counting fragments of endothelial cells and added to the upper part of the Transwell chamber coated with transendothelial cells. After 16 h of migration, cells were harvested by trypsinization and analyzed (only SNARF-positive cells) by flow cytometry. All assays were performed in triplicate and independently performed thrice.

Metastasis experiments in vivo. For all mouse experiments, we used 8- to 10-wk-old NOD.CB17-Prkdc<scid>/J [nonobese diabetic/severe combined immunodeficient (NOD/SCID)] mice obtained either by breeding in our in-house facility or from Charles River.

To analyze metastasis development following primary tumor removal, 2.5 × 10⁶ stably transfected NSCLC cells (supplemented in 200 μL PBS) were injected s.c. into the right flank. After 4 wk of tumor growth, primary tumors were surgically removed and the tumor weight (g) was determined. Mice were followed for an additional 8 wk (12 wk after initial tumor injection). At this time, mice were sacrificed and tumor weight and metastasis development were determined. Metastasis development was evaluated by counting individual metastatic nodules. For histologic analyses, the lungs were frozen or fixed in 4% paraformaldehyde and embedded in paraffin. For adjuvant therapy experiments, mice were treated by i.v. injection of 20 μg shRNA (dissolved in 200 μL of 0.9% NaCl solution) twice in the week before surgery, during surgery (after primary tumor removal), and twice in the week after surgery. To analyze shRNA effects on metastasis development on i.v. tumor cell injection, NOD/SCID mice were irradiated with a single dose of 3.5 Gy from a cobalt-60 unit 1 d before transplantation. A total of 2 × 10⁶ stable transfected cells (EGFP, control cells, dissolved in 200 μL PBS) were injected i.v. into the tail vein. One week after transplantation, 20 μg shRNA (dissolved in 250 μL PBS) was i.v. injected. Treatment with shRNA was repeated four times every fourth day. After the treatment, mice were followed for an additional 5 wk before metastasis development was analyzed. In a few cases, mice died during i.v. injection or surgery. Therefore, the number of the mice differs by one or two. None of the mice died in the weeks after shRNA injection. In all experiments, treatment groups were randomized to prevent cage effects.

Angiogenesis analysis. Angiogenesis was analyzed by immunofluorescence staining of frozen sections of the primary tumors. In brief, cryosections were fixed in acetone for 10 min at −20°C. After washing once in 80% methanol for 5 min at 4°C, sections were washed thrice with PBS at room temperature and blocked with 12% bovine serum albumin (in PBS) for 30 min. The primary antibody CD31 (BD Biosciences PharMingen) was added and incubated at room temperature for 3 h. After three additional washes with PBS, the sections were incubated in the dark for 30 min with the secondary antibody containing Alexa red (Molecular Probes/Invitrogen) and Hoechst dye 33342. Finally, sections were washed with PBS (3 × 5 min) and 10 min with 10 mmol/L Tris-HCl before embedding in Mowiol 4-88. Images were taken with the Zeiss microscope Axioskop 2 Plus (magnification, ×200) by an investigator (R.L.) not aware of the tumor/treatment group. Pictures were analyzed using the Image-Pro Plus software (Media Cybernetics). Four fields of each of five tumor samples in each group were analyzed.

Statistical analysis. All data are shown as mean plus SD if not indicated otherwise. The mean values of two groups were compared by t test. In the few cases where the variances differed significantly, the nonparametric Mann-Whitney U test was used and stated together with the P value. When more than two groups were compared, one-way ANOVA was used. A P value of <0.05 was considered significant.

Recently, we identified genes whose expression in primary tumors is closely associated with the development of distant metastasis after tumor resection in human early-stage NSCLCs (8, 9). Because these genes might be suitable targets for novel adjuvant therapy approaches in NSCLC, we analyzed the biological effects of these genes. For this purpose, the coding sequences were cloned in frame with EGFP to ease detection and to be able to compare expression levels. EIF4A1, SEC61β, as well as S100P were then expressed in HTB56 lung adenocarcinoma cells that are only weakly metastatic. Bulk cultures were used in all experiments to avoid clone-specific effects. Expression was confirmed by Western blot analysis, fluorescence microscopy, and flow cytometry (Fig. 1A and B; data not shown). None of the cell lines showed altered growth properties or proliferative advantages in vitro (data not shown). However, compared with the nontransfected cells or cells expressing EGFP alone, all of the studied genes significantly enhanced Transwell migration toward a high serum gradient (P = 0.026, ANOVA; Fig. 1C). Further assays were performed to analyze migration through an endothelial cell layer modeling transendothelial migration in vivo during metastasis. Two of three of the studied genes (S100P and EIF4A1) also led to enhanced transendothelial migration (Fig. 1D).

S100P and EIF4A1 were chosen to analyze their influence on metastasis formation in vivo.

Both genes were identified in primary tumors that metastasized following surgery in early-stage NSCLC. Therefore, we established a metastasis model that involved surgical removal after tumor formation resembling early-stage NSCLC treatment (Fig. 2A).

The NOD/SCID mice that were analyzed for the presence of distant metastasis in lungs (Fig. 2B) 8 weeks after surgery showed high frequency of metastasis in S100P-expressing tumors (8 of 12, 67%). In contrast, lungs from mice with control gene (EGFP)-transfected HTB56 cells harbored metastasis only in 2 of 12 individuals (17%; P < 0.009). The metastasis rate was not enhanced in EIF4A1 cells (1 of 9, 11%). These findings established that only S100P enhances the metastatic phenotype of HTB56 NSCLC cells in vivo. Subsequent studies therefore focused on S100P.

Tumors, which were surgically removed 4 weeks after inoculation, still expressed the transgene as indicated by Western blot analyses and EGFP fluorescence of frozen sections (Fig. 2C). Importantly, S100P-expressing tumors showed significantly enhanced neoangiogenesis indicated by an increased number of vessels as well as an increase in the vessel area per visual field (Fig. 2D).

Because expression of S100P in early-stage NSCLC is associated with a poor prognosis and our functional analyses suggested a direct involvement in a metastatic phenotype, we evaluated the potential of shRNA-based adjuvant therapy. I.v. applied hairpin-based RNAi approaches have previously been shown to inhibit primary tumor growth in vivo (18). Therefore, we evaluated shRNA-based therapy against S100P. Published shRNAs against S100P (13) or the scrambled version (control) were tested in vitro and found to suppress mRNA levels in HTB58 cells and protein levels in BXPC-3 cells (Fig. 3A). On the protein level, endogenous S100P was not detectable in NSCLC cell lines. Therefore, we used BXPC-3 cells transfected with shRNA against S100P. The shRNAs were confirmed to be active in vitro and to inhibit migration of HTB58 cells through a transendothelial cell layer (P = 0.029; Fig. 3B). To analyze the specificity of the shRNAs targeting S100P, we analyzed expression of several S100 family members in the HTB58 and BXPC-3 cell lines transfected with either scrambled, shRNA-S100P1, or shRNA-S100P2 construct. No consistent repression in the mRNA levels was found for S100A2, S100A4, or S100A10 (Fig. 3C). On the other hand, lower levels of S100A8, S100A9, and S100A12 were present in cell lines transfected with either shRNA directed against S100P. The effects on S100A8, S100A9, and S100A12 proteins are likely to occur after the initial down-regulation of S100P because the shRNAs did not match to any sequence of either S100 gene. In addition, if off-target effects were relevant, it would be highly unlikely that both shRNAs against S100P would affect the same targets but would leave the other also related S100 proteins unaffected. These findings suggest that the S100P-shRNAs specifically target S100P.

(Neo-)adjuvant shRNA therapy using a mixture of both active shRNAs or scrambled control was administered i.v. using the metastasis model described above (Fig. 4A). First, we analyzed the effect of neoadjuvant shRNA therapy on the primary tumor (Fig. 4). HTB56 cells expressing S100P were s.c. injected into the right flanks of NOD/SCID mice. After 3 weeks of tumor growth, the mice were divided in two groups with similar tumor volumes (Fig. 4B). Mice were injected i.v. with 20 μg of shRNA plasmid against S100P (mixture of both shRNAs) or scrambled control sequence twice on the 4 days preceding the surgical removal of the tumor. After two shRNA treatments, a trend toward smaller tumor sizes at the time of surgery was noted (statistically not significant; Fig. 4C). Xenograft tumors from mice treated with S100P-shRNA showed reduced S100P protein levels compared with control shRNA–treated mice (Fig. 4C). In addition, angiogenesis was significantly inhibited (Fig. 4D). Blood vessel numbers (P = 0.038) and the blood vessel area (P = 0.042) significantly decreased after two shRNA-S100P injections. Angiogenesis was not altered by control shRNA compared with nontreated mice (compare Figs. 2D and 4D). No increase in IFN levels was found in plasma samples (data not shown).

In addition to analysis of the primary tumor, we also evaluated shRNA therapy in an adjuvant setting for its effect on metastasis (Fig. 5). At the time of surgery, a third i.v. injection was performed and two more adjuvant treatments were performed in the week following the surgery. Mice were followed up for a total of 8 weeks after surgery and metastasis development was evaluated by histologic examination in the mice (Fig. 4A). Although all organs were inspected, metastasis formation was restricted to the lungs with very few exceptions. Therefore, further analysis focussed on lung metastasis.

Metastasis developed in 11 of 17 (65%) of the mice treated with scrambled shRNA (Fig. 5A), consistent with the initial results of metastasis development in S100P-expressing tumor cells. In contrast, only 6 of 19 (32%) mice treated with S100P-shRNA developed metastasis (P < 0.05). Adjuvant therapy with shRNA against S100P reduced metastasis development by >50%. In addition, the average number of metastasis in individual mice was significantly decreased by S100P-shRNA (P < 0.05; Fig. 5B). Although these results were intriguing, two caveats remained: first, the metastasizing cells expressed ectopic S100P at relatively high levels, and second, shRNA against S100P also reduced albeit nonsignificantly the tumor size already at the time of surgery. The low metastatic capacity of cell lines without ectopic S100P expression precluded metastasis prevention assays of these cells in the s.c. model. Therefore, we also analyzed a more aggressive metastasis model of i.v. injection. For this, we used HTB56 cells only transfected with EGFP, which expressed low levels of endogenous S100P only. Lung metastasis development was analyzed 6 weeks after i.v. injection. In this system, 100% of the scrambled shRNA (control)-treated mice consistently developed metastasis (10 of 10). In contrast, 33% (3 of 9) of S100P-shRNA–treated mice did not develop metastasis (Fig. 5C).

Adjuvant therapy can prevent metastasis formation. However, adjuvant therapy often fails to prevent metastasis development. The incomplete understanding of the metastatic process is the reason for the lack of specificity of the used therapeutic agents and the nonsatisfactory results in many cases. It is obvious that antiproliferative agents (e.g., classic cytotoxics) do not specifically target metastasis development. Hence, specific targeting of metastasis-inducing genes is a promising approach to improve cure rates in solid tumors.

For NSCLC, we and others have used microarray expression analysis as well as other genome-wide techniques to identify metastasis-related genes (8, 19–21). Many of the genes discovered in this process are likely to reflect the metastatic phenotype rather than actively contributing to it. Nonetheless, the discovery of genes associated with metastasis bears potential to discover novel prognostic markers and to identify novel therapeutic targets. The frequency of S100 proteins found as metastasis-associated genes is intriguing (8, 10, 13, 22, 23). Recently, we showed that S100P expression was closely associated with a significantly increased risk for NSCLC patients to develop distant metastasis (8). Here, we show that S100P confers a metastatic phenotype to NSCLC cell lines. The functions of the Ca²⁺-binding S100 proteins are still incompletely understood. S100P might act intracellularly by binding to ezrin and provoking cytoskeleton alterations (24). It has also been shown that S100P is a secreted protein that might function by binding to the receptor of advanced glycation end products (RAGE; ref. 25). Evidence for the latter point is also provided by recent findings that cromolyn blocks the S100P interaction with RAGE and inhibits pancreatic cancer growth and invasion (26).

We developed a xenograft mouse metastasis model to analyze the metastatic process in NSCLC and the potential to use the identified genes as therapeutic targets. Similar to patients with NSCLC, xenograft tumors were surgically removed and mice were followed for 8 additional weeks. In NSCLC cells without S100 protein expression, the metastasis rate was ∼30%, which is comparable with the metastasis rate in stage I NSCLC patients. S100P expression doubled the metastasis rate and also enhanced angiogenesis in the xenograft tumors pointing toward the biological mechanisms of S100P action. The findings of increased angiogenesis are in line with extracellular S100P activities. Angiogenesis and the related lymphangiogenesis indicate a metastatic phenotype (27). In addition, recent reports suggest that other S100 proteins might stimulate metastasis development by enabling the formation of a premetastatic niche (28). Taken together, gene expression profiling studies and the functional analyses presented here and elsewhere provide convincing evidence that S100 proteins and especially S100P play a crucial role in metastasis development and could provide valuable drug targets.

Neoadjuvant and adjuvant cancer therapy is a promising area of investigation to increase survival in early-stage NSCLC. However, current therapy approaches show low efficacy and considerable side effects (29). Gene therapeutic approaches have been developed in NSCLC but these have not entered clinical practice (30). Thus far, few therapies have been developed that specifically target metastasis development in an adjuvant setting. Because S100P is closely involved in metastasis development, we performed proof-of-principle studies to determine whether hairpin RNAi is suitable for adjuvant therapy and whether blockade of S100P expression would prevent metastasis formation. Our findings provide evidence that i.v. application of shRNAs can prevent metastasis formation in a xenograft NSCLC model that resembles early-stage NSCLC with regard to tumor resection and (neo-)adjuvant therapy. In a 12-week study period, shRNA was administered i.v. twice before and after surgery as well as once during surgical resection. This adjuvant therapy approach is very similar to approaches feasible in actual patients. Importantly, shRNA specifically directed against S100P reduced the metastasis rate by ∼50% compared with the same vector expressing a nonspecific control shRNA. Several approaches have shown in vivo activity of small interfering RNA delivered either as duplexes or as shRNA driven from plasmids. Naked plasmids have been used successfully, indicating that this is a feasible approach at least for some targets (18). The S100P-shRNA effects were tumor specific because no S100P homologue exists in mice. We also found a slightly decreased tumor weight after two neoadjuvant injections of shRNA directed against S100P at the time of surgery.

To exclude that the shRNA effectivity depended on this nonsignificant decrease of the resected tumor size, we administered the shRNA i.v. after i.v. injection of NSCLC lines with endogenous S100P expression. In these experiments, we observed that 33% of the mice could be prevented from metastasis development by shRNA-S100P, whereas 100% of the control shRNA–treated mice eventually developed metastasis. This observation hints toward effects of S100P-shRNA independent of the primary tumor size and against late steps in the metastatic process after invasion of the blood vessels by metastatic tumor cells.

Although these data indicate that shRNAs against S100P can be used as adjuvant therapies to specifically target metastasis, several problems remain. Several S100 proteins, such as S100P, S100A2, and S100A4, are likely to contribute to the metastatic phenotype. S100 proteins typically show 30% to 50% identity, but we did not find a unifying motif in metastasis-associated S100 proteins that separate them from nonmetastasis-associated S100 proteins. It might therefore be important to analyze the combination of shRNAs directed against different S100 proteins. The shRNAs used in this study were shown to specifically decrease mRNA and protein levels of their targets. Nonetheless, off-target effects cannot be ruled out entirely. Saturation of endogenous silencing pathways has recently been identified as an important source of shRNA-induced toxicity in vivo (31). In our study, mice were followed for up to 7 weeks after the last injection and we did not observe any detrimental effects. This is most likely due to the much less efficient delivery of naked plasmid compared with virus-induced cellular entry.

Taken together, these findings indicate for the first time that metastasis-inducing genes can be successfully targeted by shRNA in vivo and inhibit metastasis development. S100 proteins could provide attractive targets for specific inhibitory RNAs to develop an effective adjuvant therapy in solid tumors.

Grant support: NSCLC research in our laboratory is funded by the Deutsche Forschungsgemeinschaft MU1328/4-2. This project was partially supported by the Wilhelm Sander-Stiftung. C. Müller-Tidow is supported by a Heisenberg fellowship from the Deutsche Forschungsgemeinschaft. R. Liersch is supported by the Deutsche Forschungsgemeinschaft.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Maria Schiller and Nicole Fehrmann for expert technical assistance, Drs. Arumugan and Logsdon for providing the shRNA-S100P sequence, and Drs. Johannes Roth and Dorothee Viemann for providing primer and probes for analyzing mRNA expression of several S100 proteins.