The ETV6-NTRK3 (EN) chimeric tyrosine kinase, a potent oncoprotein expressed in tumors derived from multiple cell lineages, functions as a constitutively active protein-tyrosine kinase. ETV6-NTRK expression leads to the constitutive activation of two major effector pathways of wild-type NTRK3, namely, the Ras–mitogen-activated protein kinase (MAPK) mitogenic pathway and the phosphoinositide-3-kinase (PI3K)-Akt pathway mediating cell survival, and both are required for EN transformation. However, it remains unclear how ETV6-NTRK3 activates Ras-Erk1/2 and/or PI3K-Akt cascades. Here, we define some aspects of the molecular mechanisms regulating ETV6-NTRK–dependent Ras-Erk1/2 and PI3K-Akt activation. We show that ETV6-NTRK3 associates with c-Src, and that treatment with SU6656, a c-Src inhibitor, completely blocks ETV6-NTRK-transforming activity. Treatment of NIH3T3 cells expressing ETV6-NTRK3 with SU6656 attenuated the activation of Ras-Erk1/2 and PI3K-Akt. Suppression of c-Src by RNA interference in NIH3T3-ETV6-NTRK3 cells resulted in markedly decreased expression of cyclin D1 and suppression of activation of Ras-Erk1/2 and PI3K-Akt. However, in Src-deficient cells, the ETV6-NTRK3 failed to activate the PI3K-Atk pathway, but not the Ras-Erk1/2 pathway. Therefore, these data indicate that ETV6-NTRK3 induces the PI3K-Akt cascade through the activation of c-Src. [Cancer Res 2007;67(7):3192–200]

ETV6-NTRK3 chimeric transcripts encode the helix-loop-helix or pointed domain of ETV6 fused to the protein tyrosine kinase (PTK) domain of NTRK3 (1, 2). ETV6 (also known as TEL) is an ETS family transcription factor thought to play a major role in early hematopoiesis and angiogenesis (35). The ETV6 gene has also been identified as a fusion partner in leukemia-associated chimeric proteins, such as ETV6-PDGFR (6), ETV6-AML1 (7, 8), ETV6-JAK2 (9), ETV6-ARG (10, 11), and others (1214). Moreover, an ETV6-NTRK3 variant fusion lacking ETV6 exon 5 has been reported in a case of acute myelogenous leukemia (AML) occurring in an adult patient (15). The NTRK3 gene (also known as TRKC) encodes the transmembrane surface receptor for neurotrophin-3 involved in growth, development, and cell survival in the central nervous system (reviewed in ref. 16). Other reports highlight potential roles for NTRK receptors in oncogenesis. ETV6-NTRK3 functions as a chimeric PTK with potent transforming activity in NIH3T3 cells (17). In addition, the ETV6-NTRK3 protein associated with AML induced a rapidly fatal myeloproliferative disease in a murine bone marrow transplant model system (18). Therefore, ETV6-NTRK3 seems to have oncogenic activity in both mesenchymal and hematologic cells.

The mechanism of ETV6-NTRK3–mediated oncogenesis is not well characterized. ETV6-NTRK3 (EN) is capable of homodimerization or heterodimerization with endogenous ETV6 via the helix-loop-helix domain, leading to constitutive NTRK3 signaling. However, ETV6-NTRK3 fails to interact with adapter molecules known to associate with wild-type NTRK3 (17, 18). These include Src homology and collagen and growth factor receptor binding protein 2 (Grb2), which link NTRK3 to the Ras-Erk1/2 mitogen-activated protein (MAP) kinase (MAPK) pathway involved in mitogenesis or differentiation (16, 19) or the p85 subunit of phosphoinositide-3-kinase (PI3K) linking NTRK3 with the PI3K-Akt neuronal survival pathway (16, 19, 20). ETV6-NTRK3 does bind peritoneal lymphocytes, another known NTRK3 interactor that activates protein kinase C, but PTK-active mutants unable to bind phospholipase C (PLC) did not show defects in the transformation activity (17). We have recently shown that the distal COOH-terminal sequence of EN interacts specifically with the phosphotyrosine binding (PTB) domain of insulin receptor substrate-1 (IRS-1), and that this interaction is essential for EN transformation (21). However, it remains to be determined whether the interaction with the downstream signaling cascades is direct through IRS-1 or indirect via other molecules.

Expression of the ETV6-NTRK3 fusion protein is associated with constitutively high levels of phosphorylated Mek1 and Akt, even in the absence of serum. Moreover, ETV6-NTRK3–expressing cells show serum-independent elevation of cyclin D1 protein. Inhibition of either the Ras-Erk1/2 MAP kinase or the PI3K-Akt pathway alone completely blocks colony formation of ETV6-NTRK3–expressing cells in soft agar assays. Furthermore, the constitutive expression of cyclin D1 protein in ETV6-NTRK3–expressing cells can be transiently down-regulated by MEK1 or PI3K inhibition. However, only the inhibition of the Ras-Erk1/2 pathway led to persistent down-regulation of cyclin D1 levels in cells expressing ETV6-NTRK3 (15).

c-Src is known to activate PI3K-Akt and the MAP/extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK cascades through both focal adhesion kinase (FAK)-dependent and FAK-independent pathways (22). c-Src has also been implicated in nerve growth factor–induced down-regulation of epidermal growth factor receptors in PC12 cells. Expression of dominant-negative c-Src blocked the tyrosine phosphorylation of MAPKs (23). These results prompted us to examine whether ETV6-NTRK3 activates MEK/ERK and/or PI3K-Akt through the activation of c-Src. Here, we show that EN binds to and activates c-Src, and inhibition of c-Src activation blocks EN-transforming activity and activation of PI3K-Akt.

Cell culture and antibodies and reagent. Mouse embryonic fibroblasts (MEF) deficient in c-Src, Yes, and Fyn (SYF) were obtained from the American Type Culture Collection (Manassas, VA), and c-Src (SYF cells deficient for Yes and Fyn but overexpressing c-Src) cells were obtained from the ATCC. NIH3T3, 293T, SYF cells were maintained in DMEM plus 10% fetal bovine serum (FBS). Expression of Src was frequently assessed by Western blot analysis. Antibodies were obtained from the following companies: Anti–c-Src, anti-TrkC (H-300), anti-HA(Y-11), anti–cyclin D1 and anti-Myc (9E10) from Santa Cruz Biotechnology (Santa Cruz, CA); anti-V5 from Invitrogen (Carlsbad, CA); anti–phospho-Src, anti–phospho-MEK1/2, and anti–phospho-Akt from Cell Signaling Technology (Danvers, MA); anti–β-actin from Sigma-Aldrich (St. Louis, MO). Pharmacologic inhibition was done with PI3K inhibitor LY294002 (20 μmol/L) and c-Src family tyrosine kinases inhibitor SU6656, both from Calbiochem (San Diego, CA).

Plasmids. Three small interfering RNA–coding oligos against mouse c-Src were designed and verified to be specific to c-Src by Blast search against the mouse genome. To construct hairpin-type single RNAi vectors, 5 μL (100 mmol/L) of the synthesized sense and antisense oligonucleotides (Table 1) were combined with 1 μL of 1 mol/L NaCl and annealed by incubation at 95°C for 2 min, followed by rapid cooling to 72°C, and ramp cooling to 4°C over a period of 2 h. The c-Src–siRNA-1 and c-Src–siRNA-2 insert were subcloned into the XbaI/XhoI sites of the pFG12 lentivirus vector. A control siRNA, which does not match any known mouse coding cDNA, was used as control.

Table 1.

siRNAs sequences for mouse c-Src gene

Gene namePrimer sequencesVector
Mouse Src 1 5′CTAGACCAGCCGCCAATATCCTAGTATTCAAGAGATACTAGGATATTGGCGGCTTTTTGGAAAC 3′ pFG12 
Mouse Src 2 5′CTAGACCAAGATCACTAGACGGGAATCATTCAAGAGATGATTCCCGTCTAGTGATCTTTTTTTGGAAAC 3′ pFG12 
Gene namePrimer sequencesVector
Mouse Src 1 5′CTAGACCAGCCGCCAATATCCTAGTATTCAAGAGATACTAGGATATTGGCGGCTTTTTGGAAAC 3′ pFG12 
Mouse Src 2 5′CTAGACCAAGATCACTAGACGGGAATCATTCAAGAGATGATTCCCGTCTAGTGATCTTTTTTTGGAAAC 3′ pFG12 

Immunoblotting and immunoprecipitation. 293T cells were used for the detection of protein-protein interaction in vivo. 293T cells were transiently transfected with the indicated plasmids. After a 24-h transfection, cells were switched to 0.2% serum overnight. Cells were lysed in a buffer containing 25 mmol/L HEPES (pH, 7.5), 150 mmol/L NaCl, 1% Triton X-100, 10% glycerol, 5 mmol/L EDTA, and protease inhibitor mixture (Complete, Roche, Gipf-Oberfrick, Switzerland). Extracts were separated by SDS-PAGE, followed by electrotransfer to poly(vinylidene diflouride) membranes and probed with polyclonal or monoclonal antisera, followed by horseradish peroxidase–conjugated anti-rabbit, anti-mouse immunoglobulin G (IgG), respectively, and visualized by chemiluminescence according to the manufacturer's instructions (Pierce, Rockford, IL). For immunoprecipitation, the cell lysates were incubated with the appropriate antibody for 1 h, followed by incubation with γ-bind beads (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) for 1 h at 4°C. Beads were washed four times with the buffer used for cell solubilization. Immune complexes were then eluted by boiling for 3 min in 2× Laemmli buffer (pH, 6.8), and then extracts were analyzed by immunoblotting as described above.

Soft agar assays. Soft agar assays were done according to established protocols (24). NIH3T3 cells infected with recombinant retroviruses carrying either the empty vector, ETV6-NTRK3, or NIH3T3-EN cells carrying siRNA-coding oligos against mouse c-Src were seeded in triplicate at a concentration of 8 × 103 cells per well in a six-well plate. Bottom layers were made up of 0.4% agar in 9% FBS and DMEM. Cells were resuspended in a top layer of 0.2% agar in 9% FBS and DMEM. Cells were fed every other day by placing two drops of medium on the top layer. After 3 weeks at 37°C, colonies were then stained with p-iodonitrotetrazolium violet (1 mg/mL stock diluted at 1:500) for 16 h, and macroscopic colonies were counted (in quadruplicate). Each determination was done in triplicate.

Anchorage-independent cell growth. NIH3T3 cells expressing MSCV, ETV6-NTRK3, and si-c-Src were seeded into a Ultra Low Cluster plate (ULC plate; Corning Life Sciences, Acton, MA) at 1 × 106 cells and photographed at 96 h.

Viral production and infection of target cells. 293T cells were transfected with the transfer vector plasmid pCAG (empty) or pCAG-ETV6-NTRK3 plasmid with the envelope-encoding plasmid pHCMVG, the packaging plasmid pMDLg/pRRE, and the Rev-expression plasmid pRSV-Rev by using the calcium phosphate method. The supernatants were harvested 48 and 72 h after transfection, pooled, passed through a 0.45-μm filter, ultracentrifuged for 2 h at 100,000 × g in a SW28 rotor, resuspended in 100 μL of 0.1% bovine serum albumin in PBS, and the lentiviral stocks were stored in a small aliquot at −80°C for titration and cell infection. SYF and SYF-Src cells were plated in six-well plates (1 × 105 cells per well) and were cultured overnight. Lentiviruses were diluted in 2 mL DMEM containing polybrene (8 g/mL) and then centrifuged for 30 min at 1,500 rpm and after 24 h infection, polybrene-DMEM was replaced with fresh DMEM medium, and the cells were cultured for other assays.

EN directly binds to c-Src. We examined the possibility that EN may interact directly with c-Src in vivo. We used V5-tagged EN to screen for potential interactions between EN and Src. 293T cells were transfected with HA-tagged Src and V5-tagged EN. Total cell extracts were subjected to immunoprecipitation with the anti-HA or anti-V5 antibody, followed by immunoblotting using anti-HA or anti-V5 antibodies. As shown in Fig. 1A, EN interacted strongly with c-Src. We next determined whether endogenous Src interacts with EN. To this end, we did immunoprecipitation experiments in NIH3T3 cells, which were infected with recombinant retroviruses carrying either ETV6-NTRK3 cDNA or the empty MSCVpac vector as a negative control. Endogenous c-Src was able to interact with EN (Fig. 1B). The kinase dead EN-K380N mutant, which fails to autophosphorylate and completely lacks transformation activity (17), as well as a mutant in which all three tyrosines were converted to phenylalanine (EN-Yx3F), failed to interact with c-Src (Fig. 1B). We also examined the effect of K252a 43, an inhibitor of the Trk tyrosine kinases, to determine whether NTRK3 kinase activity of EN is required for its ability to interact with c-Src. As shown in Fig. 1C, pretreatment with K252a markedly reduced levels of c-Src bound to EN in NIH3T3 cells expressing EN. This indicates that NTRK3 (TrkC) kinase activity is required for the interaction between c-Src and EN. To further investigate whether interaction of EN with c-Src results in the activation of c-Src kinase, we examined the phosphorylation of c-Src in lysates of NIH3T3 cells expressing EN as well as EN-K380N and EN-Yx3F. EN expression increased phosphorylation of c-Src–Tyr416. However, c-Src phosphorylation was not observed in NIH3T3 cells expressing EN-K380N and EN-Yx3F (Fig. 1D). These results suggest that phosphorylation of EN kinase may result in a conformational change, exposing its interaction domain to c-Src.

Figure 1.

EN interacts with c-Src. A, V5-tagged EN was cotransfected into 293T cells with HA-tagged c-Src. Cell extracts were subjected to immunoprecipitation using anti-HA antibody or anti-V5 antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti-V5 antibody or anti-HA antibody. The expression of EN and c-Src was monitored as indicated. B, schematic representation of ETV6-NTRK3 mutant constructs (top). c-Src does not associate with the kinase-dead EN-K380N and EN-Yx3F mutant protein. NIH3T3 cell lines stably expressing EN, EN-K380N, and EN-Y3XF as well as control NIH3T3 cells (MSCV) were used. Cell extracts were immunoprecipitated using anti-TrkC (NTRK3) antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti-Src antibody. C, NTRK3 kinase activity is required for the EN interaction with c-Src. EN-expressing NIH3T3 cells or vector control cells were pretreated with K-252a for 2 h. Cell extracts were immunoprecipitated using anti-TrkC (NTRK3) antibody, followed by immunoblotting with anti-Src antibody. D, EN increased phosphorylation of c-Src in vivo. E, identification of EN–c-Src complexes in human primary tumors. Primary tumor tissue extracts from EN-positive CMN and CFS were subjected to immunoprecipitation using anti–cSrc antibody or IgG as a control, followed by immunoblotting with anti-TrkC (NTRK3) antibody. Whole-tissue lysates from primary tumors also were probed for EN, c-Src, phospho–c-Src, and β-actin as a loading control.

Figure 1.

EN interacts with c-Src. A, V5-tagged EN was cotransfected into 293T cells with HA-tagged c-Src. Cell extracts were subjected to immunoprecipitation using anti-HA antibody or anti-V5 antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti-V5 antibody or anti-HA antibody. The expression of EN and c-Src was monitored as indicated. B, schematic representation of ETV6-NTRK3 mutant constructs (top). c-Src does not associate with the kinase-dead EN-K380N and EN-Yx3F mutant protein. NIH3T3 cell lines stably expressing EN, EN-K380N, and EN-Y3XF as well as control NIH3T3 cells (MSCV) were used. Cell extracts were immunoprecipitated using anti-TrkC (NTRK3) antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti-Src antibody. C, NTRK3 kinase activity is required for the EN interaction with c-Src. EN-expressing NIH3T3 cells or vector control cells were pretreated with K-252a for 2 h. Cell extracts were immunoprecipitated using anti-TrkC (NTRK3) antibody, followed by immunoblotting with anti-Src antibody. D, EN increased phosphorylation of c-Src in vivo. E, identification of EN–c-Src complexes in human primary tumors. Primary tumor tissue extracts from EN-positive CMN and CFS were subjected to immunoprecipitation using anti–cSrc antibody or IgG as a control, followed by immunoblotting with anti-TrkC (NTRK3) antibody. Whole-tissue lysates from primary tumors also were probed for EN, c-Src, phospho–c-Src, and β-actin as a loading control.

Close modal

Identification of EN-Src complexes in human primary tumors. We next wished to confirm that the above findings are relevant to human tumors expressing EN. We therefore screened for the presence of EN-v-Src complexes in human primary tumors positive for the ETV6-NTRK3 gene fusion. These included four cellular mesoblastic nephromas (CMN) occurring in 5-month- and 5-week-old infants and one congenital fibrosarcoma (CFS) occurring in a 15-month-old infant (Fig. 1E and Supplementary Fig. S1). Tumors were diagnosed using standard histopathologic criteria. All cases were screened for ETV6-NTRK3 fusion transcripts using established methods (1), but only the CMN and CFS cases were fusion positive (data not shown). We screened 12 primary tumor samples (4 CFSs and 8 CMN), but only 5 samples were of sufficient integrity for protein studies. Therefore, we examined the interaction between c-Src and EN using these five samples. Total tissue extracts were isolated from primary tumors and subjected to immunoprecipitation with the anti–c-Src antibody, followed by immunoblotting with the anti-TrkC antibody. As shown in Fig. 1F and G, EN–c-Src complexes were found in the CMN and CFS cases, but not in control liver samples. EN expression was associated with a strong increase in phosphorylation of c-Src and Akt (S473; Fig. 1F). These results clearly show that the interaction between EN and c-Src occurs in vivo in human primary cancer tissues expressing ETV6-NTRK3 gene fusions.

SU6656 treatment suppresses EN transformation activity. Cells infected with ETV6-NTRK3 exhibited a dramatically transformed phenotype compared with negative control cells. We examined the effect of SU6656 (25), an inhibitor of c-Src kinase, on EN transformation activity by assessing the cell morphology. EN transformation activity was almost completely abrogated by the addition of SU6656 (Fig. 2A). Treatment of NIH3T3 cells expressing EN with even 1 μmol/L SU6656 exhibited a normal phenotype and failed to form microscopic or macroscopic colonies in soft agar when scored after 28 days (Fig. 2A and B). Most tumor cell lines suppress anoikis and form multicellular spheroids through cell-cell adhesion when grown in nonadhesive agar-coated dishes. Under these conditions, nonmalignant cells generally fail to do so and undergo massive cell death in culture (26). We observed that when placed in nonadherent cultures, parental NIH3T3 cells poorly formed cell aggregates and existed as dead or dying cells under these conditions (Fig. 2C). In contrast, EN-expressing cells readily form multicellular spheroids within 6 to 24 h that are stable indefinitely in culture (27). However, SU6656 treatment of EN-expressing cells suppressed formation of multicellular spheroids (Fig. 2C). The fact that NIH3T3-EN cells do not form stable spheroids in the presence of SU6656 indicates that this reagent is blocking the ability of cells to suppress anoikis.

Figure 2.

Inhibition of c-Src activation blocks soft agar colony formation of ETV6-NTRK3–expressing NIH3T3 cells. A, The NIH3T3 cell line stably expressing EN as well as control NIH3T3 cells (MSCV) were grown in medium containing 9% serum and were treated with various doses of SU6656, vehicle control (DMSO) for 12 h. Cells were then photographed in time at ×200 magnification. B, soft agar colony forming assay of NIH3T3 cells stably expressing EN. Monolayer cells were trypsinized, washed, and plated in medium containing 0.2% agar to assess anchorage-independent growth. Results are presented as the number of macroscopic colonies formed at 3 wks after plating. C, anchorage-independent spheroid growth of NIH3T3 cells stably expressing EN as well as control NIH3T3 cells.

Figure 2.

Inhibition of c-Src activation blocks soft agar colony formation of ETV6-NTRK3–expressing NIH3T3 cells. A, The NIH3T3 cell line stably expressing EN as well as control NIH3T3 cells (MSCV) were grown in medium containing 9% serum and were treated with various doses of SU6656, vehicle control (DMSO) for 12 h. Cells were then photographed in time at ×200 magnification. B, soft agar colony forming assay of NIH3T3 cells stably expressing EN. Monolayer cells were trypsinized, washed, and plated in medium containing 0.2% agar to assess anchorage-independent growth. Results are presented as the number of macroscopic colonies formed at 3 wks after plating. C, anchorage-independent spheroid growth of NIH3T3 cells stably expressing EN as well as control NIH3T3 cells.

Close modal

Characterization of the c-Src/EN interaction. c-Src is a multidomain protein containing a unique NH2-terminal domain: UD (residues 1–80), SH3 (residues 83–144), SH2 protein interaction domains (150–247), a catalytic region (269–522), and a negative-regulatory tyrosine located near the COOH terminus (residue 523; ref. 28; Fig. 3A). To identify the functional domain of c-Src responsible for the interaction with EN, we used a series of deletion constructs. The c-Src mutant lacking the UD region, SH3 and SH2 still interacted with EN (Fig. 3B). This indicates that the c-Src COOH-terminal region is directly involved in this interaction. Next, we tested the interaction of EN with a series of COOH-terminal deletion mutants. The c-Src ΔC, which does not have a negative regulatory tyrosine in the COOH-terminal region, still interacted with EN. Although the deletion of amino acid residues 361–535 (ΔKD-1 and ΔKD-2) also interacted with EN, the deletion of amino acid residues 275–360 abrogated the EN interaction (Fig. 3C). These results clearly indicate that the region including amino acids 275–360 of Src, which includes the ATP binding domain, is required for EN interaction.

Figure 3.

Immunoprecipitation analyses of overexpressed EN and its interaction with c-Src proteins in 293T cells. A, top, a schematic representation of full-length and truncated c-Src proteins. B and C, immunoprecipitation and immunoblot analyses of HA-tagged c-Src protein (B) or Myc-tagged c-Src protein (C) interacting with V5-tagged EN.

Figure 3.

Immunoprecipitation analyses of overexpressed EN and its interaction with c-Src proteins in 293T cells. A, top, a schematic representation of full-length and truncated c-Src proteins. B and C, immunoprecipitation and immunoblot analyses of HA-tagged c-Src protein (B) or Myc-tagged c-Src protein (C) interacting with V5-tagged EN.

Close modal

The Fyn tyrosine kinase, a member of the c-Src kinase family, is known to associate with IRS-1 in vitro and in vivo (29). Because other members of the c-Src kinase family have similar SH2 domains, these kinases may also associate with IRS-1 and contribute to the overall response in various cellular backgrounds. Because IRS-1 functions as the adaptor protein linking EN to downstream signaling pathways, we examined whether the interaction between EN and c-Src is mediated through IRS-1. 293T cells were transfected with Myc-tagged c-Src and HA-tagged IRS-1 with or without the V5-tagged EN. IRS-1 interacts with either EN or c-Src (Fig. 4A and B). To determine whether c-Src could associate with EN directly, 293T cells were transiently transfected with HA-tagged c-Src and either the V5-tagged EN construct or V5-tagged EN-Δ614 construct which fails to associate with IRS-1 (21). Lysates were immunoprecipitated with HA antibodies followed by Western blot analysis with V5 antibodies. As shown in Fig. 4C, EN and EN-Δ614 were pulled down in c-Src lysates. Equal expression of c-Src was confirmed by Western blotting of lysates using HA antibodies (Fig. 4C). These data indicate that c-Src directly interacts with EN.

Figure 4.

EN interacts with c-Src and IRS-1. A, V5 tagged EN was cotransfected into 293T cells with the HA-tagged IRS-1 and Myc-tagged c-Src constructs. Cell extracts were subjected to immunoprecipitation using anti-HA antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti-TrkC(NTRK3) antibody or anti-V5 antibody. The expression of c-Src, IRS-1, or EN was monitored as indicated. B, HA-tagged IRS-1 was cotransfected into 293T cells with the Myc-tagged c-Src constructs. C, ENΔ614 associates with the c-Src protein. HA-tagged c-Src was cotransfected into 293T cells with V5-tagged EN or the EN mutant ENΔ614 construct. D, generation of SYF and SYF-Src cells stably expressing V5-tagged EN. Expression of EN protein was examined by immunoblotting in SYF and SYF-Src cells expressing V5-tagged EN. E, c-Src expression in c-Src–deficient MEF cells enhances the EN–IRS-1 complex formation. Cell extracts were subjected to immunoprecipitation using anti-V5 antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti–IRS-1 antibody. The expression of V5-EN or IRS-1 was monitored as indicated. F, suppression of c-Src expression by stable siRNA decreases the level of IRS-1 bound to EN in NIH3T3 cells stably expressing EN. ETV6-NTRK3, c-Src–siRNA–expressing or control NIH3T3 cells were serum starved overnight in 0.5% serum and then stimulated with 9% calf serum–DMEM for 1 h. Cell extracts were subjected to immunoprecipitation using anti-V5 antibody or anti–IRS-1, followed by immunoblotting with anti–IRS-1 antibody or anti–phospho-tyrosine antibody. The expression of V5-EN or IRS-1 was monitored as indicated.

Figure 4.

EN interacts with c-Src and IRS-1. A, V5 tagged EN was cotransfected into 293T cells with the HA-tagged IRS-1 and Myc-tagged c-Src constructs. Cell extracts were subjected to immunoprecipitation using anti-HA antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti-TrkC(NTRK3) antibody or anti-V5 antibody. The expression of c-Src, IRS-1, or EN was monitored as indicated. B, HA-tagged IRS-1 was cotransfected into 293T cells with the Myc-tagged c-Src constructs. C, ENΔ614 associates with the c-Src protein. HA-tagged c-Src was cotransfected into 293T cells with V5-tagged EN or the EN mutant ENΔ614 construct. D, generation of SYF and SYF-Src cells stably expressing V5-tagged EN. Expression of EN protein was examined by immunoblotting in SYF and SYF-Src cells expressing V5-tagged EN. E, c-Src expression in c-Src–deficient MEF cells enhances the EN–IRS-1 complex formation. Cell extracts were subjected to immunoprecipitation using anti-V5 antibody and γ-bind beads (Amersham Pharmacia Biosciences), followed by immunoblotting with anti–IRS-1 antibody. The expression of V5-EN or IRS-1 was monitored as indicated. F, suppression of c-Src expression by stable siRNA decreases the level of IRS-1 bound to EN in NIH3T3 cells stably expressing EN. ETV6-NTRK3, c-Src–siRNA–expressing or control NIH3T3 cells were serum starved overnight in 0.5% serum and then stimulated with 9% calf serum–DMEM for 1 h. Cell extracts were subjected to immunoprecipitation using anti-V5 antibody or anti–IRS-1, followed by immunoblotting with anti–IRS-1 antibody or anti–phospho-tyrosine antibody. The expression of V5-EN or IRS-1 was monitored as indicated.

Close modal

c-Src expression in c-Src–deficient MEF cells enhances the EN-IRS-1 complex formation. To test whether EN binding to IRS-1 requires c-Src, we used SYF cells that were derived from Src, Yes, and Fyn triple knock-out mouse embryos (30). Because Src, Yes, and Fyn are three ubiquitously expressed members of the Src family tyrosine kinases, no Src family tyrosine kinase activity was detected in these SYF cells (30). We infected SYF and SYF–c-Src cells with the lentiviral vector transducing the ETV6-NTRK3 gene. As shown in Fig. 4D, expression of EN protein in these cells was verified by immunoblotting using the anti-TrkC (C-14) antibody. We next determined whether EN–IRS-1 complex formation is increased in the presence of c-Src. IRS-1 immunoprecipitated with EN was detected in c-Src–deficient SYF cells. However, the level of IRS-1 immunoprecipitated with EN was markedly enhanced in SYF cells expressing c-Src compared with that in SYF cells (Fig. 4E). Interestingly, expression of EN markedly decreased the level of IRS-1 protein in SYF cells. In SYF–c-Src cells, the level of IRS-1 is much lower than that in SYF cells, and expression of EN further reduced the level of IRS-1. It is possible that when cells are transformed by an oncoprotein such as EN, IRS-1 cellular levels must remain below a certain threshold to avoid inducing apoptosis in these cells. However, this hypothesis requires further experiments to validate. We next examined whether endogenous c-Src plays a critical role for EN and IRS-1 interaction and EN-mediated IRS-1 phosphorylation. To do this, the RNA interference approach was employed to knockdown endogenous c-Src in NIH3T3 cells expressing EN. We constructed lentiviral vectors expressing two different c-Src siRNAs (Si–c-Src 1 and 2). To establish cell lines expressing these c-Src siRNA genes, two cycles of infection and selection were done. The c-Src gene silencing activity of c-Src RNAi in NIH3T3 cells expressing EN was confirmed by immunoblotting with c-Src antibodies. Expression of c-Src siRNAs (Si–c-Src 1 and 2) resulted in more than 80% decreases in the expression of the endogenous c-Src (Supplementary Fig. S2). The luciferase RNAi nucleotide (Si-Lu) was used as a control. We examined whether the EN and IRS-1 interaction and EN-mediated IRS-1 phosphorylation are affected when endogenous c-Src is silenced in NIH3T3-EN cells. The level of IRS-1 bound to EN was markedly reduced in c-Src–silenced NIH3T3-EN cells (Fig. 4F). Interestingly, EN-mediated IRS-1 phosphorylation seemed to be increased in c-Src–silenced NIH3T3-EN cells. However, when IRS-1 phosphorylation levels are normalized with endogenous IRS-1 levels, this induction effect is negligible (data not shown). We are currently investigating how c-Src reduces expression of IRS-1. Taken together, these results suggest that c-Src facilitates the EN–IRS-1 interaction. However, these data do not exclude the possibility that EN interacts directly, although more weakly, with IRS-1, or that an unidentified protein may also be involved in the EN–IRS-1 complex formation.

Treatment with SU6656 attenuates Akt Activation in EN-expressing NIH3T3 cells. ETV6-NTRK3 seems to be linking to both the Ras-Erk1/2 and the PI3K-Akt pathways via adaptors other than those used by wild-type NTRK3 (15). Recently, we have shown a role for IRS-1 binding in constitutive activation of the Ras-MAPK and PI3K-Akt pathways in EN-transformed cells. Therefore, we examined whether c-Src also plays a role in EN-induced activation of the Ras-MAPK and PI3K-Akt pathways and in constitutive overexpression of cyclin D1 by using an inhibitor of c-Src kinase. To assess this, we examined the activation states of MEK1/2 and Akt, as well as cyclin D1 levels, in NIH3T3 cells expressing EN by treating these cells with SU6656. Levels of phosphorylated (activated) MEK1/2 and Akt as well as cyclin D1 were reduced markedly in EN-expressing cells after treatment with SU6656 (Fig. 5A). Previous studies have shown that the PI3K inhibitor LY294002 blocks soft agar colony formation of EN-transformed NIH3T3 fibroblasts (27). To determine that PI3K-Akt is a downstream effector of the c-Src kinase, we treated EN-expressing NIH3T3 cell lines with the PI3K-Akt inhibitor LY294002 and examined the phosphorylation of Src. LY294002 treatment caused a reduction in phosphorylation of Akt, whereas it has no effect on c-Src phosphorylation (Fig. 5B), indicating that PI3K-Akt acts downstream of c-Src in EN-expressing NIH3T3 cell lines. Taken together, our findings show that c-Src is essential for the ability of EN to constitutively activate the Ras-MAPK and the PI3K-Akt pathways and to induce cyclin D1 overexpression.

Figure 5.

The SU6656 c-Src inhibitor, but not LY294002 Akt inhibitor, reduces the level of MEK phosphorylation, Akt phosphorylation, and cyclin D1 in ETV6-NTRK3–expressing NIH3T3 cells. A, MSCV or ETV6-NTRK3–transformed NIH3T3 cells were grown for 48 h in 9% calf serum–DMEM and then incubated with or without the c-Src family tyrosine kinase inhibitor SU6656 (2 and 5 μmol/L) or DMSO (0) for 1 h. Total cell lysates were prepared from the untreated and treated cells, and Western blotting was done using antibodies against P-MEK, P-Akt, and cyclin D1. B, MSCV or ETV6-NTRK3–expressing cells were grown for 48 h in 9% calf serum–DMEM and then grown in 9% calf serum–DMEM with or without LY294002 (25 μmol/L) for 1 h. Whole cell lysates were prepared, and Western blotting was done using phospho-Src and phospho-Akt antibody. C, suppression of c-Src expression by stable siRNA decreases elevated levels of phosphorylated Akt in NIH3T3 cells stably expressing ETV6-NTRK3. ETV6-NTRK3, c-Src–siRNA–expressing or control NIH3T3 cells were serum starved overnight in 0.5% serum and then stimulated with 9% CS-DMEM for 1 h. Whole cell lysates were prepared for Western blotting and probed with antibodies against the phosphorylated forms of Mek1/2 (Ser217/221), phosphorylated Akt (Ser473), and cyclin D1. D, soft agar colony-forming assay. Soft agar colony-forming assay of EN control-siRNA, EN c-Src–siRNA-1, and EN c-Src–siRNA-2. Monolayer cells were trypsinized, washed, and plated in medium containing 0.2% agar to assess anchorage-independent growth. Results are presented as the number of macroscopic colonies formed at 3 wks after plating.

Figure 5.

The SU6656 c-Src inhibitor, but not LY294002 Akt inhibitor, reduces the level of MEK phosphorylation, Akt phosphorylation, and cyclin D1 in ETV6-NTRK3–expressing NIH3T3 cells. A, MSCV or ETV6-NTRK3–transformed NIH3T3 cells were grown for 48 h in 9% calf serum–DMEM and then incubated with or without the c-Src family tyrosine kinase inhibitor SU6656 (2 and 5 μmol/L) or DMSO (0) for 1 h. Total cell lysates were prepared from the untreated and treated cells, and Western blotting was done using antibodies against P-MEK, P-Akt, and cyclin D1. B, MSCV or ETV6-NTRK3–expressing cells were grown for 48 h in 9% calf serum–DMEM and then grown in 9% calf serum–DMEM with or without LY294002 (25 μmol/L) for 1 h. Whole cell lysates were prepared, and Western blotting was done using phospho-Src and phospho-Akt antibody. C, suppression of c-Src expression by stable siRNA decreases elevated levels of phosphorylated Akt in NIH3T3 cells stably expressing ETV6-NTRK3. ETV6-NTRK3, c-Src–siRNA–expressing or control NIH3T3 cells were serum starved overnight in 0.5% serum and then stimulated with 9% CS-DMEM for 1 h. Whole cell lysates were prepared for Western blotting and probed with antibodies against the phosphorylated forms of Mek1/2 (Ser217/221), phosphorylated Akt (Ser473), and cyclin D1. D, soft agar colony-forming assay. Soft agar colony-forming assay of EN control-siRNA, EN c-Src–siRNA-1, and EN c-Src–siRNA-2. Monolayer cells were trypsinized, washed, and plated in medium containing 0.2% agar to assess anchorage-independent growth. Results are presented as the number of macroscopic colonies formed at 3 wks after plating.

Close modal

Effects of c-Src–targeted siRNA on EN-transforming activity. To further prove the requirement of c-Src for EN transformation activity, we examined the EN-induced MEK1/2 and Akt-1 activation, cyclin D1 expression, and the EN transformation activity in c-Src–silenced NIH3T3-EN cells and control NIH3T3-EN cells (si-Luc). As shown in Fig. 5C, EN-induced MEK1/2 and Akt-1 activation and cyclin D1 expression were significantly reduced in c-Src knockdown cells. Expression of c-Src RNAi nucleotides (Si–c-Src) failed to form microscopic or macroscopic colonies in soft agar when scored after 28 days in NIH3T3 cells expressing EN (Fig. 5D). Taken together, our data suggest that c-Src plays a role in the EN-induced MEK1/2 and Akt-1 activation and cyclin D1 expression and mediates the EN transformation activity.

c-Src is required for EN-induced Akt activation in c-Src–deficient MEF cells. To genetically test the role of c-Src in EN signaling to the MEK1/2 and PI3K–Akt-1 pathways, we investigated the activation of MEK1/2 and PI3K–Akt-1 by the EN in SYF and SYF–c-Src cells. SYF cells and SYF-Src cells with or without the EN were serum starved overnight and then incubated with serum. Ras-Erk1/2 and PI3K–Akt-1 activation as well as cyclin D1 expression were not observed in SYF cells. Constitutive serum-independent phosphorylation of Akt Ser473 was observed in SYF cells expressing c-Src, but EN expression in these cells markedly increased Akt phosphorylation (Fig. 6A). Interestingly, stable expression of EN in SYF cells did not lead to increased activity of Akt, suggesting that EN-induced PI3K-Akt activation requires c-Src (Fig. 6B). In both SYF and SFY-c-Src cells, expression of EN increased the Mek1 phosphorylation even in the absence of serum (Fig. 6B). Interestingly, SYF-Src cells had constitutively high levels of Mek1 phosphoryation, but addition of serum decreased levels of Mek1 phosphoryation. SYF cells expressing EN exhibited constitutively high levels of cyclin D1 even after overnight serum starvation (Fig. 6A). SYF-Src cells responded to EN in cyclin D1 elevation only in the presence of serum (Fig. 6B). In NIH3T3-EN cells, silencing c-Src expression blocked EN-mediated MEK phosphorylation (Fig. 5C). In contrast, EN-mediated MEK phosphorylation remained unaffected in SYF cells. Because SYF cells are also deficient of Yes and Fyn in addition to c-Src, Yes and Fyn may also affect EN-mediated MEK phosphorylation via unknown mechanisms. It is also possible that in the absence of the three Src family members, the cells use another mechanism to induce Ras-MAPK and MEK activation.

Figure 6.

c-Src is required for EN-induced Akt activation in c-Src–deficient MEF cells. A, EN-expressing SYF cells exhibit elevated levels of phosphorylated Mek1 and cyclin D1, but not phosphorylated Akt. EN-expressing or control SYF cells were serum starved overnight in 0.5% serum and then stimulated with (+) and without (−) 9% calf serum–DMEM for 1 or 6 h. Data are representative of three experiments. B, EN-expressing SYF-Src cells exhibit elevated levels of phosphorylated Mek1, phosphorylated Akt, and cyclin D1. SYF cells and EN-expressing or control SYF-Src cells were serum starved overnight in 0.5% serum and then stimulated with (+) and without (−) 9% calf serum–DMEM for 1 or 6 h. Whole cell lysates were prepared for Western blotting and probed with antibodies against the phosphorylated forms of Mek1/2 (Ser217/221), phosphorylated Akt (Ser473), cyclin D1, and β-actin (as a loading control). C and D, the inhibitor U0126 reduces cyclin D1 levels in EN-expressing SYF and SYF–c-Src cells. Control and EN-expressing cells were serum starved overnight in 0.5% calf serum–DMEM and then grown in 9% calf serum–DMEM ± U0126 (10 mmol/L) for 24 h. Whole cell lysates were prepared, and immunoblotting was done using a cyclin D1 antibody. Equal loading was determined by probing the blots with an antibody against β-actin.

Figure 6.

c-Src is required for EN-induced Akt activation in c-Src–deficient MEF cells. A, EN-expressing SYF cells exhibit elevated levels of phosphorylated Mek1 and cyclin D1, but not phosphorylated Akt. EN-expressing or control SYF cells were serum starved overnight in 0.5% serum and then stimulated with (+) and without (−) 9% calf serum–DMEM for 1 or 6 h. Data are representative of three experiments. B, EN-expressing SYF-Src cells exhibit elevated levels of phosphorylated Mek1, phosphorylated Akt, and cyclin D1. SYF cells and EN-expressing or control SYF-Src cells were serum starved overnight in 0.5% serum and then stimulated with (+) and without (−) 9% calf serum–DMEM for 1 or 6 h. Whole cell lysates were prepared for Western blotting and probed with antibodies against the phosphorylated forms of Mek1/2 (Ser217/221), phosphorylated Akt (Ser473), cyclin D1, and β-actin (as a loading control). C and D, the inhibitor U0126 reduces cyclin D1 levels in EN-expressing SYF and SYF–c-Src cells. Control and EN-expressing cells were serum starved overnight in 0.5% calf serum–DMEM and then grown in 9% calf serum–DMEM ± U0126 (10 mmol/L) for 24 h. Whole cell lysates were prepared, and immunoblotting was done using a cyclin D1 antibody. Equal loading was determined by probing the blots with an antibody against β-actin.

Close modal

Previous studies have shown that the Mek1 inhibitor U0126 markedly decreased levels of cyclin D1 levels in EN-expressing cells. We also confirmed this finding in SYF and SRF–c-Src cells expressing EN (Fig. 6C and D). These genetic data showed that c-Src is required for EN-induced PI3K-Akt activation, but not for the Ras-Erk1/2 pathway. These results further supported by our previous finding that only the inhibition of the Ras-Erk1/2 pathway led to persistent down-regulation of cyclin D1 expression (15).

The EN chimeric product functions as a constitutively active protein-tyrosine kinase with potent transforming activity in multiple cell lineages (15, 17). Activation of the EN protein-tyrosine kinase is linked to the induction of downstream signaling pathways of wild-type NTRK3, including Ras-MAPK and PI3K-Akt, leading to elevated cyclin D1 expression and aberrant cell cycle progression (15). However, the mechanism of EN-mediated oncogenesis remains for the most part unknown. In this study, we show that c-Src activation is necessary for the transformation activity of EN in NIH3T3 cells. Inhibition of either c-Src kinase activity or c-Src expression blocked anchorage-independent growth and formation of microscopic or macroscopic colonies in soft agar in NIH3T3 fibroblasts expressing EN.

The transforming properties of EN are associated with the constitutive activation of NTRK3 signaling pathways, namely, the Ras-MAPK and PI3K-Akt cascades (15). However, other than IRS-1 (ref. 27; see below), the adaptor proteins that link EN to activation of these pathways have yet to be identified. EN does not directly associate with known NTRK3-associating molecules, including Src homology and collagen, Grb2, PI3K p85, ABL, SH2B, or Ship2 (15, 17). The unique ability of ETV6-NTRK3 to activate both the Ras-Erk1/2 and PI3K-Akt pathways may be key to its oncogenic activity. An association between the aberrant activation of the Ras-Erk1/2 pathway and cellular transformation is well described in the literature (31, 32). Alterations in the PI3K-Akt pathway have also been observed in humans tumors, including the amplification of the Akt β isoform in breast and ovarian carcinomas (33), amplification of the PI3K regulatory subunit in ovarian carcinoma (34), and mutations of the PTEN tumor suppressor gene leading to the constitutive Akt activation (reviewed in ref. 35). Although these and other studies (reviewed in ref. 36) illustrate the oncogenic potential of each individual pathway, it is becoming increasingly clear that a synergistic effect exists between Ras-Erk1/2 and PI3K-Akt cascades in transformation. Activated Ras mutants that are incapable of activating PI3K are unable to transform NIH3T3 cells unless an activated (nontransforming) viral form of Akt is coexpressed (37). Moreover, the transformation of rat intestinal epithelial cells by oncogenic Ha-Ras not only leads to coactivation of PI3K-Akt but is blocked by PI3K inhibitors (38). Recent studies suggest that depletion of endogenous c-Src levels by means of siRNA or expression of dominant-negative c-Src significantly reduced cell proliferation in vitro and led to a clear decrease in Akt phosphorylation, placing c-Src upstream of the PI3K-Akt signals. Therefore, our data indicate that EN-activated c-Src tyrosine kinase exerts its transforming activity by activating PI3K-Akt.

Recent studies show that EN binds the IRS-1 protein, and that EN–IRS-1 complex localization to the membrane leads to the activation of the PI3K-Akt cascade (27). Expression of EN in insulin-like growth factor-IR (IGF-IR)–null R mouse embryo fibroblasts is specifically associated with a defect in Akt activation, whereas these cells retain intact Ras-MAPK pathway activation and cell cycle progression. R EN cells undergo detachment-induced apoptosis (anoikis) under anchorage-independent conditions. This report showed that soft agar colony formation, spheroid formation, and tumorigenesis induced by EN require Akt activation, and IGF-IR–mediated IRS-1 membrane localization is essential for Akt activation during EN transformation. We found that either inhibition of c-Src kinase activity or knockdown of c-Src expression in NIH3T3 fibroblasts expressing EN suppresses Akt activation. These results suggest that c-Src is involved in the EN–IRS-1–induced Akt activation. One possibility to explain our findings is that c-Src is also recruited to EN–IRS-1 complexes and is essential to link these complexes to downstream signaling cascades such as PI3K-Akt and Ras-Erk1/2. IGF-I and IGF-II are known to promote direct association of c-Src with IGF-IR and to phosphorylate c-Src (39) and PP2, a specific c-Src–like kinase inhibitor, blocks IGF-I–stimulated Akt activation (39). Interestingly, IGF-IR expression was reported to be up-regulated in the PANC-1 human pancreatic cancer cell line when cells were stably transfected with active c-Src (40). This increased expression of IGF-IR may also enhance the Akt activation. IGF-IR is frequently overexpressed in several types of human malignancy and is associated with invasion and metastasis of tumor cells. It will be interesting to investigate whether IGF-IR is also overexpressed in EN-expressing tumors.

Interestingly, we recently showed that Ras-ERK pathway signaling, cyclin D1 induction, and cell cycle progression may be independent of EN/IRS-1 complex localization to the plasma membrane (27). Whereas PI3K-Akt signaling occurs almost exclusively at the plasma membrane, Ras-ERK signaling can take place on Golgi and endoplasmic reticulum membranes (41). EN showed a perinuclear expression pattern in IGF-IR null R cells, which is indicative of localization to internal membranes. It is therefore possible that Ras-ERK signaling is activated predominantly on endomembranes in EN-expressing cells (27). Taken together, our observations establish an essential role for c-Src kinase in the activation of the PI3K-Akt cascade in EN-expressing fibroblasts.

c-Src is a proto-oncogene belonging to the nonreceptor protein tyrosine kinase family, which plays a prominent role in carcinogenesis (42, 43). c-Src kinase activity is significantly increased in a number of human cancers, including lung, skin, colon, breast, ovarian, endometrial, and head and neck malignancies, and this elevated c-Src activity is correlated with poor metastasis-free survival (42, 44, 45). Because c-Src is a critical component of so many different processes that promote cancer progression, it is becoming recognized as a valid chemotherapeutic target. c-Src and its family members are critical mediators of multiple signaling pathways that regulate all stages of cancer progression (from initiation to metastasis) in multiple cell types, and thus, one can envision the use of c-Src inhibitors in a wide range of malignancies at all stages of disease. Recent studies provided compelling evidence that in vivo pharmacologic treatment with a c-Src inhibitor could be very promising for the treatment of human cancers and their metastatic complications (46, 47). Interestingly, human primary cellular tumors expressing the ETV6-NTRK3 gene exhibit elevated c-Src protein levels and catalytic activity. Given the difficulty in the clinical management of CFS and cellular CMN, the possibility that c-Src inhibitors can be used alone or in combination for the treatment of human tumors expressing ETV6-NTRK3 is of great interest.

In summary, we have shown that EN binds to and activates c-Src, and inhibition of c-Src activation blocks EN transforming activity and activation of PI3K-Akt. In c-Src–deficient SYF cells, it seems that there is no Akt activation in response to serum, and that expression of EN cannot overcome this. Because a recent report showed that c-Src is directly associated with Akt (48), our data suggest that EN requires c-Src to activate Akt.

Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Grant support: Tissue samples were provided by the Children's Oncology Group, which is funded by the National Cancer Institute. Intramural Research Program of the National Cancer Institute, NIH. The work was also funded in part through a grant from the Canadian Institutes for Health Research (P.H.B. Sorensen).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Knezevich SR, McFadden DE, Tao W, Lim JF, Sorensen PH. A novel ETV6-NTRK3 gene fusion in congenital fibrosarcoma.
Nat Genet
1998
;
18
:
184
–7.
2
Knezevich SR, Garnett MJ, Pysher TJ, Beckwith JB, Grundy PE, Sorensen PH. ETV6-NTRK3 gene fusions and trisomy 11 establish a histogenetic link between mesoblastic nephroma and congenital fibrosarcoma.
Cancer Res
1998
;
58
:
5046
–8.
3
Baens M, Peeters P, Guo C, Aerssens J, Marynen P. Genomic organization of TEL: the human ETS-variant gene 6.
Genome Res
1996
;
6
:
404
–13.
4
Edel MJ. Analysis of the TEL protein during tumour angiogenesis.
Anticancer Res
1999
;
19
:
2945
–51.
5
Wang LC, Kuo F, Fujiwara Y, Gilliland DG, Golub TR, Orkin SH. Yolk sac angiogenic defect and intra-embryonic apoptosis in mice lacking the Ets-related factor TEL.
EMBO J
1997
;
16
:
4374
–83.
6
Carroll M, Tomasson MH, Barker GF, Golub TR, Gilliland DG. The TEL/platelet-derived growth factor β receptor (PDGFβR) fusion in chronic myelomonocytic leukemia is a transforming protein that self-associates and activates PDGFβR kinase-dependent signaling pathways.
Proc Natl Acad Sci U S A
1996
;
93
:
14845
–50.
7
Golub TR, Barker GF, Bohlander SK, et al. Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci U S A
1995
;
92
:
4917
–21.
8
Romana SP, Mauchauffe M, Le Coniat M, et al. The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion.
Blood
1995
;
85
:
3662
–70.
9
Lacronique V, Boureux A, Valle VD, et al. A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia.
Science
1997
;
278
:
1309
–12.
10
Cazzaniga G, Tosi S, Aloisi A, et al. A. The tyrosine kinase abl-related gene ARG is fused to ETV6 in an AML-M4Eo patient with a t(1;12)(q25;p13): molecular cloning of both reciprocal transcripts.
Blood
1999
;
94
:
4370
–3.
11
Iijima Y, Ito T, Oikawa T, et al. A new ETV6/TEL partner gene, ARG (ABL-related gene or ABL2), identified in an AML-M3 cell line with a t(1;12)(q25;p13) translocation.
Blood
2000
;
95
:
2126
–31.
12
Golub TR, Goga A, Barker GF, et al. Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human leukemia.
Mol Cell Biol
1996
;
16
:
4107
–16.
13
Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM. The novel activation of ABL by fusion to an ets-related gene, TEL.
Cancer Res
1995
;
55
:
34
–8.
14
Yagasaki F, Wakao D, Yokoyama Y, et al. Fusion of ETV6 to fibroblast growth factor receptor 3 in peripheral T-cell lymphoma with a t(4;12)(p16;p13) chromosomal translocation.
Cancer Res
2001
;
61
:
8371
–4.
15
Tognon C, Garnett M, Kenward E, et al. The chimeric protein tyrosine kinase ETV6-NTRK3 requires both Ras-Erk1/2 and PI3-kinase-Akt signaling for fibroblast transformation.
Cancer Res
2001
;
61
:
8909
–16.
16
Kaplan DR, Miller FD. Neurotrophin signal transduction in the nervous system.
Curr Opin Neurobiol
2000
;
10
:
381
–91.
17
Wai DH, Knezevich SR, Lucas T, Jansen B, Kay RJ, Sorensen PH. The ETV6-NTRK3 gene fusion encodes a chimeric protein tyrosine kinase that transforms NIH3T3 cells.
Oncogene
2000
;
19
:
906
–15.
18
Liu Q, Schwaller J, Kutok J, Cain D, Aster JC, Williams IR, Gilliland DG. Signal transduction and transforming properties of the TEL-TRKC fusions associated with t(12;15)(p13;q25) in congenital fibrosarcoma and acute myelogenous leukemia.
EMBO J
2000
;
19
:
1827
–38.
19
Hallberg B, Ashcroft M, Loeb DM, Kaplan DR, Downward J. Nerve growth factor induced stimulation of Ras requires Trk interaction with Shc but does not involve phosphoinositide 3-OH kinase.
Oncogene
1998
;
17
:
691
–7.
20
Minichiello L, Klein R. TrkB and TrkC neurotrophin receptors cooperate in promoting survival of hippocampal and cerebellar granule neurons.
Genes Dev
1996
;
10
:
2849
–58.
21
Lannon CL, Martin MJ, Tognon CE, Jin W, Kim SJ, Sorensen PH. A highly conserved NTRK3 C-terminal sequence in the ETV6-NTRK3 oncoprotein binds the phosphotyrosine binding domain of insulin receptor substrate-1: an essential interaction for transformation.
J Biol Chem
2004
;
279
:
6225
–34.
22
Jones RJ, Brunton VG, Frame MC. Adhesion-linked kinases in cancer; emphasis on src, focal adhesion kinase and PI 3-kinase.
Eur J Cancer
2000
;
36
:
1595
–606.
23
Kremer NE, D'Arcangelo G, Thomas SM, DeMarco M, Brugge JS, Halegoua S. Signal transduction by nerve growth factor and fibroblast growth factor in PC12 cells requires a sequence of src and ras actions.
J Cell Biol
1991
;
115
:
809
–19.
24
May WA, Lessnick SL, Braun BS, et al. The Ewing's sarcoma EWS/FLI-1 fusion gene encodes a more potent transcriptional activator and is a more powerful transforming gene than FLI-1.
Mol Cell Biol
1993
;
13
:
7393
–8.
25
Blake RA, Broome MA, Liu X, et al. SU6656, a selective src family kinase inhibitor, used to probe growth factor signaling.
Mol Cell Biol
2000
;
20
:
9018
–27.
26
Bates RC, Edwards NS, Yates JD. Spheroids and cell survival.
Crit Rev Oncol Hematol
2000
;
36
:
61
–74.
27
Martin MJ, Melnyk N, Pollard M, et al. The insulin-like growth factor I receptor is required for Akt activation and suppression of anoikis in cells transformed by the ETV6-NTRK3 chimeric tyrosine kinase.
Mol Cell Biol
2006
;
26
:
1754
–69.
28
Funakoshi-Tago M, Tago K, Andoh K, Sonoda Y, Tominaga S, Kasahara T. Functional role of c-Src in IL-1–induced NF-κ B activation: c-Src is a component of the IKK complex.
J Biochem (Tokyo)
2005
;
137
:
189
–97.
29
Sun XJ, Pons S, Asano T, et al. The Fyn tyrosine kinase binds Irs-1 and forms a distinct signaling complex during insulin stimulation.
J Biol Chem
1996
;
271
:
10583
–7.
30
Klinghoffer RA, Sachsenmaier C, Cooper JA, Soriano P. Src family kinases are required for integrin but not PDGFR signal transduction.
EMBO J
1999
;
18
:
2459
–71.
31
Mansour SJ, Matten WT, Hermann AS, et al. Transformation of mammalian cells by constitutively active MAP kinase kinase.
Science
1994
;
265
:
966
–70.
32
Cowley S, Paterson H, Kemp P, Marshall CJ. Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells.
Cell
1994
;
77
:
841
–52.
33
Bellacosa A, de Feo D, Godwin AK, et al. Molecular alterations of the Akt2 oncogene in ovarian and breast carcinomas.
Int J Cancer
1995
;
64
:
280
–5.
34
Shayesteh L, Lu Y, Kuo WL, et al. PIK3CA is implicated as an oncogene in ovarian cancer.
Nat Genet
1999
;
21
:
99
–102.
35
Di Cristofano A, Pandolfi PP. The multiple roles of PTEN in tumor suppression.
Cell
2000
;
100
:
387
–90.
36
Kopnin BP. Targets of oncogenes and tumor suppressors: key for understanding basic mechanisms of carcinogenesis.
Biochemistry (Mosc)
2000
;
65
:
2
–27.
37
Marte BM, Rodriguez-Viciana P, Wennstrom S, Warne PH, Downward J. R-Ras can activate the phosphoinositide 3-kinase but not the MAP kinase arm of the Ras effector pathways.
Curr Biol
1997
;
7
:
63
–70.
38
Sheng H, Shao J, DuBois RN. Akt/PKB activity is required for Ha-Ras–mediated transformation of intestinal epithelial cells.
J Biol Chem
2001
;
276
:
14498
–504.
39
Cui QL, Zheng WH, Quirion R, Almazan G. Inhibition of Src-like kinases reveals Akt-dependent and -independent pathways in insulin-like growth factor I-mediated oligodendrocyte progenitor survival.
J Biol Chem
2005
;
280
:
8918
–28.
40
Tanno S, Tanno S, Mitsuuchi Y, Altomare DA, Xiao GH, Testa JR. Akt activation up-regulates insulin-like growth factor I receptor expression and promotes invasiveness of human pancreatic cancer cells.
Cancer Res
2001
;
61
:
589
–93.
41
Chiu VK, Bivona T, Hach A, et al. Ras signalling on the endoplasmic reticulum and the Golgi.
Nat Cell Biol
2002
;
4
:
343
–50.
42
Ishizawar R, Parsons SJ. c-Src and cooperating partners in human cancer.
Cancer Cell
2004
;
6
:
209
–14.
43
Dehm SM, Bonham K. SRC gene expression in human cancer: the role of transcriptional activation.
Biochem Cell Biol
2004
;
82
:
263
–74.
44
Verbeek BS, Vroom TM, Adriaansen-Slot SS, et al. c-Src protein expression is increased in human breast cancer. An immunohistochemical and biochemical analysis.
J Pathol
1996
;
180
:
383
–8.
45
Biscardi JS, Ishizawar RC, Silva CM, Parsons SJ. Tyrosine kinase signalling in breast cancer: epidermal growth factor receptor and c-Src interactions in breast cancer.
Breast Cancer Res
2000
;
2
:
203
–10.
46
Rucci N, Recchia I, Angelucci A, et al. Inhibition of protein kinase c-Src reduces the incidence of breast cancer metastases and increases survival in mice. Implications for therapy.
J Pharmacol Exp Ther
2006
;
318
:
161
–72.
47
Shakespeare W, Yang M, Bohacek R, et al. Structure-based design of an osteoclast-selective, nonpeptide src homology 2 inhibitor with in vivo antiresorptive activity.
Proc Natl Acad Sci U S A
2000
;
97
:
9373
–8.
48
Jiang T, Qiu T. Interaction between Src and a C-terminal proline-rich motif of Akt is required for Akt activation.
J Biol Chem
2003
;
278
:
15789
–93.

Supplementary data