Previously, we have shown that the expression of Wnt-1–induced signaling protein-2 (WISP-2), also known as CCN5, can be regulated by multiple stimulants in estrogen receptor (ER)–positive breast tumor cells to exert their mitogenic action in these cells. Here, we show that insulin-like growth factor-1 (IGF-1), a strong mitogen, enhanced the expression of the WISP-2/CCN5 gene parallel with the induction of proliferation of ER-positive breast tumor cells. An additive effect was also seen in combination with estrogen. Perturbation of IGF-1–induced WISP-2/CCN5 expression by WISP-2–specific RNA interference impaired the mitogenic action of IGF-1 on ER-positive breast tumor cells. Furthermore, the studies have shown that the multiple molecular cross-talks and side-talks among IGF-1R, ER-α, and phosphatidylinositol 3-kinase (PI3K)/Akt signaling molecules are required to induce WISP-2/CCN5 mRNA by IGF-1 in ER-positive, noninvasive breast tumor cells. Because a pure anti-ER ICI 182,780 is not only able to suppress the up-regulation of WISP-2/CCN5 mRNA expression by IGF-1, it also suppresses the PI3K/Akt activity induced by IGF-1 in MCF-7 cells; we anticipate that the membrane ER receptor may participate in this event. Collectively, these studies propose for the first time that WISP-2/CCN5 is an integral signaling molecule in mitogenic action of IGF-1 axis in ER-positive human breast tumor cells. [Cancer Res 2007;67(4):1520–6]

Wnt-1–induced signaling protein-2 (WISP-2), also known as CCN5, has been identified as a member of the CCN (connective tissue growth factor/cysteine-rich 61/nephroblastoma overexpressed) family of growth factors (1, 2). It has been implicated as having an important role in carcinogenesis (3). Multiple studies, from our laboratory and others, have shown that steroid hormones (i.e., estrogen and progesterone), serum, epidermal growth factor (EGF), and phorbol esters exhibit an inductive role in WISP-2/CCN5 gene expression in breast cancer cell lines (47). Evidently, this induction is crucial for serum- or EGF-induced, estrogen receptor (ER)–positive breast tumor cell proliferation (4, 6). Moreover, WISP-2/CCN5 is expressed in early stages of breast tumors, and its expression is correlated with ER status (4). Collectively, these emerging evidences suggest that WISP-2/CCN5 signaling might have particular relevance in the early wave of the development of human breast cancer (4, 6).

The insulin-like growth factor-1 (IGF-1; somatomedin) is a circulating polypeptide growth factor of ∼7.5 kDa in size (8) and with insulin-like activity (9). This growth factor is an increasing focus in breast cancer research because higher levels of circulating “free” IGF-1 may increase breast cancer risk in premenopausal women (10), and its action is detected in all stages of human breast tumors (11). IGF-1 plays a critical role in breast tumor cell proliferation, differentiation, and survival (12) as well as in carcinogenesis through the modulation of multiple events including inhibition of apoptotic cell death (11, 13, 14). Most of the physiologic as well as pathophysiologic effects of IGF-I are transmitted via the type-I IGF receptor (IGF-R1; refs. 15, 16), a marker for the regulation of breast tumor growth (17, 18). IGF-1 is considered the strongest potential growth stimulator among the growth factors responsible for mitogenic responses in estrogen-dependent human breast cancer and breast tumor cell lines (19, 20) but not the ER-negative breast tumor cell lines (21). The mitogenic potential of IGF-1 in ER-positive cells can be augmented by estrogen through its receptor (2225), and it can be blocked by an estrogen antagonist without inhibiting IGF-1 signaling (22, 26). A high percentage of IGF-R1 expression is detected in primary breast tumor samples, and this expression is positively correlated with ER status (27). Animal studies support the consequence of IGF-1 signaling in the pathogenesis of ER-positive breast cancer. They show significantly less growth of ER-positive MCF-7 xenograft tumors in nude mice that lack circulating IGF-1 (28). Together, these studies suggest that there could be a unique interacting or modulating signaling intermediate in ER-positive breast tumor cells whose activation by the IGF-1/IGF-R1/ER-α axis is mandatory for the IGF-1–induced mitogenic switch in these cells. However, this common “switchman” has not yet been identified. Thus, the goal of the present study was to find out whether WISP-2/CCN5 is the candidate molecule in IGF-1 signaling pathway.

Here, we present evidence that WISP-2/CCN5 signaling is critical for IGF-1 mitogenesis. In particular, studies show that WISP-2/CCN5 mRNA expression is increased by the IGF-1 axis in a dose- and time-dependent manner to produce mitogenic response in ER-positive breast tumor cells. The activation of mitogenesis by IGF-1-WISP-2 circuitry is mediated by multiple molecular side-talks and cross-talks.

Reagents. IGF-1, 17β-estradiol (17β-E2), wortmannin, and anti-actin were obtained from Sigma Chemical (St. Louis, MO). U0126 was obtained from Promega Corp. (Madison, WI). PCR kits were obtained from Perkin-Elmer (Foster City, CA). Biolase DNA polymerase and Trizol were obtained from Bioline (Randolph, MA) and Life Technologies (Grand Island, NY) respectively. IGF-1R inhibitor, Tyrphostin AG1024 was obtained from Alexis Biochemicals (San Diego, CA). Antiestrogen ICI 182,780 was obtained from Tocris (Ellisville, MO). Rabbit polyclonal anti-Akt and anti–phosphorylated Akt polyclonal antibodies were obtained from Cell Signaling (Beverly, MA). Digoxigenin high prime DNA labeling and detection kit and cell proliferation bromodeoxyuridine (BrdUrd) ELISA kit was obtained from Roche Diagnostics GmbH (Indianapolis, IN). All other chemicals from commercial sources were of the highest purity available.

Cell lines and culture conditions. Human breast tumor–derived, noninvasive, ER-positive cell lines (i.e., MCF-7 and ZR-75-1) and invasive, ER-negative cell line (MDA-MB-231) were obtained from the American Type Culture Collection (Manassas, VA). These cells were grown in DMEM (Sigma Chemical) supplemented with 1 mmol/L sodium pyruvate (Sigma Chemical), 10% fetal bovine serum (HyClone, Road Logan, UT), 2 mmol/L glutamine, 100 units/mL penicillin, and 100 units Streptomycin (Sigma Chemical) in a 37°C, 5% CO2 and 95% air. In each experiment, cells were initially grown in complete media until the culture became ∼70% confluent. The cells were then grown in serum and phenol red–free media for 72 h to reach estrogen- and growth factor–free environment. The deprived cells were exposed to stimulants or inhibitors or both as per the requirements of the experiments.

BrdUrd incorporation assay. The BrdUrd cell proliferation assay was done according to manufacturer's instructions (Roche Diagnostics) with some modifications. Briefly, cells were pulsed with BrdUrd labeling reagent overnight followed by fixation in FixDenat solution for 30 min at room temperature. Cells were then incubated with anti–BrdUrd-POD (1:100 dilutions) for 90 min at room temperature. Finally, the cells were incubated in substrate solution at room temperature, and proliferation was assessed by colorimetric detection.

RNA extraction, cDNA synthesis, PCR amplification, and probe synthesis. Cytoplasmic RNA was extracted from cells using Trizol (Life Technologies), and the extraction procedure was as described previously (29). cDNA preparation, the sequences of primers, reverse transcription-PCR analysis, and nonradioactive digoxigenin labeling and probe synthesis were done essentially same as reported (6, 30).

Northern hybridization. The nonradioactive Northern blot analysis was done according to our previous method (6). Briefly, 10 μg of total RNA was fractionated by electrophoresis in 1% agarose gels containing formaldehyde and was transferred to a super charged nylon membrane (Schleicher and Schuell, Keene, NH). Membranes were hybridized with digoxigenin-labeled WISP-2/CCN5 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene–specific probe. Relative expressions of WISP-2/CCN5 mRNAs were calculated by densitometric analysis using a one-dimensional image analysis software (Kodak Image Station, version 3.6). The signal intensity of WISP-2/CCN5 bands was normalized to the results obtained with GAPDH bands.

Total cell protein extraction and Western immunoblot analysis. Total cell protein extraction and Western immunoblotting were carried out as described previously (6). Briefly, the cells were incubated in cell lysis buffer [10 mmol/L Tris-HCl (pH 6.8), 0.4 mmol/L EDTA, 1% SDS, 10 mmol/L sodium fluoride, 0.4 mmol/L sodium orthovanadate, 10 mmol/L sodium pyrophosphate, 1 mmol/L phenylmethylsulfonyl fluoride, 1 μg/mL leupeptin, and 1 μg/mL aprotinin] for 30 min at 4°C followed by centrifugation for 60 min at 4°C. Supernatants were collected as total cell protein extracts, and protein concentrations were measured by Coomasie blue detection method. Equal amounts of total cell extracts were separated by SDS-PAGE and transformed to nitrocellulose membranes. Membranes were blocked with super block (Pierce, Rockford, IL) followed by incubation with appropriate primary antibodies overnight at 4°C. Protein bands were detected by enhanced chemiluminescence kit (Pierce), and the intensity of the band was measured by densitometric analysis using a one-dimensional image analysis software (version 3.6).

Short hairpin RNA synthesis, cloning, and transfection of cells. WISP-2/CCN5–specific, double-stranded short hairpin RNAs (shRNA) or mismatched shRNA were designed and synthesized according to our previous method (6) or obtained from Ambion, Inc. (Austin, TX). Briefly, oligonucleotides were annealed, and cloned into the pSilencer 1.0-U6 shRNA expression vector. The positive clones were confirmed by PCR amplification using a gene-specific forward primer and the T3 promoter primer. The sequences of the shRNA are given in Table 1.

Table 1.

WISP-2 shRNA sequences used in this study (vector: pSilencer 1.0-U6)

shRNASequences (5′-3′)Source
shRNA1 Sense: GACCCACCTCCTGGCCTTCTTCAAGAGAGAAGGCCAGGAGGTGGGTCTTTTTT Personal 
 Antisense: AATTAAAAAAGACCCACCTCCTGGCCTTCTCTCTTGAAGAAGGCCAGGAGGTGGGTCGGCC  
shRNA2 Sense: GGCACACAGAGATTCTGGATTCAAGAGATCCAGAATCTCTGTGTGCCTTTTTT Ambion (ID#4918) 
 Antisense: AATTAAAAAAGGCACACAGAGATTCTGGATCTCTTGAATCCAGAATCTCTGTGTGCCGGCC  
shRNA3 Sense: GGCAACACTTTAGCTTGGGTTCAAGAGACCCAAGCTAAAGTGTTGCCTGTTTTTT Ambion (ID#4824) 
 Antisense: AATTAAAAAACAGGCAACACTTTAGCTTGGGTCTCTTGAACCCAAGCTAAAGTGTTGCCGGCC  
shRNA4 Sense: GGGGGGCCCTGTGCCTCTTTTCAAGAGAAAGAGGCACAGGGCCCCCCTTTTTT Personal 
 Antisense: AATTAAAAAAGGGGGGCCCTGTGCCTCTTTCTCTTGAAAAGAGGCACAGGGCCCCCCGGCC  
Mismatch Sense: CTGCTAAATCCACTGTGATTCAAGAGAAGAGACAAGGCCAGAAAACTGTTTTTT  
 Antisense: AATTAAAAAACAGTTTTCTGGCCTTGTCTCTTCTCTTGAAAATCACAGTGGATTTAGCAGGGCC  
shRNASequences (5′-3′)Source
shRNA1 Sense: GACCCACCTCCTGGCCTTCTTCAAGAGAGAAGGCCAGGAGGTGGGTCTTTTTT Personal 
 Antisense: AATTAAAAAAGACCCACCTCCTGGCCTTCTCTCTTGAAGAAGGCCAGGAGGTGGGTCGGCC  
shRNA2 Sense: GGCACACAGAGATTCTGGATTCAAGAGATCCAGAATCTCTGTGTGCCTTTTTT Ambion (ID#4918) 
 Antisense: AATTAAAAAAGGCACACAGAGATTCTGGATCTCTTGAATCCAGAATCTCTGTGTGCCGGCC  
shRNA3 Sense: GGCAACACTTTAGCTTGGGTTCAAGAGACCCAAGCTAAAGTGTTGCCTGTTTTTT Ambion (ID#4824) 
 Antisense: AATTAAAAAACAGGCAACACTTTAGCTTGGGTCTCTTGAACCCAAGCTAAAGTGTTGCCGGCC  
shRNA4 Sense: GGGGGGCCCTGTGCCTCTTTTCAAGAGAAAGAGGCACAGGGCCCCCCTTTTTT Personal 
 Antisense: AATTAAAAAAGGGGGGCCCTGTGCCTCTTTCTCTTGAAAAGAGGCACAGGGCCCCCCGGCC  
Mismatch Sense: CTGCTAAATCCACTGTGATTCAAGAGAAGAGACAAGGCCAGAAAACTGTTTTTT  
 Antisense: AATTAAAAAACAGTTTTCTGGCCTTGTCTCTTCTCTTGAAAATCACAGTGGATTTAGCAGGGCC  

Breast tumor cells were transiently transfected with shRNAs using Lipofectin Plus reagent (Life Technologies) according to our previous method (4, 6). Briefly, ∼60% confluent cells were fed with Opti-MEM I (Invitrogen, Carlsbad, CA) for 1 to 2 days to eliminate the endogenous WISP-2/CCN5 protein; 10 μg shRNA constructs were transfected in cells with 1 mL Opti-MEM I containing Lipofectin for 24 h. The media were replaced with Lipofectin-free fresh Opti-MEM I with or without IGF-1 (100 ng/mL) for 24 h. Cells were harvested from 25-cm2 flasks to quantitate the RNA level of WISP-2/CCN5 and from 96-well plates assayed for cell proliferation using BrdUrd ELISA kit. Mismatched-transfected cells or parent cells were considered as controls.

Statistical analysis. BrdUrd cell proliferation studies were carried out in quadruplicate wells. WISP-2 mRNA level and bioactivity studies were repeated three to four times. Experiments for the detection of signaling intermediates were done in triplicate wells. Results are expressed as mean ± SE, and effects were compared with untreated control cells on the same plate or same experimental conditions. Paired Student's t tests were used to analyze the effect of stimulants and inhibitors. P < 0.05 was considered significant.

IGF-1 displays mitogenic effect on ER-positive breast cancer cell lines. To assess the mitogenic effect of IGF-1 on breast tumor cells, we used ER-positive cell lines (i.e., MCF-7 and ZR-75-1) and ER-negative cell line (MDA-MB-231) as experimental cellular models. Serum-starved cells were exposed to IGF-1 for distinct doses (i.e., 1, 10, and 100 ng/mL) for 24 h or distinct times (i.e., 24, 48, and 72 h) with a single dose (100 ng/mL) of IGF-1, and cell proliferation was evaluated using BrdUrd ELISA assay. As shown in Fig. 1A and B, IGF-1 exhibits mitogenic effect on ER-positive MCF-7 breast tumor cells in a dose- and time-dependent manner. The significant mitogenic effect of IGF-1 was detected by 1 ng/mL dose at 24 h, and the effect was increased along the increment of the dose and the treatment duration. The mitogenic effect of IGF-1 was also found in ZR-75-1 ER-positive breast tumor cells (Fig. 1A). However, this effect was undetected in ER-negative MDA-MB-231 cells (Fig. 1A). These findings are consistent with earlier studies (22, 31, 32).

Figure 1.

Effect of IGF-1 alone and combined effect of IGF-1 and 17β-E2 on breast tumor cell proliferation. A, equal numbers of cells were plated in each well of a 96-well plate and were cultured in DMEM containing 10% serum (dose-dependent effect). After attachment, the cells were serum starved for 3 days and treated with IGF-1 (1–100 ng/ml) for 24 h. Cellular proliferation in the control and the treated cultures were measured by colorimetric immunoassay based on BrdUrd incorporation into the cellular DNA. B, serum-starved MCF-7 cells were treated with IGF-1 (100 ng/mL) for indicated times, and cell proliferation was determined using BrdUrd ELISA (time-dependent effect). C, serum-starved cells were treated with IGF-1 (100 ng/mL) in the presence or absence of 17 β-E2 (10 nmol/L) for 24 h (combination effect). Cellular proliferations were measured by BrdUrd ELISA. Columns, mean absorbance (A370 nm) from three separate experiments; bars, SD. P was determined by Student's t test. *, P < 0.05; **, P < 0.01; ***, P < 0.001, versus control; #, P < 0.001, versus control; ns, nonsignificant.

Figure 1.

Effect of IGF-1 alone and combined effect of IGF-1 and 17β-E2 on breast tumor cell proliferation. A, equal numbers of cells were plated in each well of a 96-well plate and were cultured in DMEM containing 10% serum (dose-dependent effect). After attachment, the cells were serum starved for 3 days and treated with IGF-1 (1–100 ng/ml) for 24 h. Cellular proliferation in the control and the treated cultures were measured by colorimetric immunoassay based on BrdUrd incorporation into the cellular DNA. B, serum-starved MCF-7 cells were treated with IGF-1 (100 ng/mL) for indicated times, and cell proliferation was determined using BrdUrd ELISA (time-dependent effect). C, serum-starved cells were treated with IGF-1 (100 ng/mL) in the presence or absence of 17 β-E2 (10 nmol/L) for 24 h (combination effect). Cellular proliferations were measured by BrdUrd ELISA. Columns, mean absorbance (A370 nm) from three separate experiments; bars, SD. P was determined by Student's t test. *, P < 0.05; **, P < 0.01; ***, P < 0.001, versus control; #, P < 0.001, versus control; ns, nonsignificant.

Close modal

To explore whether IGF-1 and 17β-E2 could synergistically or additively enhance ER-positive breast tumor cell proliferation, serum-starved MCF-7, ZR-75-1, or MDA-MB-231 cells were exposed to IGF-1 (100 ng/mL) or 17β-E2 (10 nmol/L), or both stimuli for 24 h and assayed for cell proliferation. Consistent with previous findings (33), these studies show that the treatment of MCF-7 and ZR-75-1 cells with IGF-1 or 17β-E2 independently resulted in induction of cell proliferation (Fig. 1C). Combination treatment of MCF-7 cells or ZR-75-1 cells with IGF-1 and 17β-E2 exhibits an additive effect (i.e., combination effect of IGF-1 and 17β-E2 was equal or all most equal to the sum of the effect of each agent) on the proliferation (Fig. 1C) rather than synergistic as observed previously (33). This discrepancy could be due to the application of different detection techniques. The effect was undetected in MDA-MB-231 cells (Fig. 1C).

IGF-1 up-regulates WISP-2/CCN5 mRNA expression in a dose- and time-dependent manner in ER-positive breast carcinoma cells. To explore the involvement of WISP-2/CCN5 signaling in IGF-1 mitogenesis in ER-positive breast tumor cells, we first needed to determine if IGF-1 is able to modulate the expression of WISP-2/CCN5 expression in MCF-7 cells. To test this, serum-starved MCF-7 cells were exposed to different doses of IGF-1 (i.e. 1, 10, or 100 ng/mL) for 24 h, and mRNA levels were determined by Northern blot analysis. As revealed in Fig. 2A, the up-regulation of WISP-2/CCN5 mRNA expression by IGF-1 was recognized at a 10 ng/mL concentration, which was ∼2.5-fold higher than vehicle-treated control. The expression levels were elevated along with the augmentation of doses with the highest effect detected at a 100 ng/mL dose. We extended this study and determined the time course (i.e., up to 72 h) effect of IGF-1 on WISP-2/CCN5 mRNA expression in MCF-7 cells. WISP-2/CCN5 mRNA expression was amplified significantly at 2 h of exposure and gradually augmented as the time of exposure increased (Fig. 2B and C). Maximum induction was observed after 24 h of exposure. Together, these studies established that IGF-1 enhanced the WISP-2/CCN5 mRNA expression in MCF-7 noninvasive, ER-positive breast tumor cells, and this induction is dose and time dependent.

Figure 2.

Dose- and time-dependent effects of IGF-1 on WISP-2/CCN5 mRNA expression in MCF-7 cells. A to C, exponentially growing, ER-positive, noninvasive MCF-7 cells were serum starved for 3 d and exposed to different doses of IGF-1 for 24 h or IGF-1 (100 ng/mL) for different time points. Total RNA was extracted and analyzed by RNA blotting using nonradioactive digoxigenin-labeled, PCR-generated probes for WISP-2/CCN5 or GAPDH. Columns, means of three different experiments; bars, SD. *, P < 0.05; **, P < 0.01; ***, P < 0.002; ###, P < 0.001, versus control.

Figure 2.

Dose- and time-dependent effects of IGF-1 on WISP-2/CCN5 mRNA expression in MCF-7 cells. A to C, exponentially growing, ER-positive, noninvasive MCF-7 cells were serum starved for 3 d and exposed to different doses of IGF-1 for 24 h or IGF-1 (100 ng/mL) for different time points. Total RNA was extracted and analyzed by RNA blotting using nonradioactive digoxigenin-labeled, PCR-generated probes for WISP-2/CCN5 or GAPDH. Columns, means of three different experiments; bars, SD. *, P < 0.05; **, P < 0.01; ***, P < 0.002; ###, P < 0.001, versus control.

Close modal

Additive effect of IGF-1 on 17β-E2–induced WISP-2/CCN5 mRNA up-regulation. Consistent with previous works (3436), the present studies have shown a synergistic effect of IGF-1 and 17β-E2 on ER-positive MCF-7 cell proliferation; we tested whether IGF-1 and estrogen could synergistically activate WISP-2/CCN5 mRNA expression in MCF-7 cells. To test this, serum-starved cells were exposed to 100 ng/mL IGF-1 or 10 nmol/L E2 or both for 24 h. Total RNA was extracted and WISP-2/CCN5 mRNA level was measured. As expected from previous studies, WISP-2/CCN5 mRNA expression was significantly increased in 17β-E2– or IGF-1–treated cells, respectively, compared with the cells grown in serum-free medium (Fig. 3A). Combination treatment of MCF-7 cells with IGF-1 and 17β-E2 exert an additive effect on the activation of WISP-2/CCN5 mRNA expression (Fig. 3A).

Figure 3.

Additive effects of estrogen and IGF-1 and effect of IGF-1R and ER antagonists on IGF-1–induced WISP-2/CCN5 mRNA expression in MCF-7 cells. A, serum-starved MCF-7 cells were exposed to IGF-1 (100 ng/mL), or 17β-E2 (10 nmol/L) or a combination of IGF-1 and 17β-E2 for 24 h. Total RNA was extracted and analyzed by RNA blotting using nonradioactive, digoxigenin-labeled, PCR-generated probes for WISP-2/CCN5 or GAPDH. B and C, serum-starved MCF-7 cells were exposed to IGF-1 (100 ng/mL) alone or in combination with IGF-1R antagonist AG1024 (10 μmol/L) or pure antiestrogen ICI 182,780 (1 μmol/L) for 24 h. mRNA expression was evaluated by Northern blot analysis using WISP-2/CCN5– or GAPDH-specific nonradioactive digoxigenin-labeled probe. Columns, means of three different experiments; bars, SD. *, P < 0.05, versus control; **, P < 0.01, versus control; #, P < 0.05, versus IGF-1; ##, P < 0.05, versus IGF-1 + E2 treated; #, P < 0.01, versus control; ***, P < 0.001, IGF-1 treated.

Figure 3.

Additive effects of estrogen and IGF-1 and effect of IGF-1R and ER antagonists on IGF-1–induced WISP-2/CCN5 mRNA expression in MCF-7 cells. A, serum-starved MCF-7 cells were exposed to IGF-1 (100 ng/mL), or 17β-E2 (10 nmol/L) or a combination of IGF-1 and 17β-E2 for 24 h. Total RNA was extracted and analyzed by RNA blotting using nonradioactive, digoxigenin-labeled, PCR-generated probes for WISP-2/CCN5 or GAPDH. B and C, serum-starved MCF-7 cells were exposed to IGF-1 (100 ng/mL) alone or in combination with IGF-1R antagonist AG1024 (10 μmol/L) or pure antiestrogen ICI 182,780 (1 μmol/L) for 24 h. mRNA expression was evaluated by Northern blot analysis using WISP-2/CCN5– or GAPDH-specific nonradioactive digoxigenin-labeled probe. Columns, means of three different experiments; bars, SD. *, P < 0.05, versus control; **, P < 0.01, versus control; #, P < 0.05, versus IGF-1; ##, P < 0.05, versus IGF-1 + E2 treated; #, P < 0.01, versus control; ***, P < 0.001, IGF-1 treated.

Close modal

IGF-1–induced up-regulation of WISP-2/CCN5 mRNA expression is mediated via IGF-1R. To determine whether IGF-1R is required to up-regulate the WISP-2/CCN5 mRNA expression by IGF-1, we explored the effect of AG1024 (10 μmol/L), a selective IGF-1R inhibitor, on IGF-1 action. As shown in Fig. 3B, IGF-1 alone significantly elevated WISP-2/CCN5 mRNA levels in MCF-7 cells compared with untreated controls, while the cells were exposed to IGF-1 along with AG1024; the effect of IGF-1 reduces significantly. This result indicates that up-regulation of WISP-2/CCN5 gene expression by IGF-1 is IGF-1R mediated in MCF-7 cells.

Inhibition of IGF-1–induced up-regulation of WISP-2/CCN5 mRNA expression by a pure anti-ER. It is a well-established phenomenon that the molecular cross-talk between peptide growth factors and ER signaling is required to regulate some growth factor–dependent genes (6, 37, 38). Thus, we anticipated that similar molecular cross-talk could be allied in IGF-1–induced regulation of WISP-2/CCN5 expression in ER-positive breast tumor cells. To clarify this, starved MCF-7 cells were exposed to IGF-1 (100 ng/mL) alone or in combination with a pure ER antagonist, ICI 182,780 (1 μmol/L), for 24 h followed by evaluation of WISP-2/CCN5 mRNA levels using Northern blot analysis. As shown in Fig. 3C, IGF-1 alone amplified WISP-2/CCN5 mRNA expression in MCF-7 cells by severalfold compared with unexposed one, and this stimulation can be reduced to the basal level or less by ICI 182,780. However, ICI 182,780 alone has no effect on WISP-2/CCN5 expression. Therefore, this study strongly suggests that the participation of ER is crucial for up-regulation of WISP-2/CCN5 mRNA in MCF-7 by IGF-1.

Involvement of phosphatidylinositol 3-kinase in IGF-1–induced WISP-2/CCN5 up-regulation. To find out the involvement of signaling molecule(s) in IGF-1–induced WISP-2/CCN5 up-regulation, we exposed cells to wortmannin (100 nmol/L), a phosphatidylinositol 3-kinase (PI3K)/Akt inhibitor or U0126 (10 μmol/L), a mitogen-activated protein kinase (MAPK) kinase/extracellular-regulated kinase inhibitor, for 30 min before IGF-1 exposure for 24 h. As shown in Fig. 4A, wortmannin was able to inhibit IGF-1–induced up-regulation of WISP-2/CCN5 expression, whereas the inhibitory effect of U0126 was undetected. This study, therefore, suggests that the PI3K signaling pathway is involved in IGF-1 action on the transcriptional regulation of the WISP-2/CCN5 gene. Next, we needed to determine whether ER signaling pathways are crucial in PI3K activation by IGF-1. To obtain this information, MCF-7 cells were exposed to either IGF-1 (100 ng/mL) or IGF-1 in combination with ICI 182,780 (1 μmol/L) for 30 and 60 min, and PI3K activity was determined by measuring total and phosphorylated PI3K/Akt (pPI3K/Akt) protein in MCF-7 cells. As shown in Fig. 4B, co–short exposure of IGF-1 and ICI 182, 780 resulted in markedly decreased PI3K/Akt activity compared with IGF-1–exposed MCF-7 cells. Activity of pPI3K/Akt was almost undetected in 10 μg of untreated protein samples when run in PAGE for immunodetection. The activity of PI3K/Akt increased severalfold in MCF-7 cells when exposed to IGF-1, and this induced activity was blocked almost to the basal level by ICI 182,780 when exposed concomitantly for 60 min. No significant changes were detected in ICI 182, 780–exposed cells (data not shown). Thus, this study clearly shows that a side-talk between IGF-1/IGF-1R and unliganded ER signaling (possibly membrane associated) is necessary for the activation of PI3K signaling by IGF-1, which eventually enhances the WISP-2/CCN5 expression.

Figure 4.

Effects of PI3K and MAPK inhibitors on IGF-1–induced up-regulation of WISP-2/CCN5 mRNA and detection of Akt activity in IGF-1– and ICI 182,780–exposed MCF-7 cells. A, starved cells were incubated with or without 100 nmol/L wortmannin (PI3K/Akt inhibitor) and 10 μmol/L U0126 (MAPK/ERK inhibitor) for 30 min before being incubated with or without IGF-1 (100 ng/mL) for 24 h. The blot was probed with digoxigenin-labeled, PCR-generated WISP-2/CCN5 and GAPDH. Columns, mean WISP-2/CCN5 and GAPDH ratio from three different experiments; bars, SD. **, P < 0.01, versus IGF-1 treated; ***, P < 0.001, versus untreated control. B, starved cells were incubated IGF-1 (100 ng/mL) alone or in combination with ICI 182,780 (1 μmol/L) for 30 and 60 min. Proteins were extracted from semiconfluent cells, and 10 μg proteins were loaded for Western immunobloting. Total Akt and phosphorylated Akt (p-Akt) was detected by chemiluminescent immunobloting using polyclonal anti-rabbit Akt antibody and phosphorylated Akt–specific polyclonal antibody, respectively.

Figure 4.

Effects of PI3K and MAPK inhibitors on IGF-1–induced up-regulation of WISP-2/CCN5 mRNA and detection of Akt activity in IGF-1– and ICI 182,780–exposed MCF-7 cells. A, starved cells were incubated with or without 100 nmol/L wortmannin (PI3K/Akt inhibitor) and 10 μmol/L U0126 (MAPK/ERK inhibitor) for 30 min before being incubated with or without IGF-1 (100 ng/mL) for 24 h. The blot was probed with digoxigenin-labeled, PCR-generated WISP-2/CCN5 and GAPDH. Columns, mean WISP-2/CCN5 and GAPDH ratio from three different experiments; bars, SD. **, P < 0.01, versus IGF-1 treated; ***, P < 0.001, versus untreated control. B, starved cells were incubated IGF-1 (100 ng/mL) alone or in combination with ICI 182,780 (1 μmol/L) for 30 and 60 min. Proteins were extracted from semiconfluent cells, and 10 μg proteins were loaded for Western immunobloting. Total Akt and phosphorylated Akt (p-Akt) was detected by chemiluminescent immunobloting using polyclonal anti-rabbit Akt antibody and phosphorylated Akt–specific polyclonal antibody, respectively.

Close modal

WISP-2/CCN5 is required for IGF-1–induced ER-positive breast tumor cell proliferation. Given the observed effect of IGF-1 on WISP-2/CCN5, we hypothesized that WISP-2/CCN5 signaling may contribute ER-positive breast tumor cell proliferation. To ascertain this, first, MCF-7 cells were transiently transfected with pSilencer vectors containing WISP-2–specific shRNA or mismatch sequence, and WISP-2/CCN5 mRNA levels were evaluated in WISP-2/CCN5–transfected and nontransfected cells. As shown Fig. 5A, the WISP-2/CCN5–specific shRNAs (i.e., shRNA1, shRNA2, shRNA3, and shRNA4) inhibits effectively the expression of WISP-2/CCN5 in MCF-7 cells, whereas mismatched shRNA were unable to block the WISP-2/CCN5 expression in these cells. After the confirmation of the efficacy of the shRNAs, we selected shRNA4 for subsequent studies.

Figure 5.

IGF-1–induced WISP-2/CCN5 mRNA expression and cellular proliferation are suppressed by WISP-2/CCN5 shRNA. A, ∼70% confluent MCF-7 were grown in Opti-MEM I for 1 to 2 d and then transfected with WISP-2/CCN5 shRNAs (i.e., shRNA1, shRNA2, shRNA3, and shRNA4) or mismatch shRNA for 24 h, and WISP-2/CCN5 mRNA levels were determined using Northern blot analysis. B, the MCF-7 cells were transfected with shRNA4 for 24 h and incubated with IGF-1 (100 ng/mL) for 24 h, and WISP-2/CCN5 mRNA expression and cellular proliferation were determined using Northern blot analysis (top right) and BrdUrd ELISA (bottom left), respectively. Mismatched vector transfected cultures were considered as control. Columns, mean absorbance (A370 nm) from three separate experiments; bars, SD. P was determined by Student's t test. *, P < 0.001, versus vector transfected control; **, P < 0.001, versus IGF-1 treated.

Figure 5.

IGF-1–induced WISP-2/CCN5 mRNA expression and cellular proliferation are suppressed by WISP-2/CCN5 shRNA. A, ∼70% confluent MCF-7 were grown in Opti-MEM I for 1 to 2 d and then transfected with WISP-2/CCN5 shRNAs (i.e., shRNA1, shRNA2, shRNA3, and shRNA4) or mismatch shRNA for 24 h, and WISP-2/CCN5 mRNA levels were determined using Northern blot analysis. B, the MCF-7 cells were transfected with shRNA4 for 24 h and incubated with IGF-1 (100 ng/mL) for 24 h, and WISP-2/CCN5 mRNA expression and cellular proliferation were determined using Northern blot analysis (top right) and BrdUrd ELISA (bottom left), respectively. Mismatched vector transfected cultures were considered as control. Columns, mean absorbance (A370 nm) from three separate experiments; bars, SD. P was determined by Student's t test. *, P < 0.001, versus vector transfected control; **, P < 0.001, versus IGF-1 treated.

Close modal

Next, WISP-2/CCN5-shRNA4 or mismatch-shRNA transiently transfected cells were grown in serum-free medium with or without IGF-1 (100 ng/mL) in T-flask or 96-well plates for 24 h and assayed for WISP-2 mRNA expression and cell proliferation using Northern blot and BrdUrd ELISA, respectively. As shown in Fig. 5B, shRNA4-mediated inhibition of WISP-2/CCN5 mRNA expression in MCF-7 cells (top) resulted in significant inhibition of IGF-1–induced cell proliferation (bottom). Thus, shRNA experiments indicate that the mitogenic ability of IGF-1 is mediated by WISP-2/CCN5 signaling.

A large number of studies over the last decade have revealed the association of IGF-1–regulatory circuitry with mitogenesis and carcinogenesis of breast tissue (35, 3943). These studies have shown that IGF-1 enhances the growth of ER-positive breast cancer cells (31, 39), and acquisition of the malignant phenotype in the breast is initially dependent on IGF-IR signals (39). Moreover, accumulating evidence suggests that IGF-1 actions are entwined with estrogen/ER axis because the active participation of ER-α in IGF-1 action is needed (21, 44), and both IGF-1 and estrogen have been shown to share the common molecular signaling pathways to exert their biological or pathobiological actions in combination or alone (43). However, the defined mechanism of why and how IGF-1 action is entwined with the estrogen/ER axis has not yet been fully elucidated. The present studies provide evidence indicating a novel modulating role of IGF-1–induced WISP-2/CCN5 in mitogenic switch that is activated by IGF-1 signaling through an ER-α–dependent pathway in breast tumor cells.

Previously, we have shown that WISP-2/CCN5 is an important signaling intermediate in ER-positive breast tumor cells. Its expression is not only increased by steroid hormones or growth factors, but its enhanced expression is also required for cell proliferation induced by stimulants such as serum and EGF (46, 29, 45). Given the importance of WISP-2/CCN5, we assumed that monitoring the WISP-2/CCN5 expression and its functional role in IGF-1 exposed breast tumor cells might reveal a previously unidentified mechanism associated with IGF-1–induced mitogenesis. To explore this, we first determined the effect of IGF-1 alone or in combination with 17β-E2 on ER-positive and ER-negative breast tumor cell proliferation. We found that IGF-1 significantly enhanced the proliferation of ER-positive MCF-7 and ZR-75-1 human breast tumor cells in a dose- and time-dependent manner (Fig. 1A and B). Addition of 17β-E2 with IGF-1 enhances this proliferation in an additive fashion (Fig. 1C). The similar effect of IGF-1 was undetected in ER-negative MDA-MB-231 breast tumor cells (Fig. 1C). Therefore, consistent with the previous perception (21, 22, 31, 32, 34, 37, 44, 46), our studies suggest that the mitogenic switch in breast cancer cells by the IGF-1 axis may mediate through ER-α.

Why and how does IGF-1 exert its mitogenic action on ER-positive breast tumor cells? And why is the induction of breast cancer cell proliferation by IGF-1/ER-α dependent? The answers to these complex issues may be provided from the WISP-2/CCN5 mRNA expression profile of breast tumor cells treated with IGF-1 alone (Figs. 1 and 2) or in combination with estrogen (Fig. 1C and Fig. 3A) or their inhibitors (Fig. 3B and C and Fig. 4) and from its functional study. We found that WISP-2/CCN5, which only expresses in ER-positive breast tumor cells (6) and participates in serum- and growth factor–induced cell proliferation (4, 6), is activated transcriptionally by IGF-1 in a dose- and time-dependent fashion. This induction can be augmented by estrogen in a synergistic manner and can be repressed by both IGF-1 and estrogen antagonists (Fig. 1C and Fig. 3). Furthermore, targeted down-regulation of WISP-2/CCN5 transcription by an RNA interference approach results in perturbation of mitogenic action of IGF-1 in ER-positive breast tumor cells (Fig. 5). Together, these studies not only explain the above issues; these findings also likely enlighten why IGF-1 does not exert mitogenic effect on MDA-MB-231 cells (21). However, further studies are warranted to confirm the perception.

IGF-1 has been shown to activate several different intracellular pathways, including MAPK and PI3K signaling pathways, for its mitogenic action (47, 48). Under our experimental conditions, only wortmannin, a PI3K inhibitor, is able to perturb the IGF-1 action on WISP-2/CCN5 expression (Fig. 4). Thus, this study clearly suggests that transcriptional regulation of WISP-2/CCN5 by IGF-1 is mediated through the PI3K signaling pathway. As there is inconsistency regarding IGF-1 action on MAPK pathway with the previous report (49), this study implies that a cross-talk of intracellular signals may be involved in IGF-1/IGF-1R–mediated activation of a gene associated with breast tumor cell proliferation.

Earlier, several lines of evidences established the importance of ER-α signaling in the IGF-1 axis–mediated mitogenic signal in uterus and in breast tumor cells (21, 43, 44, 50). Here, we report the findings supporting the previous works and indicate that IGF-1 promotes activation of WISP-2/CCN5 signaling pathway in breast tumor cells through the molecular cross-talking with ER-α via PI3K-dependent fashion. Because a pure estrogen antagonist is capable of blocking the activation of PI3K by IGF-1 (Fig. 4B), it is reasonable to anticipate that the unbound membrane ER is involved in activation of the WISP-2/CCN5 signaling pathway for mitogenic switch in breast tumor cells.

In summary, our data provide the first evidence of the regulation of WISP-2/CCN5 signaling by the IGF-1 axis and explored why and how the IGF-1 axis promotes mitogenic signal in ER-α–positive breast cells.

Note: K. Dhar and S. Banerjee equally contributed to this work.

Grant support: VA Merit Review grant (S.K. Banerjee), NIH/National Cancer Institute grant CA87680 (S.K. Banerjee), Midwest Biomedical Research Foundation grant (S. Banerjee), NIH COBRE award 1 P20 RR15563 (S. Banerjee), and matching support from the State of Kansas.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Pennica D, Swanson TA, Welsh JW, et al. WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors.
Proc Natl Acad Sci U S A
1998
;
95
:
14717
–22.
2
Brigstock DR. The connective tissue growth factor/cysteine-rich 61/nephroblastoma overexpressed (CCN) family.
Endocr Rev
1999
;
20
:
189
–206.
3
Moussad EE, Brigstock DR. Connective tissue growth factor: what's in a name?
Mol Genet Metab
2000
;
71
:
276
–92.
4
Banerjee S, Saxena N, Sengupta K, Tawfik O, Mayo MS, Banerjee SK. WISP-2 gene in human breast cancer: estrogen and progesterone inducible expression and regulation of tumor cell proliferation.
Neoplasia
2003
;
5
:
63
–73.
5
Ray G, Banerjee S, Saxena NK, Campbell DR, Van VP, Banerjee SK. Stimulation of MCF-7 tumor progression in athymic nude mice by 17beta-estradiol induces WISP-2/CCN5 expression in xenografts: a novel signaling molecule in hormonal carcinogenesis.
Oncol Rep
2005
;
13
:
445
–8.
6
Banerjee S, Sengupta K, Saxena NK, Dhar K, Banerjee SK. Epidermal growth factor induces WISP-2/CCN5 expression in estrogen receptor-{alpha}-positive breast tumor cells through multiple molecular cross-talks.
Mol Cancer Res
2005
;
3
:
151
–62.
7
Sengupta K, Banerjee S, Dhar K, et al. WISP-2/CCN5 is involved as a novel signaling intermediate in phorbol ester-protein kinase Ca-mediated breast tumor cell proliferation.
Biochemistry
2006
;
45
:
10698
–709.
8
Rechler M, Nissley S. Insulin-like growth factors. In: Sporn M, Roberts A, editors. Peptic growth factors and their receptors. Berlin: Springer-Verlag; 1990. p. 263–346.
9
Froesch ER, Schmid C, Schwander J, Zapf J. Actions of insulin-like growth factors.
Annu Rev Physiol
1985
;
47
:
443
–67.
10
Banerjee SK, Islam A, Banerjee S. The regulatory roles of estrogen in carcinogenesis: an overview. In: Preuss HG, Bagchi D, editors. Phytopharmaceuticals in cancer chemoprevention. Boca Raton (FL): CRC Press; 2005. p. 105–21.
11
Yee D. The insulin-like growth factor system as a target in breast cancer.
Breast Cancer Res Treat
1994
;
32
:
85
–95.
12
Umayahara Y, Kawamori R, Watada H, et al. Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1 enhancer.
J Biol Chem
1994
;
269
:
16433
–42.
13
Pollak M, Beamer W, Zhang JC. Insulin-like growth factors and prostate cancer.
Cancer Metastasis Rev
1998
;
17
:
383
–90.
14
Manousos O, Souglakos J, Bosetti C, et al. IGF-I and IGF-II in relation to colorectal cancer.
Int J Cancer
1999
;
83
:
15
–7.
15
LeRoith D, Werner H, Beitner-Johnson D, Roberts CT, Jr. Molecular and cellular aspects of the insulin-like growth factor I receptor.
Endocr Rev
1995
;
16
:
143
–63.
16
Jones JI, Clemmons DR. Insulin-like growth factors and their binding proteins: biological actions.
Endocr Rev
1995
;
16
:
3
–34.
17
Peyrat JP, Bonneterre J, Laurent JC, et al. Presence and characterization of insulin-like growth factor 1 receptors in human benign breast disease.
Eur J Cancer Clin Oncol
1988
;
24
:
1425
–31.
18
Surmacz E. Function of the IGF-I receptor in breast cancer.
J Mammary Gland Biol Neoplasia
2000
;
5
:
95
–105.
19
Karey KP, Sirbasku DA. Differential responsiveness of human breast cancer cell lines MCF-7 and T47D to growth factors and 17 beta-estradiol.
Cancer Res
1988
;
48
:
4083
–92.
20
Ellis MJ. The insulin-like growth factor network and breast cancer. In: Bowcock AM, editor. Breast cancer. New York: Humana; 1999. p. 121–41.
21
Bartucci M, Morelli C, Mauro L, Ando' S, Surmacz E. Differential insulin-like growth factor I receptor signaling and function in estrogen receptor (ER)-positive MCF-7 and ER-negative MDA-MB-231 breast cancer cells.
Cancer Res
2001
;
61
:
6747
–54.
22
Varma H, Conrad SE. Antiestrogen ICI 182,780 decreases proliferation of insulin-like growth factor I (IGF-I)-treated MCF-7 cells without inhibiting IGF-I signaling.
Cancer Res
2002
;
62
:
3985
–91.
23
Lee AV, Jackson JG, Gooch JL, et al. Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo.
Mol Endocrinol
1999
;
13
:
787
–96.
24
Mauro L, Salerno M, Panno ML, et al. Estradiol increases IRS-1 gene expression and insulin signaling in breast cancer cells.
Biochem Biophys Res Commun
2001
;
288
:
685
–9.
25
Sachdev D, Yee D. The IGF system and breast cancer.
Endocr Relat Cancer
2001
;
8
:
197
–209.
26
Vignon F, Bouton MM, Rochefort H. Antiestrogens inhibit the mitogenic effect of growth factors on breast cancer cells in the total absence of estrogens.
Biochem Biophys Res Commun
1987
;
146
:
1502
–8.
27
Peyrat JP, Bonneterre J. Type 1 IGF receptor in human breast diseases.
Breast Cancer Res Treat
1992
;
22
:
59
–67.
28
Yang XF, Beamer WG, Huynh H, Pollak M. Reduced growth of human breast cancer xenografts in hosts homozygous for the lit mutation.
Cancer Res
1996
;
56
:
1509
–11.
29
Zoubine MN, Banerjee S, Saxena NK, Campbell DR, Banerjee SK. WISP-2: a serum-inducible gene differentially expressed in human normal breast epithelial cells and in MCF-7 breast tumor cells.
Biochem Biophys Res Commun
2001
;
282
:
421
–5.
30
Sengupta K, Banerjee S, Saxena NK, Banerjee SK. Thombospondin-1 disrupts estrogen-induced endothelial cell proliferation and migration and its expression is suppressed by estradiol.
Mol Cancer Res
2004
;
2
:
150
–8.
31
Dupont J, Le RD. Insulin-like growth factor 1 and oestradiol promote cell proliferation of MCF-7 breast cancer cells: new insights into their synergistic effects.
Mol Pathol
2001
;
54
:
149
–54.
32
Morelli C, Garofalo C, Bartucci M, Surmacz E. Estrogen receptor-alpha regulates the degradation of insulin receptor substrates 1 and 2 in breast cancer cells.
Oncogene
2003
;
22
:
4007
–16.
33
Dupont J, Karas M, LeRoith D. The potentiation of estrogen on insulin-like growth factor I action in MCF-7 human breast cancer cells includes cell cycle components.
J Biol Chem
2000
;
275
:
35893
–901.
34
Katzenellenbogen BS. Estrogen receptors: bioactivities and interactions with cell signaling pathways.
Biol Reprod
1996
;
54
:
287
–93.
35
Baserga R, Sell C, Porcu P, Rubini M. The role of the IGF-I receptor in the growth and transformation of mammalian cells.
Cell Prolif
1994
;
27
:
63
–71.
36
Cohen FJ, Manni A, Glikman P, Bartholomew M, Demers L. Interactions between growth factor secretion and polyamines in MCF-7 breast cancer cells.
Eur J Cancer
1990
;
26
:
603
–8.
37
Smith CL. Cross-talk between peptide growth factor and estrogen receptor signaling pathways.
Biol Reprod
1998
;
58
:
627
–32.
38
Zhang S, Li X, Burghardt R, Smith R III, Safe SH. Role of estrogen receptor (ER) alpha in insulin-like growth factor (IGF)-I-induced responses in MCF-7 breast cancer cells.
J Mol Endocrinol
2005
;
35
:
433
–47.
39
Sarfstein R, Maor S, Reizner N, Abramovitch S, Werner H. Transcriptional regulation of the insulin-like growth factor-I receptor gene in breast cancer.
Mol Cell Endocrinol
2006
;
27
:
241
–6.
40
Ahmad T, Farnie G, Bundred NJ, Anderson NG. The mitogenic action of insulin-like growth factor I in normal human mammary epithelial cells requires the epidermal growth factor receptor tyrosine kinase.
J Biol Chem
2004
;
279
:
1713
–9.
41
Lippman ME, Dickson RB, Gelmann EP, et al. Growth regulation of human breast carcinoma occurs through regulated growth factor secretion.
J Cell Biochem
1987
;
35
:
1
–16.
42
Mauro L, Salerno M, Morelli C, Boterberg T, Bracke ME, Surmacz E. Role of the IGF-I receptor in the regulation of cell-cell adhesion: implications in cancer development and progression.
J Cell Physiol
2003
;
194
:
108
–16.
43
Hamelers IH, Steenbergh PH. Interactions between estrogen and insulin-like growth factor signaling pathways in human breast tumor cells.
Endocr Relat Cancer
2003
;
10
:
331
–45.
44
Klotz DM, Hewitt SC, Ciana P, et al. Requirement of estrogen receptor-alpha in insulin-like growth factor-1 (IGF-1)-induced uterine responses and in vivo evidence for IGF-1/estrogen receptor cross-talk.
J Biol Chem
2002
;
277
:
8531
–7.
45
Saxena N, Banerjee S, Sengupta K, Zoubine MN, Banerjee SK. Differential expression of WISP-1 and WISP-2 genes in normal and transformed human breast cell lines.
Mol Cell Biochem
2001
;
228
:
99
–104.
46
Kahlert S, Nuedling S, van EM, Vetter H, Meyer R, Grohe C. Estrogen receptor alpha rapidly activates the IGF-1 receptor pathway.
J Biol Chem
2000
;
275
:
18447
–53.
47
Shepherd PR, Withers DJ, Siddle K. Phosphoinositide 3-kinase: the key switch mechanism in insulin signalling.
Biochem J
1998
;
333
:
471
–90.
48
White MF. The IRS-signalling system: a network of docking proteins that mediate insulin action.
Mol Cell Biochem
1998
;
182
:
3
–11.
49
Thordarson G, Slusher N, Leong H, et al. Insulin-like growth factor (IGF)-I obliterates the pregnancy-associated protection against mammary carcinogenesis in rats: evidence that IGF-I enhances cancer progression through estrogen receptor-alpha activation via the mitogen-activated protein kinase pathway.
Breast Cancer Res
2004
;
6
:
R423
–36.
50
Mauro L, Bartucci M, Morelli C, Ando' S, Surmacz E. IGF-I receptor-induced cell-cell adhesion of MCF-7 breast cancer cells requires the expression of junction protein ZO-1.
J Biol Chem
2001
;
276
:
39892
–7.