The phytochemical indole-3-carbinol (I3C), found in cruciferous vegetables, and its major acid-catalyzed reaction product 3,3′-diindolylmethane (DIM) showed anticancer activity mediated by its pleiotropic effects on cell cycle progression, apoptosis, carcinogen bioactivation, and DNA repair. To further elucidate the molecular mechanism(s) by which 3,3′-diindolylmethane exerts its effects on breast cancer cells, we have used microarray gene expression profiling analysis. We found a total of 1,238 genes altered in 3,3′-diindolylmethane-treated cells, among which 550 genes were down-regulated and 688 genes were up-regulated. Clustering analysis showed significant alterations in some genes that are critically involved in the regulation of cell growth, cell cycle, apoptosis, and signal transduction, including down-regulation of survivin. Previous studies have shown that antiapoptotic protein survivin is overexpressed in many human cancers, including breast cancer. However, very little or no information is available regarding the consequence of down-regulation of survivin for cancer therapy. We, therefore, hypothesized that down-regulation of survivin as observed by 3,3′-diindolylmethane could be an important approach for the treatment of breast cancer. We have tested our hypothesis using multiple molecular approaches and found that 3,3′-diindolylmethane inhibited cell growth and induced apoptosis in MDA-MB-231 breast cancer cells by down-regulating survivin, Bcl-2, and cdc25A expression and also caused up-regulation of p21WAF1 expression, which could be responsible for cell cycle arrest. Down-regulation of survivin by small interfering RNA before 3,3′-diindolylmethane treatment resulted in enhanced cell growth inhibition and apoptosis, whereas overexpression of survivin by cDNA transfection abrogated 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis. These results suggest that targeting survivin by 3,3′-diindolylmethane could be a new and novel approach for the prevention and/or treatment of breast cancer. (Cancer Res 2006; 66(9): 4952-60)

Breast cancer is the second leading cause of cancer-related deaths in women in the United States (1), suggesting that early diagnosis and prevention of this disease is urgently needed. Currently, breast cancer is treated with surgery, chemotherapy, and radiation therapy or combined modalities with remarkable success. In addition, patients with breast cancer or preneoplastic lesions are also treated with hormonal therapy either for treatment or prevention purposes. Although these treatment modalities are successful, a significant number of patients either do not respond to therapy, or the tumor may recur during therapy and develop metastasis, for which there is limited curative therapy. This inadequate outcome strongly suggests that the evaluation of novel targeted therapeutic agents is urgently needed to improve the treatment outcome of patients diagnosed with this disease.

It has been well known that many genes play important roles in the control of cell growth, differentiation, apoptosis, inflammation, stress response, and many other physiologic processes (210). Among those genes, survivin, a member of the inhibitor of apoptosis protein (IAP) family, plays important roles in tumorigenesis, progression of breast carcinoma, cell invasion, metastasis, and resistance to chemotherapy (1015). Several studies have suggested that the antiapoptotic protein survivin is overexpressed in many human cancers, including breast cancer (9, 10). It has also been shown that expression of survivin is associated with cancer cell viability and drug resistance (16). Previous studies in determining the association of survivin with prognosis in breast cancer patients has been controversial (17); thus, the clinical importance of survivin expression remains unclear in patients with breast cancer. We believe that the down-regulation of survivin in breast cancer cells could be a novel therapeutic approach for achieving optimal results in patients with chemoresistant breast cancer. However, very little or no information is currently available regarding the consequence of down-regulation of survivin in cell fate and whether this down-regulation could offer potential therapeutic benefits in breast cancer patients.

Studies from our laboratory and others have shown that 3,3′-diindolylmethane, a major in vivo acid-catalyzed condensation product of indole-3-carbinol (I3C), is a potent inhibitor of cell growth and inducer of apoptotic cell death (4, 1822). However, the comprehensive molecular mechanism(s) by which I3C/3,3′-diindolylmethane inhibits cell growth and apoptosis is still unknown. However, the 3,3′-diindolylmethane's pleiotropic effects on breast cancer cells could be due to alterations in gene expression profiles that are important for cell growth and induction of apoptosis. Thus, understanding the molecular biological properties of 3,3′-diindolylmethane may lead to the clinical development of mechanism-based chemopreventive and/or therapeutic strategies for breast cancer. Microarray gene expression profiling allows examination of the expression of a large number of genes and, in turn, provides an opportunity for determining the effects of anticancer agents on cancer cells. The alterations of gene expression profiles by several anticancer agents have been reported (23, 24). In this study, we used the high-throughput gene chip, which contains 22,215 known genes to better understand the precise molecular mechanism(s) by which 3,3′-diindolylmethane exerts its effects on breast cancer cells. We found a total of 1,238 genes altered by 3,3′-diindolylmethane treatment, among which 550 genes were down-regulated and 668 genes were up-regulated, many of which are associated with regulation of cell growth, cell cycle, apoptosis, and intracellular signaling. We also found a significant down-regulation of survivin expression. Based on our results, we further tested and found that 3,3′-diindolylmethane-induced down-regulation of survivin is, in part, mechanistically associated with 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis.

Cell culture and growth inhibition. For the present study, we have used human breast epithelial cells MDA-MB-231, which is tumorigenic [American Type Culture Collection (ATCC), Manassas, VA]. It has aggressive invasion capacity and can also grow very well in an animal model (ATCC). MDA-MB-231 was grown in DMEM/F12 (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin in a 5% CO2 atmosphere at 37°C. 3,3′-Diindolylmethane (LKT Laboratories, St. Paul, MN) was dissolved in DMSO to make 20 mmol/L stock solution and was added directly to the media at different concentrations. Concentration between 30 and 60 μmol/L 3,3′-diindolylmethane seems adequate for this study primarily because results of several studies have indicated that 3,3′-diindolylmethane exhibits promising cancer protective activities, especially against mammary neoplasia (8, 2528). Moreover, based on these previous studies, including our own study, we have chosen different concentrations of 3,3′-diindolylmethane for this study, which is relevant and achievable in vivo. Survivin small interfering RNA (siRNA) and siRNA control were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). LipofectAMINE 2000 was purchased from Invitrogen. Protease inhibitor cocktail, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and all other chemicals were obtained from Sigma (St. Louis, MO).

Cell growth inhibition studies by MTT assay. For growth inhibition, MDA-MB-231 cells (2 × 103) were seeded in a 96-well culture plate and subsequently treated with 10, 20, 30, 40, and 60 μmol/L 3,3′-diindolylmethane for 24, 48, and 72 hours, whereas control cells received 0.01% DMSO in culture medium. After treatment, the cells were incubated with MTT reagent (0.5 mg/mL; Sigma) at 37°C for 2 hours and then with isopropanol at room temperature for 1 hour. Spectrophotometric absorbance of the samples was determined by an Ultra Multifunctional Microplate Reader (Tecan, Durham, NC). Results were plotted as means ±SD of three separate experiments having six determinations per experiment for each experimental condition.

Histone/DNA ELISA for detecting apoptosis. The cell apoptosis ELISA detection kit (Roche, Palo Alto, CA) was used to detect apoptosis in breast cancer cells treated with 3,3′-diindolylmethane according to manufacturer's protocol. Briefly, the cytoplasmic histone/DNA fragments from MDA-MB-231 breast cancer cells treated with 40 and 60 μmol/L 3,3′-diindolylmethane or DMSO (vehicle control) for 24, 48, or 72 hours were extracted and bound to immobilized anti-histone antibody. Subsequently, the peroxidase-conjugated anti-DNA antibody was used for the detection of immobilized histone/DNA fragments. After addition of substrate for peroxidase, the spectrophotometric absorbance of the samples was determined by using Ultra Multifunctional Microplate Reader at 405 nm.

Plasmid and transfection. The survivin cDNA plasmid encoding survivin were obtained from Science Reagents (Ipswich, MA). MDA-MB-231 cells were transfected with survivin siRNA and siRNA control, respectively, using LipofectAMINE 2000. MDA-MB-231 cells were transiently transfected with human survivin cDNA. The transfected cells were treated with 40 and 60 μmol/L 3,3′-diindolylmethane for 24, 48, and 72 hours or kept as control. The cell growth and apoptotic cell death of transfected cells with and without treatments were measured using MTT assay and cell apoptosis ELISA Detection kit (Roche), respectively.

cDNA microarray analysis. MDA-MB-231 cells were treated with 40 μmol/L 3,3′-diindolylmethane for 6, 24, and 48 hours. 3,3′-Diindolylmethane is the in vivo dimeric product of I3C. The doses of 3,3′-diindolylmethane chosen for the microarray experiment were close to IC50. However, the biological relevance of these doses in relation to prevention or therapy has not been fully evaluated. The rationale for choosing these time points was to capture the expression profiles of early-response genes, genes that may be involved in the onset of growth inhibition and apoptotic processes, and, finally, genes that may be involved during active growth inhibition and apoptosis. Total RNA from each sample was isolated by Trizol (Invitrogen) and purified using the RNeasy Mini kit and RNase-free DNase Set (Qiagen, Valencia, CA) according to the manufacturer's protocols. cDNA for each sample was synthesized using a Superscript cDNA Synthesis kit (Invitrogen) and a T7-(dT)24 primer instead of the oligo-(dT) provided in the kit. Then, the biotin-labeled cRNA was transcribed in vitro from cDNA using a BioArray HighYield RNA Transcript Labeling kit (ENZO Biochem, New York, NY) and purified using the RNeasy Mini kit. The purified cRNA was fragmented by incubation in fragmentation buffer [200 mmol/L Tris-acetate (pH 8.1), 500 mmol/L potassium acetate, 150 mmol/L magnesium acetate] at 95°C for 35 minutes and chilled on ice. The fragmented labeled cRNA was applied to the Human Genome U133A Array (Affymetrix, Santa Clara, CA), which contains 22,215 human gene sequence, and hybridized to the probes in the array. After washing and staining, the arrays were scanned using a HP GeneArray Scanner (Hewlett-Packard, Palo Alto, CA). Two independent experiments were done to verify the reproducibility of our results.

Microarray data normalization and analysis. The gene expression levels of samples were normalized and analyzed using Microarray Suite, MicroDB and Data Mining Tool software (Affymetrix). The signal value of the experimental array was multiplied by a normalization factor to make its mean intensity equivalent to the mean intensity of the control array using Microarray Suite software according to manufacturer's protocol. The absolute call (present, marginal, and absent) and average difference of 22,215 gene expressions in a sample and the absolute call difference, fold change, and average difference of gene expressions between two or several samples were identified using the abovementioned software. Statistical analysis of the difference in the mean expression of genes showing a >2-fold change was done repeatedly between treated and untreated samples using t tests. Average-linkage hierarchical clustering of the data was applied using the Cluster method (29), and the results were displayed with TreeView (29). The genes showing altered expression were also categorized based on their location and cellular component and reported or suggested biochemical, biological, and molecular functions using Onto-Express (30). Genes that were not annotated or not easily classified were excluded from the functional clustering analysis.

Real-time reverse transcription-PCR analysis for gene expression. To verify the alterations of gene expression at the mRNA level, which appeared on the microarray, we chose 15 representative genes (Table 2) with varying expression profiles for real-time reverse transcription-PCR (RT-PCR) analysis. Two micrograms of total RNA from each sample were subjected to reverse transcription using the Superscript first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer's protocol. Real-time PCR reactions were then carried out in a total of 25 μL of reaction mixture (2 μL of cDNA, 12.5 μL of 2× SYBR Green PCR Master Mix, 1.5 μL of each 5 μmol/L forward and reverse primers, and 7.5 μL of H2O) in an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). The PCR program was initiated for 10 minutes at 95°C before 40 thermal cycles, each of 15 seconds at 95°C, and 1 minute at 60°C. Data was analyzed according to the comparative Ct method and was normalized by actin expression in each sample. Melting curves for each PCR reaction were generated to ensure the purity of the amplification product.

Western blot analysis. To verify whether the alterations of genes at the level of transcription ultimately result in the alterations at the level of translation, we conducted Western blot analysis for selected genes with varying expression profiles. The MDA-MB-231 cells were treated with 40 and 60 μmol/L 3,3′-diindolylmethane for 6, 12, and 48 hours. After treatment, the cells were lysed, and protein concentration was measured using bicinchoninic acid protein assay (Pierce, Rockford, IL). The proteins were subjected to 10%, 12%, or 14% SDS-PAGE and electrophoretically transferred to nitrocellulose membrane. The membranes were incubated with anti-p21WAF1 (1:500; Upstate, Lake Placid, NY), anti-survivin (1:200; R&D Systems, Minneapolis, MN), anti-cell division cycle cdc25A (1:200; Santa Cruz Biotechnology), anti-Bcl-2 (1:250; Calbiochem, San Diego, CA), and anti-β-actin (1:10,000; Sigma) primary antibodies and subsequently incubated with the secondary antibodies conjugated with peroxidase. All secondary antibodies were obtained from Pierce. The signal was then detected using chemiluminescence detection system (Pierce).

Statistical analysis. The statistical significance was determined using Student's t test, and P < 0.05 was considered significant.

Cell growth inhibition by 3,3′-diindolylmethane treatment. MTT assay showed that the treatment of MDA-MB-231 breast cancer cells with 3,3′-diindolylmethane resulted in a dose- and time-dependent inhibition of cell proliferation (Fig. 1), showing the inhibitory effect of 3,3′-diindolylmethane on MDA-MB-231 cell growth. The proliferation of MDA-MB-231 cells was significantly inhibited by 40 μmol/L 3,3′-diindolylmethane treatment for 48 and 72 hours (30% and 40%, respectively) compared with 60 μmol/L 3,3′-diindolylmethane treatment for 24, 48, and 72 hours (40%, 60%, and 70%, respectively). These results are consistent with our previously published results (8). Inhibition of cell proliferation observed by MTT could be due to altered regulation of several gene expressions by 3,3′-diindolylmethane treatment. Hence, we further investigated the gene expression profile of MDA-MB-231 breast cancer cells treated with 3,3′-diindolylmethane.

Figure 1.

Effects of 3,3′-diindolylmethane (DIM) on the growth of MDA-MB-231 cells. MDA-MB-231 breast cancer cells were treated with 3,3′-diindolylmethane, showing inhibition of cell proliferation in a dose-dependent and time-dependent manner. The proliferation of MDA-MB-231 cells was significantly inhibited by 40 μmol/L 3,3′-diindolylmethane treatment for 48 and 72 hours (30% and 40%, respectively) compared with 60 μmol/L 3,3′-diindolylmethane treatment for 24, 48, and 72 hours (40%, 60%, and 70%, respectively). *, P < 0.05; **, P < 0.01.

Figure 1.

Effects of 3,3′-diindolylmethane (DIM) on the growth of MDA-MB-231 cells. MDA-MB-231 breast cancer cells were treated with 3,3′-diindolylmethane, showing inhibition of cell proliferation in a dose-dependent and time-dependent manner. The proliferation of MDA-MB-231 cells was significantly inhibited by 40 μmol/L 3,3′-diindolylmethane treatment for 48 and 72 hours (30% and 40%, respectively) compared with 60 μmol/L 3,3′-diindolylmethane treatment for 24, 48, and 72 hours (40%, 60%, and 70%, respectively). *, P < 0.05; **, P < 0.01.

Close modal

Regulation of the mRNA expression by 3,3′-diindolylmethane treatment. The gene expression profile of MDA-MB-231 breast cancer cells treated with 3,3′-diindolylmethane was assessed using cDNA microarray. We found a total of 1,238 genes that showed a >1.5-fold change after 48 hours of 3,3′-diindolylmethane treatment. Among these genes, 550 genes were down-regulated, and 688 genes were up-regulated in 3,3′-diindolylmethane-treated MDA-MB-231 breast cancer cells. The altered expressions of most genes occurred after only 6 hours of 3,3′-diindolylmethane treatment and were more evident with longer treatment (Fig. 2). After clustering based analysis according to their biological functions, we found down-regulation and up-regulation of several genes, which are related to apoptosis, angiogenesis, tumor cell invasion, and metastasis (Fig. 2; Table 1).

Figure 2.

Cluster analysis of genes showing alterations in mRNA expression after 3,3′-diindolylmethane treatment. The alterations of specific and selected genes are shown.

Figure 2.

Cluster analysis of genes showing alterations in mRNA expression after 3,3′-diindolylmethane treatment. The alterations of specific and selected genes are shown.

Close modal
Table 1.

Fold changes of specific genes in MDA-MB-231 cells treated with 3,3′-diindolylmethane

GenesMDA-MB-231
6 h24 h48 h
Cell cycle, apoptosis, and cell proliferation    
    NM_004702.1, cyclin E2 (CCNE2NC −2.2* −4.2 
    AI343459, cdc25A NC −6.9 −13.9 
    NM_001760.1, cyclin D3 (CCND3NC −1.5 −2.4 
    NM_001197.2, BCL2-interacting killer (apoptosis-inducing; BIK) NC NC NC 
    NM_004749.1, cell cycle progression 2 protein (CPR2NC −1.4 −2.1 
    NM_006739.1, cdc46 (MCM5NC −1.7 −3.4 
    NM_002592.1, proliferating cell nuclear antigen (PCNANC NC −2.5 
    NM_004526.1, mitotin (MCM2NC −2.1 −4.0 
    NM_001237.1, cyclin A2 (CCNA2NC −1.8 −4.0 
    AA648913, survivin (BIRC5NC −1.5 −2.4 
    AF033111.1, Siva-2 NC −1.7 −2.6 
    NM_005860.1, follistatin-like 3 (secreted glycoprotein; FSTL3−1.8 −1.7 −1.6 
    AB011446.1, mRNA for Aik2 NC −2.0 −4.9 
    M73554.1, bcl-1 mRNA NC −1.4 −2.4 
    NM_001924.2, growth arrest and DNA damage–inducible, alpha (GADD45ANC NC 1.4 
    NM_005030.1, polo (Drosophila)-like kinase (PLKNC −2.1 −4.0 
    D64137, CDK inhibitor 1C (p57Kip2NC 22.6 6.9 
    NM_000389.1, CDK inhibitor 1A (p21Cip11.51 1.7 4.0 
    BF061658, transforming growth factor-β2 −2.6 −1.8 −2.8 
    NM_00145, FOXO3A 1.6 
Kinase, cell signaling, and cell structure    
    NM_003954.1, mitogen-activated protein kinase kinase kinase 14 (MAP3K14NC −1.7 −1.6 
    NM_030662.1, mitogen-activated protein kinase kinase 2 (MAP2K2NC NC NC 
    AW025150, mitogen-activated protein kinase kinase kinase 12 NC NC −1.8 
    D31661.1, mRNA for tyrosine kinase (EPHB2NC −2.1 −1.6 
    NM_007019.1, ubiquitin carrier protein E2-C (UBCH10NC −1.7 −3.7 
Transcription and translation    
    NM_021953.1, forkhead box M1 (FOXM1NC −2.0 −4.5 
    NM_005225.1, E2F transcription factor 1 (E2F1NC NC −4.2 
    AF360549.1, BRCA1-binding helicase-like protein BACH1 NC NC −2.6 
    NM_005342.1, high-mobility group (nonhistone chromosomal) protein 4 (HMG41.1 NC −1.6 
    U63824, human transcription factor RTEF-1 (RTEF1NC −2.1 −3.0 
    NM_006312.1, nuclear receptor corepressor 2 (NCOR2NC −1.5 −1.6 
    NM_007111.1, transcription factor Dp-1 (TFDP1NC −1.5 −2.8 
Angiogenesis, metastasis, and invasion    
    M92934.1, connective tissue growth factor (CTGF−2.2 −2.4 −6.9 
    NM_006342.1, transforming, acidic coiled-coil containing protein 3 (TACC3NC −2.0 −4.2 
    NM_016639.1, I transmembrane protein Fn14 (FN14NC −1.6 −1.5 
    NM_002826.2, quiescin Q6 (QSCN6−1.2 −1.3 −1.6 
    NM_005242.2, coagulation factor II (thrombin) receptor-like 1 (F2RL1NC NC −1.7 
    NM_003600.1, serine-threonine kinase 15 (STK15NC NC −2.6 
    NM_001274.1, CHK1 (checkpoint, Schizosaccharomyces pombe) homologue (CHEK1NC NC −2.4 
GenesMDA-MB-231
6 h24 h48 h
Cell cycle, apoptosis, and cell proliferation    
    NM_004702.1, cyclin E2 (CCNE2NC −2.2* −4.2 
    AI343459, cdc25A NC −6.9 −13.9 
    NM_001760.1, cyclin D3 (CCND3NC −1.5 −2.4 
    NM_001197.2, BCL2-interacting killer (apoptosis-inducing; BIK) NC NC NC 
    NM_004749.1, cell cycle progression 2 protein (CPR2NC −1.4 −2.1 
    NM_006739.1, cdc46 (MCM5NC −1.7 −3.4 
    NM_002592.1, proliferating cell nuclear antigen (PCNANC NC −2.5 
    NM_004526.1, mitotin (MCM2NC −2.1 −4.0 
    NM_001237.1, cyclin A2 (CCNA2NC −1.8 −4.0 
    AA648913, survivin (BIRC5NC −1.5 −2.4 
    AF033111.1, Siva-2 NC −1.7 −2.6 
    NM_005860.1, follistatin-like 3 (secreted glycoprotein; FSTL3−1.8 −1.7 −1.6 
    AB011446.1, mRNA for Aik2 NC −2.0 −4.9 
    M73554.1, bcl-1 mRNA NC −1.4 −2.4 
    NM_001924.2, growth arrest and DNA damage–inducible, alpha (GADD45ANC NC 1.4 
    NM_005030.1, polo (Drosophila)-like kinase (PLKNC −2.1 −4.0 
    D64137, CDK inhibitor 1C (p57Kip2NC 22.6 6.9 
    NM_000389.1, CDK inhibitor 1A (p21Cip11.51 1.7 4.0 
    BF061658, transforming growth factor-β2 −2.6 −1.8 −2.8 
    NM_00145, FOXO3A 1.6 
Kinase, cell signaling, and cell structure    
    NM_003954.1, mitogen-activated protein kinase kinase kinase 14 (MAP3K14NC −1.7 −1.6 
    NM_030662.1, mitogen-activated protein kinase kinase 2 (MAP2K2NC NC NC 
    AW025150, mitogen-activated protein kinase kinase kinase 12 NC NC −1.8 
    D31661.1, mRNA for tyrosine kinase (EPHB2NC −2.1 −1.6 
    NM_007019.1, ubiquitin carrier protein E2-C (UBCH10NC −1.7 −3.7 
Transcription and translation    
    NM_021953.1, forkhead box M1 (FOXM1NC −2.0 −4.5 
    NM_005225.1, E2F transcription factor 1 (E2F1NC NC −4.2 
    AF360549.1, BRCA1-binding helicase-like protein BACH1 NC NC −2.6 
    NM_005342.1, high-mobility group (nonhistone chromosomal) protein 4 (HMG41.1 NC −1.6 
    U63824, human transcription factor RTEF-1 (RTEF1NC −2.1 −3.0 
    NM_006312.1, nuclear receptor corepressor 2 (NCOR2NC −1.5 −1.6 
    NM_007111.1, transcription factor Dp-1 (TFDP1NC −1.5 −2.8 
Angiogenesis, metastasis, and invasion    
    M92934.1, connective tissue growth factor (CTGF−2.2 −2.4 −6.9 
    NM_006342.1, transforming, acidic coiled-coil containing protein 3 (TACC3NC −2.0 −4.2 
    NM_016639.1, I transmembrane protein Fn14 (FN14NC −1.6 −1.5 
    NM_002826.2, quiescin Q6 (QSCN6−1.2 −1.3 −1.6 
    NM_005242.2, coagulation factor II (thrombin) receptor-like 1 (F2RL1NC NC −1.7 
    NM_003600.1, serine-threonine kinase 15 (STK15NC NC −2.6 
    NM_001274.1, CHK1 (checkpoint, Schizosaccharomyces pombe) homologue (CHEK1NC NC −2.4 

Abbreviation: NC, no change.

*

Negative value, decrease.

Positive value, increase.

Target confirmation by real-time RT-PCR. To confirm these alterations in gene expression, we conducted RT-PCR analysis of selected genes (Table 2). The results of RT-PCR analysis for these selected genes (BACH1, BIRC5, CCNE2, cdc25A, F2F1, FOXM1, MCM5, p21Cip1, p57Kip2, PCNA, TACC3, and UBCH10) were in direct agreement with the microarray data (Fig. 3A; Table 1). The same alternations at the mRNA levels were observed by RT-PCR analysis after 3,3′-diindolylmethane treatment, although the fold change in the expression level was not exactly similar between these two different analytic methods (Fig. 3A; Table 1). To further verify the regulation of gene expression at the protein level by 3,3′-diindolylmethane treatment, we narrowed down few genes from the RT-PCR analysis and conducted Western blot analysis only for selected few genes, which are the main focus of this study and for those genes that are critically important for the inhibition of cell growth and induction of apoptosis. Western blot analysis showed that the protein levels of BIRC5 (survivin), Bcl-2, and cdc25A were down-regulated, and p21WAF1 was up-regulated after 3,3′-diindolylmethane treatment (Fig. 3B). These results suggest that 3,3′-diindolylmethane regulated the transcription of the genes involved in apoptosis and cell cycle arrest, angiogenesis, tumor cell invasion, and metastasis, and these results are consistent with our previously published data in prostate cancer cells (3).

Table 2.

The primer used for real-time RT-PCR analysis

GenesPrimer sequence
CCNE2 GAATGTCAAGACGAAGTA 
 ATGAACATATCTGCTCTC 
cdc25A ACACAGCAACTAGCCATCTCCAG 
 GCCAGCCTCCTTACCATCACG 
MCM5 GACCATCTCTATCGCCAAG 
 CTCCTCATTGTGCTCATCC 
BIRC5 GCTTTCAGGTGCTGGTAG 
 GATGTGGATCTCGGCTTC 
PCNA CCTGTAGCGGCGTTGTTG 
 CGTTGATGAGGTCCTTGAGTG 
Aik2 ACTTCGGCTGGTCTGTCC 
 ATAGGTCTCGTTGTGTGATGC 
p57Kip2 GGACGAGACAGGCGAACC 
 AGAGGACAGCGAGAAGAAGG 
p21Cip1 TCCAGCGACCTTCCTCATCCAC 
 TCCATAGCCTCTACTGCCACCATC 
UBCH10 TAGGAGAACCCAACATTGATA 
 AGACGACACAAGGACAGG 
FOXM1 AACCGCTACTTGACATTGG 
 GCAGTGGCTTCATCTTCC 
E2F1 CAAGAAGTCCAAGAACCACATCC 
 CTGCTGCTCGCTCTCCTG 
BACH1 TTTGGGACACGCACACAC 
 ACCGACTACCTCAGGATGG 
CTGF ACCAATGACAACGCCTCCTG 
 TTGCCCTTCTTAATGTTCTCTTCC 
TACC3 ATCGTCTGTTCTTCGTGTG 
 AGTCCAAGGGTGTCATCC 
β-Actin CCACACTGTGCCCATCTACG 
 AGGATCTTCATGAGGTAGTCAGTCAG 
GenesPrimer sequence
CCNE2 GAATGTCAAGACGAAGTA 
 ATGAACATATCTGCTCTC 
cdc25A ACACAGCAACTAGCCATCTCCAG 
 GCCAGCCTCCTTACCATCACG 
MCM5 GACCATCTCTATCGCCAAG 
 CTCCTCATTGTGCTCATCC 
BIRC5 GCTTTCAGGTGCTGGTAG 
 GATGTGGATCTCGGCTTC 
PCNA CCTGTAGCGGCGTTGTTG 
 CGTTGATGAGGTCCTTGAGTG 
Aik2 ACTTCGGCTGGTCTGTCC 
 ATAGGTCTCGTTGTGTGATGC 
p57Kip2 GGACGAGACAGGCGAACC 
 AGAGGACAGCGAGAAGAAGG 
p21Cip1 TCCAGCGACCTTCCTCATCCAC 
 TCCATAGCCTCTACTGCCACCATC 
UBCH10 TAGGAGAACCCAACATTGATA 
 AGACGACACAAGGACAGG 
FOXM1 AACCGCTACTTGACATTGG 
 GCAGTGGCTTCATCTTCC 
E2F1 CAAGAAGTCCAAGAACCACATCC 
 CTGCTGCTCGCTCTCCTG 
BACH1 TTTGGGACACGCACACAC 
 ACCGACTACCTCAGGATGG 
CTGF ACCAATGACAACGCCTCCTG 
 TTGCCCTTCTTAATGTTCTCTTCC 
TACC3 ATCGTCTGTTCTTCGTGTG 
 AGTCCAAGGGTGTCATCC 
β-Actin CCACACTGTGCCCATCTACG 
 AGGATCTTCATGAGGTAGTCAGTCAG 
Figure 3.

A, real-time RT-PCR amplification value showing the altered expression of specific genes from RNA of 3,3′-diindolylmethane (DIM)–treated MDA-MB-231 cells. B, Western blot analysis of selected gene expression in 3,3′-diindolylmethane-treated MDA-MB-231 cells at the protein level. a, expression of survivin was down-regulated with 3,3′-diindolylmethane treatment. b, expression of Bcl-2 was down-regulated with 3,3′-diindolylmethane treatment. c, expression of p21WAF1 was up-regulated with 3,3′-diindolylmethane treatment. d, expression of cdc25A was down-regulated with 3,3′-diindolylmethane treatment.

Figure 3.

A, real-time RT-PCR amplification value showing the altered expression of specific genes from RNA of 3,3′-diindolylmethane (DIM)–treated MDA-MB-231 cells. B, Western blot analysis of selected gene expression in 3,3′-diindolylmethane-treated MDA-MB-231 cells at the protein level. a, expression of survivin was down-regulated with 3,3′-diindolylmethane treatment. b, expression of Bcl-2 was down-regulated with 3,3′-diindolylmethane treatment. c, expression of p21WAF1 was up-regulated with 3,3′-diindolylmethane treatment. d, expression of cdc25A was down-regulated with 3,3′-diindolylmethane treatment.

Close modal

Regulation of genes involved in cell cycle and apoptotic process. After clustering based on biological function using OntoExpress and GenMAPP computerized analysis, we found that in MDA-MB-231 breast cancer cells, 3,3′-diindolylmethane down-regulated the expression of some genes that are critically involved in the regulation of cell proliferation and cell cycle (Table 1; Figs. 2 and 4). In contrast, 3,3′-diindolylmethane up-regulated the expression of some genes that are related to induction of apoptosis and cell cycle arrest (Table 1; Figs. 2 and 4). Western blot analysis showed that the protein levels of p21WAF1 in MDA-MB-231 cells treated for 48 hours with 3,3′-diindolylmethane were up-regulated, whereas survivin, Bcl-2, and cdc25A were down-regulated (Fig. 3B). These results are novel and have not been previously shown. These results are also in direct agreement with the microarray and RT-PCR data. In addition to the effects of 3,3′-diindolylmethane on cell cycle and apoptosis, 3,3′-diindolylmethane also showed the regulation of genes related to signal transduction, transcription factor, oncogenesis, and tumor suppression (Table 1; Fig. 2). However, among these genes, survivin may have different roles in apoptosis in breast cancer, and because the clinical importance of survivin expression remains unclear in patients with breast cancer, we further investigated the mechanistic role of survivin during 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis.

Figure 4.

Effect of 3,3′-diindolylmethane on cell cycle and apoptosis pathway-related gene expression as analyzed and visualized by GenMAPP software integrated with cDNA microarray data (positive value, increase in fold change; negative value, decrease in fold change).

Figure 4.

Effect of 3,3′-diindolylmethane on cell cycle and apoptosis pathway-related gene expression as analyzed and visualized by GenMAPP software integrated with cDNA microarray data (positive value, increase in fold change; negative value, decrease in fold change).

Close modal

Down-regulation of survivin expression by siRNA promotes 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis. We used Western blot analysis to detect the protein level of survivin. Intracellular survivin was down-regulated in survivin siRNA–transfected MDA-MB-231 cells compared with siRNA control–transfected cells (Fig. 5). Down-regulation of survivin expression significantly attenuated cell growth inhibition induced by 3,3′-diindolylmethane (Fig. 6A). We found that treatment of cells with 3,3′-diindolylmethane or survivin siRNA alone for 72 hours generally caused 60% to 70% of growth inhibition in MDA-MB-231 cells compared with control. However, 3,3′-diindolylmethane plus survivin siRNA resulted in ∼90% growth inhibition compared with control. Survivin siRNA–transfected MDA-MB-231 cells were significantly more sensitive to spontaneous and 3,3′-diindolylmethane-induced apoptosis (Fig. 6B). These results suggest that 3,3′-diindolylmethane plus survivin siRNA promotes cell growth inhibition and apoptosis to a greater degree compared with either agent alone.

Figure 5.

MDA-MB-231 breast cancer cell growth inhibition and cell death induced by survivin siRNA and 3,3′-diindolylmethane. Survivin expression was down-regulated by 3,3′-diindolylmethane and survivin siRNA, resulting in cell death.

Figure 5.

MDA-MB-231 breast cancer cell growth inhibition and cell death induced by survivin siRNA and 3,3′-diindolylmethane. Survivin expression was down-regulated by 3,3′-diindolylmethane and survivin siRNA, resulting in cell death.

Close modal
Figure 6.

MDA-MB-231 breast cancer cell growth inhibition and cell death by survivin cDNA, survivin siRNA, and 3,3′-diindolylmethane (DIM). CS, control siRNA; SS, survivin siRNA; CP, control plasmid; SP, survivin plasmid. A, down-regulation of survivin expression significantly inhibited cell growth. 3,3′-Diindolylmethane plus survivin siRNA inhibited cell growth to a greater degree compared with 3,3′-diindolylmethane or survivin alone. B, MDA-MB-231 breast cancer cell death induced by survivin siRNA and 3,3′-diindolylmethane. Down-regulation of survivin expression significantly increased apoptosis induced by 3,3′-diindolylmethane. Survivin siRNA–transfected MDA-MB-231 cells were significantly more sensitive to spontaneous and 3,3′-diindolylmethane-induced apoptosis. C, overexpression of survivin expression significantly promoted cell growth. Overexpression in survivin rescued breast cancer cells from 3,3′-diindolylmethane-induced cell growth inhibition. D, overexpression of survivin by survivin cDNA transfection abrogated 3,3′-diindolylmethane-induced apoptosis. *, P < 0.05; **, P < 0.01.

Figure 6.

MDA-MB-231 breast cancer cell growth inhibition and cell death by survivin cDNA, survivin siRNA, and 3,3′-diindolylmethane (DIM). CS, control siRNA; SS, survivin siRNA; CP, control plasmid; SP, survivin plasmid. A, down-regulation of survivin expression significantly inhibited cell growth. 3,3′-Diindolylmethane plus survivin siRNA inhibited cell growth to a greater degree compared with 3,3′-diindolylmethane or survivin alone. B, MDA-MB-231 breast cancer cell death induced by survivin siRNA and 3,3′-diindolylmethane. Down-regulation of survivin expression significantly increased apoptosis induced by 3,3′-diindolylmethane. Survivin siRNA–transfected MDA-MB-231 cells were significantly more sensitive to spontaneous and 3,3′-diindolylmethane-induced apoptosis. C, overexpression of survivin expression significantly promoted cell growth. Overexpression in survivin rescued breast cancer cells from 3,3′-diindolylmethane-induced cell growth inhibition. D, overexpression of survivin by survivin cDNA transfection abrogated 3,3′-diindolylmethane-induced apoptosis. *, P < 0.05; **, P < 0.01.

Close modal

Overexpression of survivin by cDNA transfection reduced 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis. Overexpression of survivin by cDNA transfection rescued 3,3′-diindolylmethane-induced cell growth inhibition and abrogated 3,3′-diindolylmethane-induced apoptosis to a certain degree (Fig. 6C and D). We found that treatment of cells with survivin cDNA for 72 hours promotes ∼90% of cell growth in MDA-MB-231 cells compared with control. However, 3,3′-diindolylmethane plus survivin cDNA resulted in ∼35% growth inhibition compared with control (Fig. 6C). These results provide evidence for a potential role of survivin during 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis in MDA-MD-231 cells.

In the present study, we showed that 3,3′-diindolylmethane elicits a significant effect on growth inhibition and induction of apoptotic processes in MDA-MB-231 breast cancer cells mediated by alterations in the gene expression of cell cycle and apoptosis regulatory genes as shown by microarray analysis. Among these genes, we found down-regulation of several genes, such as BACH1, BIRC5 (survivin), CCNE2, CDC25A, Bcl-2, E2F1, FOXM1, MCM5, PCNA, TACC3, UBCH10, Aik2, and CTGF, and up-regulation of several genes, such as p21Cip1, p57Kip2, and FOXO3A, in 3,3′-diindolylmethane-treated MDA-MB-231 cells that are related to the inhibition of cell growth and induction of apoptosis. To further elucidate the mechanisms of increased apoptosis induced by 3,3′-diindolylmethane, we found that survivin is playing an important role during 3,3′-diindolylmethane-induced cell death.

Our results also showed that cyclins (cyclin A2 and cyclin E2) and CDCs (cdc25A and cdc45) were down-regulated in 3,3′-diindolylmethane-treated breast cancer cells, whereas CDK inhibitors (p21WAF1 and p57) were up-regulated, suggesting that 3,3′-diindolylmethane inhibited the growth of breast cancer cell through the arrest of cell cycle and inhibition of proliferation (Fig. 4). Similar effects on the cell cycle were also observed in 3,3′-diindolylmethane-treated prostate cancer cells (3). Several studies have shown that CDCs control the molecules related to the cell cycle, and they are vital and important for the initiation and progression of the consecutive phase of the cell cycle (31, 32). It has been found that cyclins binds to cyclin-dependent protein kinase (CDK) and CDCs to control the cell cycle process (3336). The CDK inhibitors, including p21WAF1, p27, and p57, have been shown to arrest the cell cycle and inhibit the growth of cancer cells (3739). Inhibition of cell growth by 3,3′-diindolylmethane could also be due to the induction of apoptosis in addition to cell cycle arrest. Moreover, after analyzing microarray data, we focused on determining whether 3,3′-diindolylmethane could induce apoptosis by inhibiting the expression of survivin, which may be critically important for cell survival and cell death.

Survivin is an IAP, which is overexpressed in human cancer cells and critically needed for regulation of the balance among cell proliferation, differentiation, and apoptosis (17). It is known that nuclear factor-κB (NF-κB), a key transcription factor, up-regulates the expression and function of survivin in breast cancer cells (40). It has also been shown that expression of antiapoptotic protein survivin is associated with cancer cell viability and drug resistance (10). Previous studies in determining the association of survivin with prognosis in breast cancer patients has been controversial (17); thus, the clinical importance of survivin expression remains unclear in patients with breast cancer. However, down-regulation of survivin signaling may be a novel approach in breast cancer therapy. Because of the critical role of survivin in cell proliferation and apoptosis, we explored whether survivin could be a molecular target for 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis. In this study, we showed, for the first time that 3,3′-diindolylmethane down-regulates survivin expression along with other antiapoptotic molecules. We also found that down-regulation of survivin by siRNA together with 3,3′-diindolylmethane treatment caused cell growth inhibition and apoptosis to a greater degree in breast cancer cells compared with either agent alone. Overexpression of survivin by survivin cDNA transfection abrogated 3,3′-diindolylmethane-induced apoptosis to certain degree. Therefore, we strongly believe that down-regulation of survivin is mechanistically linked with 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis.

It has been reported that ectopic expression of survivin, an inhibitor of apoptosis, confers resistance to apoptosis to a variety of stimuli, and survivin is one of the most abundantly overexpressed genes in human tumors (41, 42). Genetic and biochemical data indicate that survivin functions in a unique cell division checkpoint that ensures the apoptotic demise of genetically unstable cells (41). Based on these findings, survivin has been proposed as a suitable target for drugs that can restore the apoptotic program in human tumors. A recent study has indicated that anti-survivin oligonucleotides induced apoptosis in mesothelinoma cells, suggesting that down-regulation of survivin seems to be an effective therapy for mesothelinoma (42). Another study has shown that survivin is expressed in the G2-M phase of the cell cycle in a cycle-regulated manner (41). It has been shown that GADD45A promotes apoptosis and regulates G2-M arrest (43), and in our study, we found that GADD45A and FOXO3A expression was up-regulated by 3,3′-diindolylmethane treatment, which could be associated with apoptotic mechanisms (44, 45). Induction of apoptosis by FOXO3A has been correlated with the disruption of mitochondrial member integrity, cytochrome c release, and up-regulation of BIM (46). The induction of apoptosis mediated by these molecules, including survivin, could be important molecular mechanism(s) by which 3,3′-diindolylmethane exerts its growth-inhibitory effects on breast cancer cells.

We also found that 3,3′-diindolylmethane down-regulated the expression of the forkhead transcription factor FOXM1, which correlates with proliferative status in a variety of normal and transformed cell types (47). Elevated expression of FOXM1 has been noted in both hepatocellular carcinoma and basal cell carcinoma (47). It has been indicated that FOXM1 is significantly elevated in primary breast cancer (47). Our microarray analysis showed that FOXM1 regulates genes, including survivin, that are essential for mitosis. Loss of FOXM1 expression generates mitotic spindle defects, delays cells in mitosis, and induces mitotic catastrophe (47). At the beginning of mitosis, survivin associates with microtubules of the mitotic spindle on a specific and saturable reaction that is regulated by microtubule dynamics (48). Our present findings indicated that inhibition of FOXM1 expression by 3,3′-diindolylmethane, which may disrupt survivin-microtubule interactions, resulted in the loss of survivin's antiapoptosis function and increased caspase-3 activity, a mechanism involved in cell death during mitosis. In contrast, 3,3′-diindolylmethane up-regulated the expression of tumor-suppressor genes, including p21WAF1 and p57, which may inhibit survivin expression. These results are novel and suggest that 3,3′-diindolylmethane may induce the apoptotic pathway by inhibiting cancer cell growth and survival through inhibition of transcription and oncogenesis (hypothetical diagram as in Fig. 7).

Figure 7.

A schematic representation showing 3,3′-diindolylmethane(DIM)–induced cell growth inhibition and apoptosis in breast cancer cells.

Figure 7.

A schematic representation showing 3,3′-diindolylmethane(DIM)–induced cell growth inhibition and apoptosis in breast cancer cells.

Close modal

Several other potential mechanisms could explain the regulation of survivin associated with inhibition of cell proliferation and induction of apoptosis. It is known that NF-κB, a transcription factor, plays important roles in the control of cell growth, differentiation, and apoptosis (11, 12, 14, 16, 49, 50). Several studies have suggested that the activation of NF-κB up-regulates the expression of its downstream genes, such as Bcl-2/Bcl-XL and survivin, which are involved in cancer cell invasion, metastasis, and resistance to chemotherapy (16, 51). We have previously found that 3,3′-diindolylmethane is a potent inhibitor of NF-κB DNA-binding activity in breast cancer cells (8). Thus, 3,3′-diindolylmethane induced down-regulation of survivin expression could be partly due to inhibition of NF-κB activity (hypothetical diagram as in Fig. 7). We, therefore, believe that 3,3′-diindolylmethane could inhibit NF-κB expression, resulting in the down-regulation of its target genes, including survivin, and causing cell growth inhibition and apoptosis.

Taken together, we believe that targeting survivin by 3,3′-diindolylmethane could be a novel approach for the prevention and/or treatment of breast cancer. Moreover, the down-regulation of survivin by 3,3′-diindolylmethane could also be a useful strategy for chemosensitization of metastatic breast cancer cells to standard therapies. However, further in-depth investigations are needed to establish the cause and effect relationship of survivin gene regulation and 3,3′-diindolylmethane-induced cell growth inhibition and apoptosis in breast cancer in animal and human models.

Grant support: Two concept awards funded by Department of Defense grants W81XWH-04-1-0689 and W81XWH-05-1-0505 (KM Wahidur Rahman).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Carrie Koerner for editorial assistance.

1
Seymour JD, Calle EE, Flagg EW, Coates RJ, Ford ES, Thun MJ. Diet Quality Index as a predictor of short-term mortality in the American Cancer Society Cancer Prevention Study II Nutrition Cohort.
Am J Epidemiol
2003
;
157
:
980
–8.
2
Li Y, Che M, Bhagat S, et al. Regulation of gene expression and inhibition of experimental prostate cancer bone metastasis by dietary genistein.
Neoplasia
2004
;
6
:
354
–63.
3
Li Y, Li X, Sarkar FH. Gene Expression profiles of I3C- and DIM-treated PC3 human prostate cancer cells determined by cDNA microarray analysis.
J Nutr
2003
;
133
:
1011
–9.
4
Rahman KM, Li Y, Sarkar F. Inactivation of Akt and NF-kB play important roles during I3C-induced apoptosis in breast cancer cells.
Nutr Cancer
2004
;
48
:
84
–94.
5
Rahman KM, Aranha O, Glazyrin A, Chinni SR, Sarkar FH. Translocation of Bax to mitochondria induces apoptotic cell death in indole-3-carbinol (I3C) treated breast cancer cells.
Oncogene
2000
;
19
:
5764
–71.
6
Rahman KM, Sarkar FH. Steroid hormone mimics: molecular mechanisms of cell growth and apoptosis in normal and malignant mammary epithelial cells.
J Steroid Biochem Mol Biol
2002
;
80
:
191
–201.
7
Rahman KM, Aranha O, Sarkar FH. Indole-3-carbinol (I3C) induces apoptosis in tumorigenic but not in non-tumorigenic breast epithelial cells.
Nutr Cancer
2003
;
45
:
101
–12.
8
Rahman KM, Sarkar FH. Inhibition of nuclear translocation of nuclear factor-{kappa}B contributes to 3,3′-diindolylmethane-induced apoptosis in breast cancer cells.
Cancer Res
2005
;
65
:
364
–71.
9
Tsuji N, Furuse K, Asanuma K, et al. Mutations of the p53 gene and loss of heterozygosity at chromosome 17p13.1 are associated with increased survivin expression in breast cancer.
Breast Cancer Res Treat
2004
;
87
:
23
–31.
10
Wu J, Ling X, Pan D, et al. Molecular mechanism of inhibition of survivin transcription by the GC-rich sequence selective DNA-binding antitumor agent, hedamycin: evidence of survivin downregulation associated with drug sensitivity.
J Biol Chem
2005
;
280
:
9745
–51.
11
Biswas DK, Dai SC, Cruz A, Weiser B, Graner E, Pardee AB. The nuclear factor kappa B (NF-kappa B): a potential therapeutic target for estrogen receptor negative breast cancers.
Proc Natl Acad Sci U S A
2001
;
98
:
10386
–91.
12
Hideshima T, Chauhan D, Richardson P, et al. NF-kappa B as a therapeutic target in multiple myeloma.
J Biol Chem
2002
;
277
:
16639
–47.
13
Ikeguchi M, Kaibara N. Changes in survivin messenger RNA level during cisplatin treatment in gastric cancer.
Int J Mol Med
2001
;
8
:
661
–6.
14
Orlowski RZ, Baldwin AS, Jr. NF-kappaB as a therapeutic target in cancer.
Trends Mol Med
2002
;
8
:
385
–9.
15
Zhang SQ, Qiang SY, Yang WB, Jiang JT, Ji ZZ. Expression of survivin in different stages of carcinogenesis and progression of breast cancer.
Ai Zheng
2004
;
23
:
697
–700.
16
Haefiner B. Nf-kappaB: arresting a major culprit in cancer.
Drug Discov Today
2002
;
7
:
653
–63.
17
Span PN, Sweep FC, Wiegerinck ET, et al. Survivin is an independent prognostic marker for risk stratification of breast cancer patients.
Clin Chem
2004
;
50
:
1986
–93.
18
Ashok BT, Chen YG, Liu X, et al. Multiple molecular targets of indole-3-carbinol, a chemopreventive anti-estrogen in breast cancer.
Eur J Cancer Prev
2002
;
11
Suppl 2:
S86
–93.
19
Chang X, Tou JC, Hong C, et al. 3,3′-Diindolylmethane inhibits angiogenesis and the growth of transplantable human breast carcinoma in athymic mice.
Carcinogenesis
2005
;
26
:
771
–8.
20
Hong C, Firestone GL, Bjeldanes LF. Bcl-2 family-mediated apoptotic effects of 3,3′-diindolylmethane (DIM) in human breast cancer cells.
Biochem Pharmacol
2002
;
63
:
1085
–97.
21
Hong C, Kim HA, Firestone GL, Bjeldanes LF. 3,3′-Diindolylmethane (DIM) induces a G(1) cell cycle arrest in human breast cancer cells that is accompanied by Sp1-mediated activation of p21(WAF1/CIP1) expression.
Carcinogenesis
2002
;
23
:
1297
–305.
22
Howells LM, Gallacher-Horley B, Houghton CE, Manson MM, Hudson EA. Indole-3-carbinol inhibits protein kinase B/Akt and induces apoptosis in the human breast tumor cell line MDA MB468 but not in the nontumorigenic HBL100 line.
Mol Cancer Ther
2002
;
1
:
1161
–72.
23
Kudoh K, Ramanna M, Ravatn R, et al. Monitoring the expression profiles of doxorubicin-induced and doxorubicin-resistant cancer cells by cDNA microarray.
Cancer Res
2000
;
60
:
4161
–6.
24
Zembutsu H, Ohnishi Y, Tsunoda T, et al. Genome-wide cDNA microarray screening to correlate gene expression profiles with sensitivity of 85 human cancer xenografts to anticancer drugs.
Cancer Res
2002
;
62
:
518
–27.
25
Anderton MJ, Jukes R, Lamb JH, et al. Liquid chromatographic assay for the simultaneous determination of indole-3-carbinol and its acid condensation products in plasma.
J Chromatogr B Analyt Technol Biomed Life Sci
2003
;
787
:
281
–91.
26
Shilling AD, Carlson DB, Katchamart S, Williams DE. 3,3′-diindolylmethane, a major condensation product of indole-3-carbinol, is a potent estrogen in the rainbow trout.
Toxicol Appl Pharmacol
2001
;
170
:
191
–200.
27
Sizemore N, Leung S, Stark GR. Activation of phosphatidylinositol 3-kinase in response to interleukin-1 leads to phosphorylation and activation of the NF-kappaB p65/RelA subunit.
Mol Cell Biol
1999
;
19
:
4798
–805.
28
Stresser DM, Blanchard AP, Turner SD, et al. Substrate-dependent modulation of CYP3A4 catalytic activity: analysis of 27 test compounds with four fluorometric substrates.
Drug Metab Dispos
2000
;
28
:
1440
–8.
29
Eisen MB, Spellman PT, Brown POBotstein D. Cluster analysis and display of genome-wide expression patterns.
Proc Natl Acad Sci U S A
1998
;
95
:
14863
–8.
30
Khatri P, Draghici S, Ostermeier GC, Krawetz SA. Profiling gene expression using onto-express.
Genomics
2002
;
79
:
266
–70.
31
Nilsson I, Hoffmann I. Cell cycle regulation by the Cdc25 phosphatase family.
Prog Cell Cycle Res
2000
;
4
:
107
–14.
32
Poggioli GJ, Dermody TS, Tyler KL. Reovirus-induced sigma1s-dependent G(2)/M phase cell cycle arrest is associated with inhibition of p34(cdc2).
J Virol
2001
;
75
:
7429
–34.
33
Brechot C. Oncogenic activation of cyclin A.
Curr Opin Genet Dev
1993
;
3
:
11
–8.
34
Erlanson M, Landberg G. Prognostic implications of p27 and cyclin E protein contents in malignant lymphomas.
Leuk Lymphoma
2001
;
40
:
461
–70.
35
Obaya AJ, Sedivy JM. Regulation of cyclin-Cdk activity in mammalian cells.
Cell Mol Life Sci
2002
;
59
:
126
–42.
36
Sherr CJ. D-type cyclins.
Trends Biochem Sci
1995
;
20
:
187
–90.
37
el-Deiry WS, Tokino T, Waldman T, et al. Topological control of p21WAF1/CIP1 expression in normal and neoplastic tissues.
Cancer Res
1995
;
55
:
2910
–9.
38
Kawamata N, Morosetti R, Miller CW, et al. Molecular analysis of the cyclin-dependent kinase inhibitor gene p27/Kip1 in human malignancies.
Cancer Res
1995
;
55
:
2266
–9.
39
Kobatake T, Yano M, Toyooka S, et al. Aberrant methylation of p57KIP2 gene in lung and breast cancers and malignant mesotheliomas.
Oncol Rep
2004
;
12
:
1087
–92.
40
Chen X, Kandasamy K, Srivastava RK. Differential roles of RelA (p65) and c-Rel subunits of nuclear factor kappa B in tumor necrosis factor-related apoptosis-inducing ligand signaling.
Cancer Res
2003
;
63
:
1059
–66.
41
Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindle checkpoint by survivin.
Nature
1998
;
396
:
580
–4.
42
Xia C, Xu Z, Yuan X, et al. Induction of apoptosis in mesothelioma cells by antisurvivin oligonucleotides.
Mol Cancer Ther
2002
;
1
:
687
–94.
43
Maeda T, Hanna AN, Sim AB, Chua PP, Chong MT, Tron VA. GADD45 regulates G2/M arrest, DNA repair, and cell death in keratinocytes following ultraviolet exposure.
J Invest Dermatol
2002
;
119
:
22
–6.
44
Schmidt M, Fernandez de Mattos S, van der Horst A, et al. Cell cycle inhibition by FoxO forkhead transcription factors involves downregulation of cyclin D.
Mol Cell Biol
2002
;
22
:
7842
–52.
45
Yakirevich E, Maroun L, Cohen O, Izhak OB, Rennert G, Resnick MB. Apoptosis, proliferation, and Fas (APO-1, CD95)/Fas ligand expression in medullary carcinoma of the breast.
J Pathol
2000
;
192
:
166
–73.
46
Stahl M, Dijkers PF, Kops GJ, et al. The forkhead transcription factor FoxO regulates transcription of p27Kip1 and Bim in response to IL-2.
J Immunol
2002
;
168
:
5024
–31.
47
Wonsey DR, Follettie MT. Loss of the forkhead transcription factor FoxM1 causes centrosome amplification and mitotic catastrophe.
Cancer Res
2005
;
65
:
5181
–9.
48
Hirokawa N. Microtubule organization and dynamics dependent on microtubule-associated proteins.
Curr Opin Cell Biol
1994
;
6
:
74
–81.
49
Bharti AC, Aggarwal BB. Chemopreventive agents induce suppression of nuclear factor-kappaB leading to chemosensitization.
Ann N Y Acad Sci
2002
;
973
:
392
–5.
50
Bharti AC, Aggarwal BB. Nuclear factor-kappa B and cancer: its role in prevention and therapy.
Biochem Pharmacol
2002
;
64
:
883
–8.
51
Clark AS, West K, Streicher S, Dennis PA. Constitutive and inducible Akt activity promotes resistance to chemotherapy, trastuzumab, or tamoxifen in breast cancer cells.
Mol Cancer Ther
2002
;
1
:
707
–17.