Chronic Protein Kinase B (PKB/c-akt) Activation Leads to Apoptosis Induced by Oxidative Stress–Mediated Foxo3a Transcriptional Up-regulation

Cytokines of the interleukin (IL)-3, IL-5, and granulocyte-macrophage colony-stimulating factor family play an important role as hematopoietic differentiation and survival factors (1). Critical antiapoptotic signals induced by these cytokines include activation of phosphatidylinositol 3-kinase (PI3K), which in turn promotes activation of protein kinase B (PKB; c-akt; ref. 2). In mammals, there are three PKB isoforms, PKBα, PKBβ, and PKBγ, which share a high degree of sequence homology. All three isoforms contain an NH₂-terminal pleckstrin homology domain, a catalytic domain and a COOH-terminal regulatory domain (3). PKBα is the most ubiquitously expressed and studies in PKBα-deficient mice have shown it to be indispensable for normal cell growth (4). The expression of PKBβ has its highest expression levels in insulin-responsive tissues. It is thus not surprising that PKBβ-deficient mice suffer from diabetes (5). PKBγ is expressed at the lowest levels, except for the brain and testes. PKBγ-deficient mice show impaired brain development (6). PKBα and PKBβ double knockout mice die shortly after birth (7).

PKB has been reported to inhibit apoptosis through a variety of molecular mechanisms, including direct phosphorylation and inhibition of the proapoptotic Bcl-2 family member Bad (8), glycogen synthase kinase-3 (GSK-3; ref. 9), and caspase-9 (10). More recently, it also has been shown that PKB directly phosphorylates and inhibits members of the Foxo subfamily of forkhead transcription factors Foxo1, Foxo3a, and Foxo4 (11). Phosphorylation of the Foxo proteins by PKB results in their cytoplasmic retention by interaction with 14-3-3 proteins, thereby sequestering them from their target genes (12). Foxo transcription factors regulate a variety of genes that influence cellular proliferation (p27^kip1 and cyclin D; refs. 13, 14), survival (FasL and Bim; refs. 15, 16), metabolism (PEPCK and G6Pase; ref. 17), and responses to stress [manganese superoxide dismutase (MnSOD) and catalase; ref. 18]. Therefore, regulation of Foxo activity is a critical means through which PKB modulates cellular homeostasis.

In a variety of human neoplasias, PKB activity is up-regulated. This up-regulation can be due to a variety of causes, including mutation of its intracellular activators, such as Ras or PI3K (19, 20), mutation or deletion of the tumor suppressor phosphatase and tensin homologue deleted on chromosome 10 (21, 22), or enhanced expression of one or more of the PKB isoforms (23). Besides inhibition of apoptosis and uncontrolled cell growth, enhanced PKB activity can also cause another feature commonly seen in malignancies, increased aerobic glycolysis (24). PKB directly regulates aerobic glycolysis by increasing surface expression of glucose transporters (25), by stimulating the mitochondrial association of hexokinase (26), and by phosphorylation of PFK2 (27). The fact that tumor cells enhance their aerobic glycolytic metabolism is seen as one of the primary hallmarks of cancer, a phenomenon termed the Warburg effect (28). It has been shown that, after withdrawal of growth factors, cells rapidly lose surface expression of nutrient transporters, such as Glut-1 and Glut-4 (29), leading to a rapid decline in glycolysis and a decrease in mitochondrial potential, resulting ultimately in the release of cytochrome c and the initiation of apoptosis (30). The heightened levels of glycolysis and mitochondrial activity enforced by PKB activation could therefore be an important mediator of the enhanced resistance to apoptosis. However, glycolysis also results in the production of reactive oxygen species (ROS) in cells. Whereas ROS levels fluctuate during the cell cycle and are suggested to be necessary as second messengers, in excess they can result in oxidative stress causing damage to lipids, proteins, and DNA (31). To counteract the effects of oxidative stress, cells have developed defense mechanisms in the form of intracellular antioxidants molecules, such as reduced glutathione (GSH), catalase, SOD, and thioredoxin, which protect cells from oxidative damage.

In this study, we have investigated the effect of chronic PKB activation on cellular survival and proliferation using cytokine-dependent bone marrow–derived Ba/F3 cells. For this purpose, we developed a system where PKBα can be inducibly activated. Surprisingly, we found that chronic PKB activation was unable to maintain long-term cell survival. Higher levels of oxidative stress caused by prolonged PKB activation resulted in increased expression of Foxo3a leading to expression of its transcriptional targets Bim and p27^kip1. Up-regulation of these proteins ultimately results in cell cycle arrest and apoptosis. Taken together, our data suggest that chronic PKB activation is in itself insufficient for hematopoietic cell survival. These findings have important consequences for our understanding of the processes leading to cellular transformation.

Cell culture. Ba/F3 cells were cultured in RPMI 1640 with 8% Hyclone serum (Life Technologies, Paisley, United Kingdom) and recombinant mouse IL-3 produced in COS cells (32). For the generation of clonal Ba/F3 cells stably expressing myrPKB:ER*, the SRα-myrPKB:ER* construct was electroporated into Ba/F3 cells together with pSG5 conferring neomycin resistance and maintained in the presence of 1 mg/mL G418 (Life Technologies) and IL-3. Clonal cell lines were generated by limited dilution. For cytokine withdrawal experiments, cells were washed twice with PBS and resuspended in AimV medium (Life Technologies).

Antibodies and reagents. Polyclonal antibodies against total and phosphorylated PKB (Ser⁴⁷³) were from Cell Signaling Technologies (Hitchin, United Kingdom). Anti-p27^kip1 was from Transduction Laboratories (Lexington, Kentucky). Anti-Bim was from Affinity BioReagents (Golden, CO). Foxo3a, phosphorylated c-Jun NH₂-terminal kinase (JNK; Thr¹⁸³/Tyr¹⁸⁵), actin, and estrogen receptor (ER) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The phosphorylated Foxo3a (Thr³²) was from Upstate Biotechnology, Inc. (Lake Placid, NY). Phosphorylated GSK-3α/β (Ser²¹/Ser⁹), phosphorylated signal transducer and activator of transcription 5 (STAT5; Tyr⁶⁹⁴), phosphorylated p38 (Thr¹⁸⁰/Tyr¹⁸²), and phosphorylated mitogen-activated protein kinase (MAPK) 42/44 (Thr²⁰²/Tyr²⁰⁴) were from New England Biolabs (Hitchin, United Kingdom). Carboxylfluorescein diacetate succinimidyl ester (CFSE) was from Molecular Probes (Carlsbad, CA). Buthionine sulfoximine (BSO) and DTT were from Sigma (Seelze, Germany). Thiolyte Monochlorobimane Reagent was from Calbiochem (Darmstadt, Germany). N-acetylcysteine (NAC) was from Zambon (Amersfoort, the Netherlands).

Western blotting. Cells were lysed in Laemmli buffer [0.12 mol/L Tris-HCL (pH 6.8), 4% SDS, 20% glycerol, 0.05 μg/μL bromphenol blue, 35 mmol/L β-mercaptoethanol] and boiled for 5 minutes and the protein concentration was determined. Equal amounts of sample were analyzed by SDS PAGE, electrophoretically transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA), and probed with the respective antibodies. Immunocomplexes were detected using enhanced chemiluminescence (Amersham, Buckinghamshire, United Kingdom).

Apoptosis assays. Cells were counted, washed twice with PBS, resuspended in AimV medium, and seeded in six-well dishes (5 × 10⁴ mL). Then, the cells were cultured in the presence or absence of IL-3 and/or 4-hydroxytamoxifen (4-OHT; 100 nmol/L), with the indicated amounts of NAC (250 μmol/L), BSO (1.0 or 0.1 mmol/L), or hydrogen peroxide (H₂O₂) added to the medium. Cells were then harvested at the indicated time points and washed with PBS. Samples were subsequently incubated for 15 minutes with Annexin V-FITC (Bender MedSystems, Vienna, Austria) in binding buffer [10 mmol/L HEPES-NaOH (pH 7.4), 150 mmol/L NaCL, 2.5 mmol/L CaCl₂]. Cells were washed and resuspended in binding buffer containing 1 μg/mL propidium iodide (Bender MedSystems). Fluorescence-activated cell sorting (FACS) analysis was done on a FACSCalibur at a wavelength of 550 nm.

Proliferation assays. Cells were counted, washed with PBS, and incubated in prewarmed PBS containing 2.5 μmol/L CFSE for 15 minutes. Cells were subsequently washed and resuspended in AimV medium with or without IL-3 and/or 4-OHT (100 nmol/L) and seeded in six-well dishes (10⁵ per mL). Proliferation was visualized as the decrease of fluorescent CFSE probe per cell as measured by flow cytometry analysis in the FL-1 channel.

Measurement of GSH levels. Cells were cultured in the presence or absence of IL-3 and/or 4-OHT (100 nmol/L), together with NAC (250 μmol/L), DTT (100 μmol/L), GSH (250 μmol/L), or BSO (1.0 or 0.1 mmol/L) for the indicated time. To determine the total intracellular GSH content, samples (5 × 10⁶ cells) were washed and resuspended in 400 μL PBS containing 2 mmol/L monochlorobimane. On incubation for 30 minutes at 37°C, cells were centrifuged and resuspended in 400 μL PBS. Aliquots of 100 μL were taken to measure the fluorescence, either using the Fluoroskan Ascent from ThermoLabsystems (Almere, the Netherlands) at excitation wavelength of 385 nm and emission wavelength of 450 nm or by FACS analysis on a FACSCalibur in the FL-1 channel.

Transient electroporations and luciferase assay. For transient transfections, Ba/F3 cells were electroporated by using a Bio-Rad (Veenendaal, the Netherlands) Gene Pulser at 350 V and 950 μF with 10 μg of the pGL3-Foxo3a promoter reporter construct plus 1 μg pRLTK Renilla plasmid (Promega, Leiden, the Netherlands) to normalize for transfection efficiency. The Foxo3a promoter construct contains 1,146 bp upstream of the mouse Foxo3a coding region cloned into the KpnI and XhoI sites in pGL3-basic. After transfection, cells were cultured in RPMI 1640 containing 8% serum and IL-3 and left to recover for 16 hours. Then, cells were washed, transferred to cytokine-free medium, and treated with 200 nmol/L tamoxifen. At the indicated time points, the cells were washed twice with PBS and lysed in 100 μL passive lysis buffer for 5 minutes. After one freeze and thaw cycle, insoluble cell debris were spun down and the supernatant fraction was assayed for luciferase activity using Dual-Luciferase Reporter Assay System (Promega).

RNA isolation and real-time quantitative PCR. Total RNA was isolated using the RNeasy kit (Qiagen, Venlo, the Netherlands), and the concentration and purity of each sample were assessed by absorbance at 260 nm and by the 260 nm/280 nm ratio, respectively. The integrity of the RNA was verified by observing the rRNA bands in ethidium bromide–stained gel under UV irradiation.

Equal amounts of total RNA (2 μg) were reversed transcribed with SuperScript III reverse transcriptase (Invitrogen, Breda, the Netherlands). The resulting cDNA was amplified using an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) with the following primer pairs: mouse FOXO3A, TCCCAGATCTACGAGTGGATGG (sense) and CCTTCATTCTGAACGCGCAT (antisense) and mouse L19 GGAAAAAGAAGGTCTGGTTGGA (sense) and TGATCTGCTGACGGGAGTTG (antisense). L19, a nonregulated ribosomal housekeeping gene, was used as an internal control to normalize input RNA.

PKB activation is insufficient for long-term survival. To explore the mechanisms by which PKB regulates cytokine-mediated survival and proliferation in hematopoietic cells, we generated bone marrow–derived Ba/F3 cells stably expressing an inducible active PKBα (myrPKB:ER). The activation of the myristylated PKBα is, in the absence of 4-OHT, inhibited by heat-shock and chaperone proteins that associate with the fused ER hormone-binding domain. In the presence of 4-OHT, these proteins dissociate, allowing PKB to become phosphorylated and activated. Thus, in these cells, PKB activation can be directly, and specifically, induced by addition of 4-OHT (Fig. 1A,, top). 4-OHT-mediated PKB activation was sufficient to rapidly induce the phosphorylation of Foxo3a and GSK-3 (Fig. 1A). In contrast to stimulation of the cells with IL-3, 4-OHT treatment was unable to induce phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) MAPK, p38 MAPK, STAT5, or JNK (Fig. 1A,, bottom). The stability and activity of myrPKB:ER was followed over a longer period. myrPKB:ER cells were cytokine starved and then treated with 4-OHT for up to 96 hours. As a control, cells were either cytokine starved or stimulated with IL-3 for 24 hours. Stimulation of Ba/F3 myrPKB:ER cells with 4-OHT resulted in phosphorylation of the myrPKB:ER protein itself as well as Foxo3a and GSK-3 for at least 96 hours (Fig. 1B). Prolonged activation of the myrPKB:ER protein did not result in its down-regulation (Fig. 1B , top).

Subsequently, we investigated whether PKB activation alone was sufficient to induce proliferation. We cytokine-starved myrPKB:ER cells and left them untreated or treated with IL-3, 4-OHT, or both for up to 96 hours. Using CFSE, we measured the decrease in fluorescence per cell every 24 hours, an indication of proliferation. In addition, proliferation was monitored by counting cells. Both methods showed that PKB activation alone was sufficient for cells to proliferate (Fig. 2A,, 4-OHT), albeit not to the same extent as cells stimulated with IL-3 (Fig. 2A, IL-3). Cytokine-induced proliferation capacity was not perturbed when cells were stimulated with 4-OHT and IL-3 simultaneously (Fig. 2A,, IL-3/4-OHT). Because activation of PKB is thought to be an important factor contributing to cell survival, we wished to establish the effect of chronic PKB activation on survival. We again cytokine starved the myrPKB:ER cell line and left them untreated or treated them with IL-3, 4-OHT, or both for up to 96 hours and measured the percentage of living cells every 24 hours. 4-OHT-mediated PKB activation rescued Ba/F3 cells from cytokine withdrawal–induced apoptosis (Fig. 2B). Surprisingly, these antiapoptotic effects were relatively short lived; cells initiated programmed cell death after 48 hours (Fig. 2B). These apoptotic events were not due to reduced expression of myrPKB:ER nor due to inactivation of PKB judging from the phosphorylation status of myrPKB:ER and its substrates GSK-3 and Foxo3a (Fig. 1B). Importantly, chronic PKB activation in combination with IL-3 did not cause apoptosis (Fig. 2B). Because previously observed effects of PKB activation on survival and metabolism have been attributed to mammalian target of rapamycin (mTOR) activity, we were interested if the transient antiapoptotic activity of PKB was indeed mTOR dependent. To investigate this, we measured apoptosis after 4-OHT stimulation in the absence or presence of rapamycin, a specific mTOR inhibitor. In contrast to IL-3, we observed that mTOR inhibition was able to almost completely block the rescue of cytokine-starved cells by PKB activation (Fig. 2C). These data show that the transient antiapoptotic activity of PKB is dependent on mTOR activity; however, PKB activation alone is insufficient to maintain long-term cell survival in the absence of additional factors.

Foxo3a expression is induced by prolonged activation of PKB. Because chronic PKB activation was insufficient for long-term survival, we sought to establish the mechanism underlying cell death. The myrPKB:ER cell line was cytokine starved and subsequently left untreated or treated with either IL-3 or 4-OHT for up to 96 hours. During prolonged 4-OHT treatment, we observed that Foxo3a remains phosphorylated (Fig. 1B); however, Foxo3a protein levels increase dramatically (Fig. 3A). This increase in Foxo3a protein levels is already clearly visible within 24 hours of PKB activation (Fig. 3B). Quantitive analysis of the amounts of phosphorylated and unphosphorylated Foxo3a protein showed that the ratio between the two rapidly decreased after 48 hours of PKB activation (data not shown). Because chronic PKB activation in combination with cytokine treatment did not cause apoptosis or a delay in proliferation, we were interested if the presence of cytokine would have an effect on Foxo3a up-regulation. Cells were cytokine starved and left untreated or treated with IL-3, 4-OHT, or both for 24 hours. Foxo3a protein was only up-regulated when PKB was activated in the absence of cytokine (Fig. 3C). These experiments indicate that PKB activation in the absence of additional survival factors results in up-regulation of Foxo3a expression levels.

Expression of Foxo3a transcriptional targets induced by long-term PKB activation. Because the up-regulation of Foxo3a protein levels observed during chronic PKB activation leads to a decrease in the ratio of phosphorylated compared with total Foxo3a protein, we sought to establish if this leads to increased transcriptional activity. Indeed, we found that, together with the up-regulation of Foxo3a, transcriptional targets Bim and p27^kip1 were also up-regulated (Fig. 4). Up-regulation of Foxo3a protein already occurs within the first 24 hours of PKB activation (Fig. 3B), whereas the up-regulation of p27^kip1 and Bim expression occurs somewhat later. During prolonged PKB activation, down-regulation of Bcl-xl was also observed (Fig. 4). The up-regulation of Bim and p27^kip1 and the down-regulation of Bcl-xl are indicative for the fact that Foxo3a activity is no longer inhibited and provide an explanation as to why these cells are apoptotic after chronic PKB activation.

Oxidative stress leads to an up-regulation of Foxo3a protein. We have established that, during prolonged PKB activation, Foxo3a expression is up-regulated resulting in transcription of proapoptotic target genes. However, we were interested in determining the molecular mechanism underlying this up-regulation. It has been observed in various tumors, in which PKB activity is enhanced, that there is a concomitant increase in aerobic glycolysis and mitochondrial activity. This increase in metabolic activity in the cell can lead to increased levels of ROS resulting in oxidative stress. Cells have specific mechanisms to protect themselves against ROS, including the up-regulation of MnSOD. However, although MnSOD has been reported to be a transcriptional target of Foxo3a (18), surprisingly we observed that after long-term PKB activation, MnSOD levels actually decrease (Fig. 4A), indicating that at least one important protective mechanism against oxidative stress is impaired.

To determine whether an increase in intracellular oxidative stress might be responsible for increased Foxo3a expression, we used H₂O₂ and NAC, a widely used thiol-containing oxygen radical scavenger. Addition of H₂O₂ to the culture medium induced apoptosis in Ba/F3 cells, which was prevented by the addition of NAC (Fig. 4B). To determine if an increase in ROS can indeed lead to increased levels of Foxo3a protein, Ba/F3 cells were treated with H₂O₂ and subsequently cell lysates were prepared and analyzed for Foxo3a expression. Similar to chronic PKB activation, H₂O₂ treatment was also able to elevate levels of Foxo3a protein (Fig. 4C). To investigate whether increased oxidation results in the death of Ba/F3 myrPKB:ER cells after prolonged PKB activation, we measured apoptosis after 4-OHT stimulation in the absence or presence of NAC. We observed that addition of NAC was able to significantly decrease the amount of apoptosis observed after PKB activation (Fig. 5A).

Although NAC is a free radical scavenger, it can also act as an aminothiol and a precursor of intracellular cysteine and GSH. GSH, the most abundant thiol antioxidant in mammalian cells, directly reacts with ROS, functions as a cofactor for antioxidant enzymes, such as gluthatione preroxidases, and maintains thiol redox potential in cells. Under normal circumstances, biological environments and reducing thiol buffers, such as GSH, within cells are predominantly in a reduced state. However, under conditions of oxidative stress, the endogenous pool of reduced thiols can become depleted. To test if thiol buffers are reduced after prolonged PKB activation, we measured GSH levels using the GSH-sensitive probe monochlorobimane. BSO, a selective GSH biosynthesis inhibitor was used as a negative control (Fig. 5B,, left). GSH levels are significantly decreased in both cytokine-starved cells and in cells that have PKB chronically activated. We also observed that GSH depletion through BSO treatment (Fig. 5B,, middle) results in apoptosis in the Ba/F3 cells either in the presence of cytokine or together with chronic PKB activation (Fig. 5B,, right). Addition of NAC to the medium is able to significantly replenish the depleted pool of GSH (Fig. 5B,, left). To investigate if NAC may function by replenishing a depleted pool of reducing thiols, we measured apoptosis after 4-OHT stimulation in the absence or presence of GSH or DTT, a general thiol reductant. We observed that addition of either GSH or DTT significantly decreased the amount of apoptosis observed after PKB activation (Fig. 5C), revealing the key role of oxidation in the apoptotic effect of chronic PKB activation.

Furthermore, we investigated if GSH depletion by BSO has an effect on Foxo3a protein levels. As shown in Fig. 5D, (top), GSH depletion caused similar up-regulation of Foxo3a as was observed with chronic PKB activation. Moreover, addition of NAC to the culture medium was able to prevent the up-regulation of Foxo3a protein compared with cells treated with 4-OHT alone (Fig. 5D , bottom). Thus, Ba/F3 cells are sensitive to increased levels of oxidative stress leading to up-regulation of Foxo3a and apoptosis. Relieving the levels of oxidative stress by addition of NAC can delay Foxo3a up-regulation and the onset of apoptosis.

Increased ROS levels induce transcriptional activity of the Foxo3a promoter. Although we have shown regulation of Foxo3a protein levels by chronic PKB activation, we wished to determine whether this could occur at the transcriptional level. Ba/F3 cells were treated with 4-OHT in the presence or absence of transcription inhibitor actinomycin D. Actinomycin D completely blocked the up-regulation of Foxo3a protein by 4-OHT (Fig. 6A). Therefore, we examined if the effect of PKB activation on Foxo3a protein levels was also reflected on the level of Foxo3a mRNA. Real-time quantitative PCR showed an increase in Foxo3a mRNA after 4 hours of PKB activation (Fig. 6B). Furthermore, H₂O₂ treatment also resulted in an increase of Foxo3a mRNA (Fig. 6C).

In addition to analyzing Foxo3a mRNA, we also examined Foxo3a promoter regulation by PKB activation. To this end, Ba/F3 cells were transiently transfected with a luciferase reporter construct under the control of the Foxo3a promoter. Subsequently, luciferase activity was measured after 4-OHT mediated PKB activation. As shown in Fig. 6D, (top), chronic PKB activation induced Foxo3a promoter activity after 24 hours. To investigate whether Foxo3a promoter activity was also oxidative stress dependent, luciferase activity was measured after addition of H₂O₂ to the culture medium. Figure 6D  (bottom) shows that, on addition of H₂O₂, luciferase reporter activity increases. Taken together, these data suggest that chronic PKB activation leads to a state of oxidative stress, which subsequently induces Foxo3a transcription, leading to increased levels of Foxo3a protein. This increased Foxo3a expression leads to transcriptional up-regulation of proapoptotic target genes, eventually resulting in programmed cell death.

A tumor develops when the balance between generation and growth of new cells and death and removal of excess cells is perturbed. Aberrant PKB activation has now been implicated in the pathogenesis of a variety of human cancers. Mouse models have suggested that unregulated PKB signaling can contribute to malignancy either alone or in cooperation with additional genetic alterations (33). However, to properly interpret studies investigating the role of this kinase in oncogenesis, it is important to take into account that diverse genetic events and cellular changes occur in the development of a tumor. We have used a cellular model, in which PKB activity can be rapidly and inducibly activated providing a simplified model for understanding the molecular mechanisms underlying transforming capacity of this protein. Interestingly, our data suggest that chronic PKB activation can lead to cellular oxidative stress, eventually resulting in apoptosis through increased Foxo3a expression. Importantly, this shows that PKB activity alone is insufficient for cell survival and additional signals induced by cytokine stimulation are required. Indeed, it has been shown that expression of either activated Ras or PKB alone is insufficient to cause glioblastoma in mice, although their coexpression leads to aggressive disease (34).

The fact that dysregulation of PKB activation can lead to oxidative stress in cells can be explained by the mechanism by which PKB inhibits apoptotic events. PKB-mediated survival depends at least in part on the maintenance of glucose metabolism. PKB activation has been shown to maintain mitochondrial membrane potential and hexokinase activity in situations that would otherwise lead to apoptosis, such as serum withdrawal. PKB activation leads to an increase in nutrient uptake and enhanced cellular metabolism through a mTOR-dependent mechanism (35). mTOR can be activated by PKB either by direct phosphorylation (36) or by phosphorylation and inhibition of TSC2 (37). In our system, PKB-mediated survival is also dependent on mTOR activity and thus the key role mTOR plays in coordinating the cellular response to extracellular nutrient levels is of great importance to survival induced by chronic PKB activation. However, metabolic activity also results in the production of ROS and, in absence of sufficient cellular mechanisms to compensate for this, a state of oxidative stress. Unfortunately, we were unable to detect increased levels of ROS due to lack of sensitivity of available methods. However, experiments using both H₂O₂ and NAC support that chronic PKB activation can lead to oxidative stress and that the observed effects on Foxo3a regulation are oxidative stress dependent. In our system, the chronic activation of PKB leads to a prolonged situation of cellular oxidation resulting in depletion of cellular protection mechanisms, including MnSOD and GSH.

Excessive ROS and oxidative stress can result in cellular damage but also in altered signal transduction. Recently, there have been several reports describing the regulation of Foxo transcription factors by cellular oxidative stress. Essers et al. (38) showed that oxidative stress induces the activation of Foxo4. Oxidative stress leads to the activation of small GTPase Ral and this results in a JNK-dependent phosphorylation of Foxo4, leading to nuclear translocation and transcriptional activation. Another post-translational modification observed for Foxos in response to cellular stress is changes in acetylation. In 2005, three independent groups reported that Foxos are acetylated in response to cellular stress. Although these studies show that regulation of acetylation of Foxos leads to changes in transcriptional activation, the functional consequences remain unclear (39–41). Here, we are the first to show that Foxo3a can also be regulated by oxidative stress at the level of expression. This shows that cellular oxidative stress can modulate Foxo transcriptional activity through multiple molecular mechanisms.

How could cellular oxidation lead to up-regulation of Foxo3a protein levels? We have shown clearly that Foxo3a expression is regulated at the level of transcription (Fig. 6A and D). Studies have shown that changes in redox status can regulate phosphorylation and activation of a variety of intracellular signaling molecules (42). This can subsequently lead to changes in the activity of redox-sensitive transcription factors, including components of the nuclear factor-κB and activator protein-1 (AP-1) complexes (43). Indeed, with homology to Foxo3a, regulation of AP-1 activity through oxidative stress can be achieved through changes in transcription of genes encoding AP-1 subunits, control of mRNA stability, post-translational processing, and turnover of protein. It is likely that oxidation-mediated modulation of such transcription factors is responsible for the increased Foxo3a expression we observe after chronic PKB activation.

Here, we investigate the effect of chronic PKBα on survival and proliferation of Ba/F3 cells. Recently, Jin et al. (44) investigated the effect of chronic PKBβ activation in human kidney epithelial cells (HEK293). This chronic activation resulted in alterations in cellular growth, size, and the appearance of aneuploid cells. After prolonged activation, cells underwent extensive multinucleation caused by both endomitosis and cell fusion. In our system, we do not observe these phenomena; this is most likely due to the distinct nature of the two cell lines used in these studies. It is also possible that, due to their factor-dependent nature, hematopoietic cell lines are less likely to accumulate major alterations because they are more prone to apoptosis than HEK293 cells. Transgenic mice expressing constitutively active PKB targeted to the lymphocyte population show lymphoproliferation (45, 46). In our study, we also observed increased proliferation when PKB was activated in the presence of cytokine (Fig. 2A,, left), but because survival was already optimal under these conditions, there was no further advantage of PKB activation (Fig. 2B). This indicates that, in our system, the antiapoptotic activity of PKB does not lead to apoptosis in combination with other stimulating factors, but that chronic activation enhances proliferation and could increase resistance to apoptotic stimuli as was shown by Jones et al. (47). PKB activation only enhances existing survival and proliferation signals but its chronic activation seems to make these cells more sensitive to targeting or depletion of protective mechanisms, such as GSH or MnSOD.

Insulin and insulin-like growth factor-I have beneficial effects on cardiomyocyte function and survival, including protection against ischemic injury. This is thought to be mediated in part due to PKB activation (48), and acute PKB activation is cardioprotective. However, recent studies have shown that chronic PKB activation actually results in decreased functional recovery and increased injury after ischemia/reperfusion injury (IRI; ref. 49). In these studies, PKB-induced injury could be abrogated by constitutive PI3K activation. Interestingly, we found that, in contrast to PKB, chronic PI3K activation was indeed sufficient for cytokine-independent Ba/F3 survival (data not shown). Our data suggest a possible molecular mechanism underlying the detrimental effects of chronic PKB activation in IRI, suggesting that prolonged PKB activation in cardiomyocytes might also lead to increased oxidative stress and cellular damage.

We show that increased expression of Foxo3a ultimately results in up-regulation of p27^kip1 and Bim protein levels together with down-regulation of Bcl-xl. This can be explained because Bcl-xl expression is inhibited by Bcl-6, which is a transcriptional target of Foxo4 (50). Another known Foxo3a target MnSOD is down-regulated during Foxo3a activation in this cytokine-deprived situation. This indicates that, in contrast to other cell systems, Foxo3a transcriptional up-regulation is insufficient to protect cells against oxidative stress. Bone marrow–derived Ba/F3 cells apparently do not have an adequate mechanism to deal with the enhanced oxidative environment caused by chronic PKB activation.

A cell must successfully overcome a series of hurdles before it can be considered to be cancerous. Our data suggest that, although chronic activation of PKB may indeed be a crucial factor in bypassing normal failsafe mechanisms, allowing factor independent growth and survival, additional mechanisms are required to enable “PKB-transformed” cells to cope with the detrimental effects of uncontrolled glycolysis. Dysregulation of PKB activity is therefore in itself insufficient for hematopoietic cell survival, and cells are “culled” through up-regulation of the proapoptotic Foxo3a transcription factor. These findings have important consequences for our understanding of the processes leading to cellular transformation.

Grant support: ZonMW grants (A.G.M. van Gorp and K.U. Birkenkamp).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Ines Soeiro for technical assistance and Dr. A. Klippel for kindly providing us with the SRα-myrPKB:ER* construct.