Migration stimulating factor (MSF) is a truncated oncofetal fibronectin isoform expressed by fetal and tumor-associated cells. MSF mRNA is distinguished from other fibronectin isoforms by its size (2.1 kb) and the inclusion of a specific intronic sequence at its 3′ end. Initial Northern blot analysis with a MSF-specific probe indicated the presence of this 2.1-kb transcript and an additional unexpected 5.9-kb RNA present in both MSF-secreting (fetal) and nonsecreting (adult) fibroblasts. Our investigations into the nature of these transcripts and their relationship to MSF protein secretion revealed that the 5.9-kb mRNA is a second MSF-encoding transcript. Both these mRNAs have identical coding sequence and differ only in the length of their intron-derived 3′-untranslated region (UTR). The 5.9-kb MSF mRNA is retained in the nucleus whereas the 2.1-kb mRNA is not. MSF-secreting fetal fibroblasts have significantly lower nuclear levels of the 5.9-kb mRNA and correspondingly higher cytoplasmic levels of the 2.1-kb transcript than their nonsecreting adult counterparts. Adult fibroblasts induced to secrete MSF by treatment with transforming growth factor-β1 displayed similar changes in their respective levels of MSF mRNA, but not those of a control gene. When cloned downstream of a reporter gene, only the longer 3′-UTR retained coding sequence within the nucleus. We conclude that expression of MSF protein is regulated by 3′-UTR truncation of the 5.9-kb nuclear-sequestered “precursor” MSF mRNA and nuclear export of mature 2.1-kb message. Inducible 3′-UTR processing represents a novel regulatory mechanism involved in cancer pathogenesis that may open new avenues for therapeutic gene delivery.

Migration stimulating factor (MSF) is a truncated oncofetal isoform of fibronectin (1). The 2.1-kb MSF mRNA is transcribed from the Fn1 gene and is generated by read-through of the intron separating the 12th and 13th exons of this gene (exons III-1a and III-1b). As a consequence, MSF mRNA contains (a) a 1,941-bp sequence identical to the 5′ coding sequence of fibronectin, extending to and including exon III-1a, and (b) a contiguous intron-derived 30-bp coding sequence and 165-bp 3′-untranslated region (UTR) containing five in-frame stop codons and terminating in a poly(A) tail. The deduced 657-amino-acid sequence comprises the 70-kDa NH2 terminus of fibronectin and a unique (intron-derived) 10-amino-acid COOH terminus.

Immunohistochemical studies (using antibodies raised against the MSF-specific COOH-terminal decamer) indicate that MSF is expressed by keratinocytes, fibroblasts, and vascular endothelial cells in fetal, but not adult, skin (1). MSF is not significantly expressed by cells in healthy breast tissue but may be exuberantly expressed by mammary carcinoma cells as well as by tumor-associated stromal fibroblasts and endothelial cells. Recombinant MSF protein displays a number of potent bioactivities both in vitro and in vivo, including stimulation of cell migration, hyaluronan synthesis, and angiogenesis (26). MSF-specific bioactivity has been detected in the serum of >90% of breast cancer patients compared with ∼10% of healthy age- and sex-matched controls (7) and initial ex vivo observations suggest that elevated MSF expression in breast tumors at presentation is associated with poorer prognosis.1

1

Perrier et al., in preparation.

Taken together, these various observations support the suggestion that MSF plays a significant role in cancer progression (1, 8, 9).

Using a MSF-specific probe (based on the 175 bp of intron-derived sequence at the 3′ end of the MSF mRNA transcript), Northern blot analysis of RNA extracted from MSF-expressing (fetal) and nonexpressing (adult) fibroblasts indicated the presence of both the 2.1-kb MSF transcript and a 5.9-kb RNA in the two cell types. In view of the unexpected nature of these findings, the objectives of this study have been to (a) characterize the 5.9-kb RNA, (b) understand its relationship to the previously cloned 2.1-kb MSF transcript, and (c) elucidate the mechanistic basis of the apparently discordant relationship between the expression of these two transcripts and the production of MSF protein.

Cells and reagents. The fetal (n = 5) and adult (n = 5) fibroblast lines used in this study were established and maintained as previously described (1).

Recombinant human transforming growth factor (TGF)-β1 was purchased from Sigma (Poole, Dorset, England, United Kingdom). The monoclonal anti–green fluorescent protein (GFP; JL-8) and polyclonal anti-fibronectin antibodies (A0245) were purchased from BD Biosciences (Palo Alto, CA) and DAKO (Ely, Cambridgeshire, England, United Kingdom), respectively. The two anti-MSF monoclonal antibodies were produced in-house. The first (mabVSI7.1) was raised against the MSF-unique 3′ decamer, VSIPPRNLGY, and was used for immunodetection. The second (mabPepQ5.1) was a function-neutralizing antibody and was raised against the bioactive IGD motif and flanking amino acids, TNEGVMYRIGDQWDKQHDMGH, located in the ninth type I module of MSF; mabPepQ5.1 effectively abrogated MSF mitogenic activity (1).

RNA extraction and Northern blots. RNA was extracted from the cytoplasm and nucleus separately and treated with DNase I, as instructed by the manufacturer (RNeasy kit: Qiagen, Crawley, West Sussex, England, United Kingdom). Northern blots were done nonisotopically using the Strip-EZ RNA, BrightStar-Psoralen-Biotin, NorthernMax-Gly, and BrightStar BioDetect-Biotin kits (Ambion, Austin, TX). Blots detecting GFP mRNA were done on polyadenylated [poly(A)] mRNA isolated from total RNAs using the MicroPoly(A)Purist kit (Ambion). Northern blot probes were generated by PCR and cloned into the pGEM-T Easy vector (Promega, Madison, WI), which was subsequently modified to include a CU Minus T3 promoter sequence (Ambion) to aid full-length probe manufacture.

Reverse transcription and PCR. PCR primer sequences for all reactions are provided in Table 1. These include Northern blot probe generation (probes U, GFP, and 1-4), mapping of the 5.9-kb MSF 3′-UTR [primer sets PCR 1-10 and poly(A)], and quantitative real-time PCR [primer sets MSF21, MSF59, GFP, human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and mouse GAPDH]. Reverse transcription was done at 42°C with a final concentration of 5 mmol/L MgCl2 using the ImProm II system (Promega).

Table 1.

PCR primer sequences

Primer setOligomer (sense 5′-3′)Oligomer (antisense 5′-3′)
PCR 1 GCATTGCCAACCTTTACAGAC AAACTTCCCTCCCATCATCTC 
PCR 2 GATTGTTCTTCCAATGTGG TTTAACCGCCTGGGTTGGTC 
PCR 3 TAACTCCAAAGTTCATGGCTC TCTAAGCCAGCTACGCAGTTG 
PCR 4 ACAGTGCTTCCAAATCAGAC AACAGAATCTCCCTCTGTTGC 
PCR 5 AGCTGAGGTAGGAGAATCAC CTGCCCAGACAAAGTTGAGG 
PCR 6 AATCTCAGACACTGGGAATG GGCCAGATTATGAACATAGG 
PCR 7 TCGTGTCTTTCTCATTGGCTC ATGGAGTTTCGCTCTTGTTGC 
PCR 8 AAGCTGAGGCAGGACAATCG CCCTTCAGAAAAGATGAGACTC 
PCR 9 TTGAGGAAATGGTTGACTGGG CTCTCTGAAGTACAGAAATGCC 
PCR 10 GCATTTCTGTACTTCAGAGAG CAGAGTGATATGTGATATGCC 
Poly(A) GCATTTCTGTACTTCAGAGAG (a) ATCTTCCGTGTCAGCTCC(T)18 
  (b) ATCTTCCGTGTCAGCTCC 
Probe U GTGAGTATCCCACCCAGAAAC CAGTCTACAAGTCAATTTAA 
Probe 1 TTGCCAACCTTTACAGAC AGGTCTCCACCTGAGAATG 
Probe 2 AGTAGAAGGTAGCAGCACAG GTCACTTCCACAAACTGCAG 
Probe 3 GATTGTTCTTGCCCAATGTGG AAACTTCCCTCCCATCATCTC 
Probe 4 TCGTGTCTTTCTCATTGGCTC GGCCAGATTATGGACATAGGG 
Probe GFP TAAACGGCCACAAGTTCAGC TGTTCTGCTGGTAGTGGTCG 
MSF21 ACCCAGAAACCTTGGATAC GTAAAACGACGGCCAGTG 
MSF59 GCTCATATCCAAGAATGAGTC CTCTCTGAAGTACAGAAATGCC 
Human GAPDH GGTGAAGGTCGGAGTCAACGG GAGGGATCTCGCTCCTGGAAG 
Mouse GAPDH ACCCCTTCATTGACCTCAAC TCCACGACATACTCAGCAC 
GFP GAACGGCATCAAGGTGAAC CTTGTACAGCTCGTCCATG 
Primer setOligomer (sense 5′-3′)Oligomer (antisense 5′-3′)
PCR 1 GCATTGCCAACCTTTACAGAC AAACTTCCCTCCCATCATCTC 
PCR 2 GATTGTTCTTCCAATGTGG TTTAACCGCCTGGGTTGGTC 
PCR 3 TAACTCCAAAGTTCATGGCTC TCTAAGCCAGCTACGCAGTTG 
PCR 4 ACAGTGCTTCCAAATCAGAC AACAGAATCTCCCTCTGTTGC 
PCR 5 AGCTGAGGTAGGAGAATCAC CTGCCCAGACAAAGTTGAGG 
PCR 6 AATCTCAGACACTGGGAATG GGCCAGATTATGAACATAGG 
PCR 7 TCGTGTCTTTCTCATTGGCTC ATGGAGTTTCGCTCTTGTTGC 
PCR 8 AAGCTGAGGCAGGACAATCG CCCTTCAGAAAAGATGAGACTC 
PCR 9 TTGAGGAAATGGTTGACTGGG CTCTCTGAAGTACAGAAATGCC 
PCR 10 GCATTTCTGTACTTCAGAGAG CAGAGTGATATGTGATATGCC 
Poly(A) GCATTTCTGTACTTCAGAGAG (a) ATCTTCCGTGTCAGCTCC(T)18 
  (b) ATCTTCCGTGTCAGCTCC 
Probe U GTGAGTATCCCACCCAGAAAC CAGTCTACAAGTCAATTTAA 
Probe 1 TTGCCAACCTTTACAGAC AGGTCTCCACCTGAGAATG 
Probe 2 AGTAGAAGGTAGCAGCACAG GTCACTTCCACAAACTGCAG 
Probe 3 GATTGTTCTTGCCCAATGTGG AAACTTCCCTCCCATCATCTC 
Probe 4 TCGTGTCTTTCTCATTGGCTC GGCCAGATTATGGACATAGGG 
Probe GFP TAAACGGCCACAAGTTCAGC TGTTCTGCTGGTAGTGGTCG 
MSF21 ACCCAGAAACCTTGGATAC GTAAAACGACGGCCAGTG 
MSF59 GCTCATATCCAAGAATGAGTC CTCTCTGAAGTACAGAAATGCC 
Human GAPDH GGTGAAGGTCGGAGTCAACGG GAGGGATCTCGCTCCTGGAAG 
Mouse GAPDH ACCCCTTCATTGACCTCAAC TCCACGACATACTCAGCAC 
GFP GAACGGCATCAAGGTGAAC CTTGTACAGCTCGTCCATG 

The PCR used to identify the location of the 5.9-kb MSF mRNA poly(A) tail employed a sense primer in combination with two antisense primers (a and b, Table 1). The primers were used at an a/b ratio of 1:9. A total of 10 pmol of sense and antisense primers were used in this reaction and, apart from three initial cycles at annealing temperature 42°C, the remainder of the amplification was a standard touchdown PCR. Standard touchdown PCR using Platinum Taq polymerase (Invitrogen, Paisley, Scotland, United Kingdom) was used for all the other amplification reactions, apart from the quantitative PCR which was previously described (1).

PCR strategy for distinguishing 2.1-kb and 5.9-kb MSF cDNAs. The 2.1-kb MSF mRNA was distinguished from the 5.9-kb transcript on the basis of size by using an oligo-dT primer with a 5′ M13 sequence modification [5′-GTAAAACGACGGCCAGTG(T)18-3′] for reverse transcription followed by amplification using a coding sequence–specific primer in combination with an M13 sequence–specific primer (primer set: MSF21). The 5.9-kb MSF cDNA was amplified using primers (primer set: MSF59) amplifying intronic sequence <100 bp upstream of its poly(A) tail. All primer sequences are shown in Table 1. Independent amplification of the RNA used for the reverse transcription reactions confirmed the absence of contaminating genomic DNA.

Green fluorescent protein vector manufacture and transfection. The pEGFP-C1 vector (Clontech, Mountain View, CA) was modified using the upstream BsrGI site in combination with either the EcoRI site for inserting the 2.1-kb MSF 3′-UTR or the PstI site for the 5.9-kb MSF 3′-UTR. The appropriate sequences (terminal 7 bp of GFP and in-frame stop codon) were added by mutational PCR. The 5.9-kb MSF 3′-UTR was assembled by cloning three smaller PCR fragments. All constructs were sequenced in both directions at all stages of manufacture to ensure sequence fidelity. NIH 3T3 murine fibroblasts were transfected using FuGENE 6 as instructed (Roche, Lewes, East Sussex, England, United Kingdom). Experiments were initially done with uncloned lines. These were later repeated with individual subclones established from these lines. Individual clones performed in exactly the same manner as the parental line from which they were established.

Statistical analyses. Overall differences were assessed by the Kruskal-Wallis test and comparisons between individual groups were made using the two-tailed Mann-Whitney U test.

Identification and molecular characterization of a second MSF mRNA. The previously cloned MSF cDNA is a 2.1-kb transcript (Fig. 1A), the upstream 1,941 bases of coding sequence being derived from the first 12 exons of Fn1 and the following downstream 175 bases from the contiguous intronic sequence separating the 12th and 13th exons (1). The truncated size of the MSF message and the presence of the intron-derived 3′ sequence distinguish MSF from all other “full-length” Fn1 transcripts.

Figure 1.

Identification of a new MSF mRNA. A, diagrammatic representation of the upstream 130 kb of the Fn1 gene locus (G), the 2.1-kb MSF mRNA (MSF), and the upstream 2.6 kb of a full-length fibronectin isoform (FN) showing the constitutive exonic (□) and noncoding () sequences. Marked on the respective diagrams are the sequences (both coding and noncoding) to which the specific RNA probes () hybridize. None of these sequences are drawn to scale. B, Northern blot analysis of total RNA extracted from MSF-secreting (S) and nonsecreting (NS) fibroblasts using the RNA probes shown in (A). Bands corresponding to MSF, full-length fibronectin isoforms, and the novel mRNA (N) are indicated. C, diagrammatic representation of the constitutive exonic and noncoding sequences of 2.1-kb MSF mRNA and the corresponding proposed structure of the new 5.9-kb MSF transcript (N) showing the regions of the 5.9-kb transcript to which the PCR oligomers anneal. D, amplification of the new MSF transcript using the primers shown in (C). Results of amplification of secreting and nonsecreting cDNAs and a negative PCR control (N).

Figure 1.

Identification of a new MSF mRNA. A, diagrammatic representation of the upstream 130 kb of the Fn1 gene locus (G), the 2.1-kb MSF mRNA (MSF), and the upstream 2.6 kb of a full-length fibronectin isoform (FN) showing the constitutive exonic (□) and noncoding () sequences. Marked on the respective diagrams are the sequences (both coding and noncoding) to which the specific RNA probes () hybridize. None of these sequences are drawn to scale. B, Northern blot analysis of total RNA extracted from MSF-secreting (S) and nonsecreting (NS) fibroblasts using the RNA probes shown in (A). Bands corresponding to MSF, full-length fibronectin isoforms, and the novel mRNA (N) are indicated. C, diagrammatic representation of the constitutive exonic and noncoding sequences of 2.1-kb MSF mRNA and the corresponding proposed structure of the new 5.9-kb MSF transcript (N) showing the regions of the 5.9-kb transcript to which the PCR oligomers anneal. D, amplification of the new MSF transcript using the primers shown in (C). Results of amplification of secreting and nonsecreting cDNAs and a negative PCR control (N).

Close modal

RNAs extracted from fetal (MSF-secreting) and adult (MSF nonsecreting) fibroblast lines were subjected to Northern blot analysis using the downstream intron-derived 175 bases of the 2.1-kb MSF sequence as a MSF-specific probe (probe U, Fig. 1B). Unexpectedly, this probe hybridized to RNA from both the MSF-secreting and the nonsecreting cell lines, picking out, in each case, two transcripts: one consistent with the previously identified 2.1-kb transcript and a more abundant larger one.

These RNAs were analyzed using a further series of probes: probe 1 (derived from coding sequence upstream of U probe) hybridized to fibronectin mRNA and 2.1-kb MSF mRNA (as predicted), as well as the new transcript. Two other probe sets were used to characterize the downstream sequence that accounts for the increased size of the new transcript. The first set, derived from downstream Fn1 coding sequence (probe 2), only hybridized to fibronectin mRNAs. A second set of probes (3 and 4) were based on the intron-derived sequence downstream of the 3′ 175 bases retained in the 2.1-kb MSF mRNA. Both probes hybridized solely to the newly identified mRNA (Fig. 1B). PCR (Fig. 1C and D) and sequencing revealed that the upstream 2.4 kb of this transcript included part of the Fn1 5′-UTR, spliced sequence from the first 12 Fn1 exons and a significantly larger segment of the retained intron than that found in the 2.1-kb MSF mRNA.

The full extent of the retained intronic sequence was mapped using a series of 10 overlapping PCR reactions (Fig. 2A), which were subsequently cloned and sequenced. PCR reaction 1 (Fig. 2B) using cDNA templates obtained from two representative fibroblast lines (one adult and one fetal) confirmed that exons I-9 and III-1a were spliced together upstream of the contiguous intron-derived sequence. This reaction confirmed that the retained intronic sequence extended further downstream than that found in the 2.1-kb MSF mRNA. The next eight reactions (space restrictions only allow reactions 2 and 9 to be shown; Fig. 2B) all gave the same result: the cDNAs, but not the RNAs, from both MSF-secreting and nonsecreting fibroblasts were amplified successfully, as was the genomic DNA control. These results confirm that the intronic sequence detected is genuinely part of the mRNA and not due to contaminant genomic DNA in the RNA preparation. PCR reaction 10 worked only on the genomic DNA control, indicating that the larger MSF mRNA had terminated before this point. A final PCR reaction using a modified oligo-dT primer identified the position of the poly(A) tail (Fig. 2C), which was the same for MSF-secreting and nonsecreting fibroblast mRNA (Fig. 2C and D) and was consistent with that predicted from the location of the canonical poly(A) signal sequence (10) located at this region of the intron (Fig. 2D). Sequence analysis of the entire cDNA (European Molecular Biology Laboratory accession no. AJ849445) revealed that (a) it is ∼5.9 kb long from its translational start codon to the beginning of its poly(A) tail, and (b) it encodes the same protein as the 2.1-kb MSF mRNA, differing from it only in the amount of intron-derived sequence within its 3′-UTR. Accordingly, this transcript is henceforth referred to as 5.9-kb MSF mRNA.

Figure 2.

Mapping the extent of the 3′-UTR of the new 5.9-kb MSF transcript. A, diagram showing the new 5.9-kb MSF mRNA 3′-UTR and regions amplified by the 10 overlapping PCR reactions. B, electrophoresis gels showing the amplicons generated by 4 of the 10 PCR reactions described in (A). Lane 1, genomic DNA; lanes 2 and 3, MSF-secreting fibroblast RNA and cDNA, respectively; lanes 4 and 5, nonsecreting fibroblast RNA and cDNA, respectively; lane 6, negative control for each reaction. C, result of the PCR amplification reaction showing the location of the site of poly(A) addition. D, sequence of the resultant amplicons from both MSF-secreting and nonsecreting cDNA and their comparison with the corresponding genomic Fn1 sequence. The genomic sites of the constituents (AATAAA motif and downstream GT-rich region) of the canonical poly(A) signal sequence are highlighted.

Figure 2.

Mapping the extent of the 3′-UTR of the new 5.9-kb MSF transcript. A, diagram showing the new 5.9-kb MSF mRNA 3′-UTR and regions amplified by the 10 overlapping PCR reactions. B, electrophoresis gels showing the amplicons generated by 4 of the 10 PCR reactions described in (A). Lane 1, genomic DNA; lanes 2 and 3, MSF-secreting fibroblast RNA and cDNA, respectively; lanes 4 and 5, nonsecreting fibroblast RNA and cDNA, respectively; lane 6, negative control for each reaction. C, result of the PCR amplification reaction showing the location of the site of poly(A) addition. D, sequence of the resultant amplicons from both MSF-secreting and nonsecreting cDNA and their comparison with the corresponding genomic Fn1 sequence. The genomic sites of the constituents (AATAAA motif and downstream GT-rich region) of the canonical poly(A) signal sequence are highlighted.

Close modal

The subcellular distribution of 2.1-kb and 5.9-kb MSF mRNAs is associated with the expression of migration stimulating factor protein. In an attempt to elucidate the functional significance of both MSF mRNAs, we quantified the subcellular distribution of these transcripts in both MSF-secreting (fetal) and nonsecreting (adult) fibroblast lines (Fig. 3). Quantitative PCR of cDNA derived from nuclear and cytoplasmic RNA revealed that essentially all of the 5.9-kb MSF mRNA (over 97%) was confined to the cell nucleus, where it was ∼10-fold more abundant than its 2.1-kb counterpart. The 2.1-kb MSF transcript was also detected in cytoplasmic RNA at a level between 10% and 50% of that present in the nucleus. Significantly, the nuclear levels of the 5.9-kb MSF transcript were lower and the cytoplasmic levels of the 2.1-kb MSF transcript were higher (P = 0.0159, in each case) in the MSF-secreting fibroblasts compared with their nonsecreting counterparts. In contrast, the subcellular distribution of a control mRNA, GAPDH, did not significantly differ between MSF secretors and nonsecretors. These data suggest that MSF mRNAs levels vary in accordance with MSF protein expression status in fetal and adult cells.

Figure 3.

Analysis of 2.1-kb MSF, 5.9-kb MSF, and GAPDH mRNA levels in fibroblast lines. Nuclear (A) and cytoplasmic (B) mRNA levels from fetal (MSF-secreting) and adult (nonsecreting) fibroblast lines were assayed by quantitative real-time PCR. Medians and ranges for each amplicon measured are shown. Where two groups of results differ from each other, the levels of significance as assessed by Mann-Whitney U test are shown.

Figure 3.

Analysis of 2.1-kb MSF, 5.9-kb MSF, and GAPDH mRNA levels in fibroblast lines. Nuclear (A) and cytoplasmic (B) mRNA levels from fetal (MSF-secreting) and adult (nonsecreting) fibroblast lines were assayed by quantitative real-time PCR. Medians and ranges for each amplicon measured are shown. Where two groups of results differ from each other, the levels of significance as assessed by Mann-Whitney U test are shown.

Close modal

We have previously shown that treatment of adult fibroblasts with TGF-β1 induces the expression of MSF.2

2

S.L. Schor et al., in preparation.

This protocol was used to generate MSF-secreting adult cells and compare the subcellular distribution of 2.1-kb and 5.9-kb MSF mRNAs before (nonsecreting) and after (secreting) treatment with TGF-β1. Adult fibroblasts were accordingly incubated with TGF-β1 at 1 ng/mL for 24 hours. Having been washed free of TGF-β1, the cells were cultured for a further 3 weeks before conditioned medium was collected for collagen gel migration assay and dot blot analysis and the cells were harvested for mRNA analysis. The TGF-β1–induced switch-on of MSF production was confirmed both by the presence of immunoreactive protein secretion (dot blot analysis) and MSF-specific bioactivity in the conditioned medium of treated, but not of control, cells (Fig. 4A and B; ref. 1). As previously shown to be the case for fetal and adult fibroblasts, quantitative PCR analyses confirmed that induction of MSF protein secretion was associated with a significant reduction in the nuclear levels of 5.9-kb MSF mRNA and a corresponding increase in the cytoplasmic 2.1-kb MSF transcript (Fig. 4C). Induction of MSF protein secretion did not affect the subcellular distribution of control GAPDH mRNA.

Figure 4.

Effect of TGF-β1 treatment on MSF protein induction and MSF mRNA levels. MSF protein secretion was induced by incubating adult fibroblasts with TGF-β1 at 1 ng/mL for 24 hours. Having been washed free of TGF-β1, the cells were cultured for a further 3 weeks before conditioned medium was collected for collagen gel migration assay and dot blot analysis and the cells were harvested for mRNA analysis. A, analysis of the motogenic activity of conditioned medium from untreated adult fibroblasts (ACM) or adult fibroblasts after TGF-β1 treatment (TGF) or TGF medium supplemented with an in-house monoclonal antibody (Ab) which inhibits MSF motogenic activity. Comparison was made with unconditioned medium (none), medium conditioned by fetal, MSF-secreting fibroblasts (FCM), and recombinant MSF protein (MSF). *, P = 0.079, compared with none (Mann-Whitney U test). B, dot blots comparing the immunoreactivity of TGF, ACM, and FCM media to that of purified MSF and fibronectin proteins (FN). C, quantitative PCR measurement of 2.1-kb MSF, 5.9-kb MSF, and GAPDH mRNA levels in control and TGF-β1–treated fibroblasts. Medians and ranges for each amplicon measured are shown. Where two groups of results differ from each other, the levels of significance as assessed by Mann-Whitney U test are shown.

Figure 4.

Effect of TGF-β1 treatment on MSF protein induction and MSF mRNA levels. MSF protein secretion was induced by incubating adult fibroblasts with TGF-β1 at 1 ng/mL for 24 hours. Having been washed free of TGF-β1, the cells were cultured for a further 3 weeks before conditioned medium was collected for collagen gel migration assay and dot blot analysis and the cells were harvested for mRNA analysis. A, analysis of the motogenic activity of conditioned medium from untreated adult fibroblasts (ACM) or adult fibroblasts after TGF-β1 treatment (TGF) or TGF medium supplemented with an in-house monoclonal antibody (Ab) which inhibits MSF motogenic activity. Comparison was made with unconditioned medium (none), medium conditioned by fetal, MSF-secreting fibroblasts (FCM), and recombinant MSF protein (MSF). *, P = 0.079, compared with none (Mann-Whitney U test). B, dot blots comparing the immunoreactivity of TGF, ACM, and FCM media to that of purified MSF and fibronectin proteins (FN). C, quantitative PCR measurement of 2.1-kb MSF, 5.9-kb MSF, and GAPDH mRNA levels in control and TGF-β1–treated fibroblasts. Medians and ranges for each amplicon measured are shown. Where two groups of results differ from each other, the levels of significance as assessed by Mann-Whitney U test are shown.

Close modal

Processing of the 5.9-kb MSF mRNA 3′-untranslated region regulates protein secretion. These observations show that significant changes in the nuclear level of the 5.9-kb MSF mRNA and the cytoplasmic level of the 2.1-kb MSF mRNA are associated with the switch from a nonsecreting to a MSF-secreting phenotype. To ascertain the possible regulatory function of the 3′-UTR and the functional relationship between the two MSF mRNAs and protein expression, we fused both 3′-UTRs to a GFP reporter gene. The GFP-expressing vector pEGFP-C1 was modified so that either the 2.1-kb or 5.9-kb MSF 3′-UTR was introduced immediately downstream of the GFP coding sequence. A stop codon was introduced between the coding and noncoding sequences. These constructs along with the unaltered pEGFP-C1 vector were transfected into the murine fibroblast line NIH 3T3. Permanently transfected lines, selected by G418, were incubated with TGF-β1 or control medium. Lines transfected with either the unaltered vector (data not shown) or 2.1-kb MSF 3′-UTR (Fig. 5A) fluoresced regardless of TGF-β1 treatment. In contrast, 5.9-kb MSF 3′-UTR–transfected cells fluoresced very poorly until treated with TGF-β1. The heterogeneous fluorescence pattern exhibited by these cells persisted in subclones derived from these parental lines for at least 4 months in culture.

Figure 5.

The 5.9-kb MSF mRNA 3′-UTR regulates nuclear mRNA transport. A, photomicrographs of 4′,6-diamidino-2-phenylindole (D) and GFP (G) fluorescence of 3T3 fibroblasts transfected with a GFP vector modified with the MSF 2.1-kb (U21) and 5.9-kb (U59) 3′-UTRs after TGF-β1 (+) or control treatment (−). B, ratios of cytoplasmic/nuclear GFP and GAPDH mRNA levels from 2.1-kb MSF 3′-UTR– and 5.9-kb MSF 3′-UTR–transfected fibroblast lines and controls transfected with the unmodified pEGFP-C1 vector (V). C, Western blot of GFP protein from matched samples of TGF-β1–treated (+) and untreated (−) transfected fibroblast lines. D, Northern blot analysis of nuclear (n) or cytoplasmic (c) GFP poly(A) RNAs from TGF-β1–treated (+) and untreated (−) lines.

Figure 5.

The 5.9-kb MSF mRNA 3′-UTR regulates nuclear mRNA transport. A, photomicrographs of 4′,6-diamidino-2-phenylindole (D) and GFP (G) fluorescence of 3T3 fibroblasts transfected with a GFP vector modified with the MSF 2.1-kb (U21) and 5.9-kb (U59) 3′-UTRs after TGF-β1 (+) or control treatment (−). B, ratios of cytoplasmic/nuclear GFP and GAPDH mRNA levels from 2.1-kb MSF 3′-UTR– and 5.9-kb MSF 3′-UTR–transfected fibroblast lines and controls transfected with the unmodified pEGFP-C1 vector (V). C, Western blot of GFP protein from matched samples of TGF-β1–treated (+) and untreated (−) transfected fibroblast lines. D, Northern blot analysis of nuclear (n) or cytoplasmic (c) GFP poly(A) RNAs from TGF-β1–treated (+) and untreated (−) lines.

Close modal

Western blot analysis (Fig. 5C) revealed that the GFP protein expressed by the 2.1-kb MSF 3′-UTR– and 5.9-kb MSF 3′-UTR–transfected lines was, as expected, 28 kDa and seemed to be unaltered by TGF-β1 treatment. The GFP protein expressed by vector-transfected cells is larger (32 kDa) because the cloning site is in-frame and adds 26 amino acids to the encoded GFP. This protein was unaltered by TGF-β1 treatment. Quantitative PCR analyses (Fig. 5B) revealed that the GFP mRNA concentration was the same in the nucleus and cytoplasm of vector-transfected cell lines. In 2.1-kb MSF 3′-UTR–transfected lines, the cytoplasmic GFP mRNA concentration was ∼75% of that found in the nucleus. The ratio of cytoplasmic to nuclear GFP mRNA levels in vector- or 2.1-kb MSF 3′-UTR–transfected lines was not significantly affected by TGF-β1 treatment. In 5.9-kb MSF 3′-UTR–transfected lines, <20% of the nuclear levels of mRNA were found in the cytoplasm, indicating substantial trapping of GFP mRNA in the cell nucleus. After TGF-β1 treatment, the cytoplasmic mRNA concentration more than doubled (P = 0.0286) to >50% of the level of nuclear mRNA. Relative levels of a control mRNA, encoding GAPDH, were the same in all these transfected lines and were unaffected by TGF-β1 treatment. Northern blot analyses revealed that no change in GFP transcript size occurred between the nucleus and cytoplasm or between TGF-β1–treated or untreated cells in either the vector- or 2.1-kb MSF 3′-UTR–transfected lines. However, evidence of mRNA processing (shortening of the nuclear 6-kb GFP transcript) could be seen in the cytoplasmic GFP mRNAs obtained from the 5.9-kb MSF 3′-UTR–transfected lines (Fig. 5D).

Fibroblasts cultured in vitro contain 2.1-kb and 5.9-kb species of MSF mRNA as detected by Northern blot analysis. Both species share an identical coding region consisting of the first 12 exons of the fibronectin gene (up to and including exon III-1a) and the immediately contiguous 175 bp of the intron separating exons III-1a and III-1b. They differ solely with respect to the length of the remaining intron-derived 3′-UTR, which plays a unique role in the regulation of MSF expression. We suggest that the expression of MSF protein is dependent on (a) initial transcription of the 5.9-kb mRNA and its sequestration within the nucleus, (b) cleavage of 5.9-kb mRNA 3′-UTR to generate the smaller 2.1-kb transcript, and (c) nuclear export of the 2.1-kb mRNA to the cytoplasm, where it may be translated (Fig. 6). Generation of the 2.1-kb MSF mRNA seems to be the critical step in regulating the nuclear export of the MSF coding sequence and its subsequent availability for translation into protein. This is in marked contrast to the direct relationship between mRNA transcription and protein production that has been described for full-length fibronectin isoforms (11, 12).

Figure 6.

Proposed model showing mechanism of 3′-UTR–mediated nuclear mRNA sequestration as a means of regulating MSF protein secretion. A, the partial activation of fibroblasts in vitro leading to the transcription of the precursor 5.9-kb MSF mRNA and (B) the induction of MSF protein secretion as a result of regulatory signal–stimulated 3′-UTR processing of the 5.9-kb MSF mRNA leading to generation of the mature 2.1-kb MSF transcript, its consequent nuclear export, and its translation into protein within the cytoplasmic compartment.

Figure 6.

Proposed model showing mechanism of 3′-UTR–mediated nuclear mRNA sequestration as a means of regulating MSF protein secretion. A, the partial activation of fibroblasts in vitro leading to the transcription of the precursor 5.9-kb MSF mRNA and (B) the induction of MSF protein secretion as a result of regulatory signal–stimulated 3′-UTR processing of the 5.9-kb MSF mRNA leading to generation of the mature 2.1-kb MSF transcript, its consequent nuclear export, and its translation into protein within the cytoplasmic compartment.

Close modal

Significantly, our results indicate that all cultured fibroblasts examined transcribe MSF mRNA irrespective of whether these cells express MSF protein. This observation stands in marked contrast to ex vivo data, indicating that the majority of normal skin and mammary fibroblasts do not express MSF mRNA (as assessed by in situ hybridization) or protein (as assessed by immunolocalization; ref. 1). This apparent discrepancy is consistent with identified phenotypic differences between cells in vivo and their in vitro cultured counterparts in terms of the expression of various oncofetal stress response molecules, such as the extracellular domain B (EDB) isoform of full-length fibronectin (11). Such phenotypic differences are commonly ascribed to a “partial activation” of tissue cells by the in vitro culture environment, such as the presence of serum (a wound healing stimulus) and the artificial nature of the substratum (13, 14). Our observations accordingly suggest that the control of MSF expression (in vivo as well as in vitro) is regulated by a multistep process of cell activation characterized, at least in part, by the initiation of 5.9-kb MSF mRNA transcription and its subsequent truncation to the 2.1-kb species.

The 3′-UTR regulates mRNA stability by a number of well-characterized mechanisms. One such mechanism is mediated by cis-acting sequences such as the ARE instability sequence (1517). In this respect, we have already reported that a canonical ARE instability sequence is present within the 2.1-kb MSF mRNA 3′-UTR. MSF mRNA is consequently over 30-fold more unstable than other Fn1 transcripts that do not contain this element (1). Further, mutational analysis has confirmed that this canonical sequence is indeed functional and that the 2.1-kb MSF mRNA 3′-UTR confers mRNA instability not only to MSF but also to other nonrelated coding sequences when attached immediately downstream of the stop codon.3

3

Kay et al., in preparation.

The ARE is likely to be responsible for the low levels of detectable 2.1-kb MSF mRNA in the cytoplasm of fibroblasts that secrete MSF protein. This mRNA instability means that the true magnitude of MSF protein secretion is unlikely to be reflected at the mRNA level. Finally, unpublished data additionally suggest that attachment of the 2.1-kb MSF 3′-UTR to the GFP coding sequence is responsible for the reduction of cytoplasmic to nuclear GFP mRNA ratios observed in these fibroblasts compared with the vector only–transfected cells.

The 3′-UTR may have a profound effect on protein translation as a consequence of its effect on transcript stability, mediated through either cis-acting sequences (1517) or structural mRNA elements providing cleavage site protection (18, 19). The 3′-UTR may also regulate transcript availability in either a positive or negative fashion (2022) by several other mechanisms, including the regulation of nuclear export by 3′-UTR cis-acting sequences (23, 24) and mRNA sequestration into cytoplasmic mRNA ribonucleoprotein complexes during development (25). Significantly, all these reported facets of 3′-UTR functionality depend on alterations in trans-activating RNA binding proteins rather than on primary changes in the 3′-UTR itself (1525). Reduced protein expression resulting from changes in 3′-UTR length has been described in cases of β thalassaemia (26) and myotonic dystrophy (27) but, to our knowledge, MSF represents the first instance of a physiologic mechanism whereby nuclear mRNA transport is critically regulated by inducible changes in the 3′-UTR. The cleavage event and its functional sequelae accordingly represent a novel physiologically relevant mechanism for controlling gene expression. The ability of the 5.9-kb MSF mRNA 3′-UTR to control the expression of a non-MSF coding sequence (GFP) suggests that this regulatory mechanism may occur in other gene systems and, indeed, may be clinically exploited in the development of novel targeted therapeutic delivery systems. In this regard, our data indicate that the 3′-UTR–mediated release mechanism seems to operate in a promoter/enhancer–independent fashion, thereby potentially affording more subtle control over the magnitude of therapeutic protein delivery than systems that rely on tissue-specific promoter control.

As is the case for previously characterized full-length oncofetal isoforms of fibronectin (e.g., those containing the extracellular domain B module), the transcription and translation of MSF message are regulated by both developmental and physiologic signals, such as TGF-β1 (2830). Our data indicate that TGF-β1 increases 3′-UTR processing of the nuclear 5.9-kb MSF mRNA. However, TGF-β1 may also increase the generation of 5.9-kb MSF mRNA as its nuclear level decreases less (23.7%) than the corresponding increase of the cytoplasmic level of 2.1-kb MSF mRNA (63.6%) after TGF-β1 treatment. As the levels of the two MSF mRNA forms are predicted to be altered at an equimolar rate, this implies that some of the decrease in the nuclear mRNA reservoir may be offset by an increase in its production.

TGF-β1 can act both as a tumor suppressor and as a significant stimulator of tumor progression, invasion, and metastasis (31, 32). At early stages of tumor development, it acts directly to suppress cancer cell outgrowth but, as the disease progresses, its activities on both the cancer and surrounding stromal cells stimulate tumor progression (31, 33). Indeed, an investigation of TGF-β1 gene polymorphisms in breast cancer suggests that polymorphisms in the signal peptide, which increase TGF-β1 secretion, result in a moderate but significant increase in the risk of developing invasive disease (34). The ability of TGF-β1 to modulate MSF protein secretion may be one mechanism by which it contributes to the severity of tumor progression.

Although used as an exemplar in this study, TGF-β1 is not alone in its ability to stimulate MSF secretion. Other studies have shown that transfection of adult fibroblasts with constructs expressing dominant-negative p53 mutants also induces changes in MSF mRNA and MSF protein secretion,4

4

Jones et al., in preparation.

suggesting that several tumor-promoting factors may induce MSF as part of their oncogenic repertoire.

In summary, this article highlights a novel nuclear mRNA sequestration mechanism which uniquely regulates the secretion of the oncofetal cytokine MSF. It is anticipated that this information will contribute to our understanding of the mechanisms underpinning the reexpression of MSF during cancer progression and point to novel clinical intervention strategies for reversing this process.

Grant support: Engineering and Physical Sciences Research Council, NIH (USA), The Breast Cancer Campaign, Joint Research into Aging and Diabetes UK studentship, Tayside Area Oncology Fund, and Dundee University Anonymous Trust.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Rene Burnett for her invaluable technical assistance.

1
Schor SL, Ellis IR, Jones SJ, et al. Migration-stimulating factor: a genetically truncated onco-fetal fibronectin isoform expressed by carcinoma and tumor-associated stromal cells.
Cancer Res
2003
;
63
:
8827
–36.
2
Schor SL, Schor AM, Grey AM, Rushton G. Foetal and cancer patient fibroblasts produce an autocrine migration stimulating factor not made by normal adult cells.
J Cell Sci
1988
;
90
:
391
–9.
3
Schor SL, Schor AM. Characterization of migration stimulating activity (MSF): evidence for its role in cancer pathogenesis.
Cancer Invest
1990
;
8
:
665
–7.
4
Schor SL, Schor AM, Grey AM, Chen J, Rushton G, Ellis I. Mechanism of action of the migration stimulating factor produced by fetal and cancer patient fibroblasts: effect on hyaluronic acid synthesis.
In Vitro
1989
;
25
:
737
–46.
5
Ellis I, Grey AM, Schor AM, Schor SL. Antagonistic effects of transforming growth factor β and MSF on fibroblast migration and hyaluronic acid synthesis: possible implications for wound healing.
J Cell Sci
1992
;
102
:
447
–56.
6
Schor SL, Schor AM, Keatch RP, Belch J. Role of matrix macromolecules in the etiology and treatment of chronic ulcers. In: Lee BY, editor. The wound management manual. New York: McGraw-Hill; 2005. p. 109–21.
7
Picardo M, Schor SL, Grey AM, et al. Migration stimulating activity in serum of breast cancer patients.
Lancet
1991
;
337
:
130
–3.
8
Schor SL, Schor AM. Stromal acceleration of tumour progression: role of “fetal-like” fibroblast subpopulations.
Pathol Update
1997
;
4
:
75
–95.
9
Schor SL, Schor AM. Tumour-stroma interactions. Phenotypic and genetic alterations in mammary stroma: implications for tumour progression.
Breast Cancer Res
2001
;
3
:
373
–9.
10
Edmonds M. A history of poly A sequences: from formation to factors to function.
Prog Nucleic Acid Res Mol Biol
2002
;
71
:
285
–389.
11
Hynes R. Fibronectins. New York: Springer-Verlag; 1990.
12
Mimura Y, Ihn H, Jinnin M, Asano Y, Yamane K, Tamaki K. Epidermal growth factor induces fibronectin expression in human dermal fibroblasts via protein kinase Cδ signaling pathway.
J Invest Dermatol
2004
;
122
:
1390
–8.
13
Holbrook KA, Hennings H. Phenotypic expression of epidermal cells in vitro: a review.
J Invest Dermatol
1983
;
81
:
11
–24s.
14
Becher B, Antel JP. Comparison of phenotypic and functional properties of immediately ex vivo and cultured human adult microglia.
Glia
1996
;
18
:
1
–10.
15
Chen Ch-YA, Shyu A-B. AU-rich elements: characterization and importance in mRNA degradation.
Trends Biochem Sci
1995
;
20
:
465
–70.
16
Gueydan C, Droogmans L, Chalon P, Huez G, Caput D, Kruys V. Identification of TIAR as a protein binding to the transcriptional regulatory AU-rich element of tumor necrosis factor α mRNA.
J Biol Chem
1999
;
274
:
2322
–6.
17
Gallouzi I-E, Brennan CM, Stenberg MG, et al. HuR binding to cytoplasmic mRNA is perturbed by heat shock.
Proc Natl Acad Sci U S A
2000
;
97
:
3073
–8.
18
Rouault T, Klausner R. Regulation of iron metabolism in eukaryotes.
Curr Top Cell Regul
1997
;
35
:
1
–19.
19
McGowan KM, Police S, Winslow JB, Pekala PH. Tumour necrosis factor-α regulation of glucose transporter (GLUT1) mRNA turnover. Contribution of the 3′-untranslated region of the GLUT1 message.
J Biol Chem
1997
;
272
:
1331
–7.
20
Di Liegro CM, Bellafiore M, Izquierdo JM, Rantanen A, Cuezva JM. 3′-Untranslated regions of oxidative phosphorylation mRNAs function in vivo as enhancers of translation.
Biochem J
2000
;
252
:
109
–15.
21
Ostareck-Lederer DH, Ostareck DH, Standart N, Thiele BJ. Translation of 15-lipoxygenase mRNA is inhibited by a protein that binds to a repeated sequence in the 3′ untranslated region.
EMBO J
1994
;
13
:
1476
–81.
22
Mazumder B, Seshadri V, Fox PL. Translational control by the 3′-UTR: the ends specify the means.
Trends Biochem Sci
2003
;
28
:
91
–8.
23
Keene JD. Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome.
Proc Natl Acad Sci U S A
2001
;
98
:
7018
–24.
24
Keene JD. Organizing mRNA export.
Nat Genet
2003
;
23
:
111
–2.
25
Curtis D, Lehmann R, Zamore PD. Translational regulation in development.
Cell
1995
;
81
:
171
–8.
26
Bilenoglu O, Basak AN, Russell JE. A 3′UTR mutation affects β-globin expression without altering the stability of its fully processed mRNA.
Br J Haematol
2002
;
119
:
1106
–14.
27
Timchenko LT. Myotonic dystrophy: the role of RNA CUG triplet repeats.
Am J Hum Genet
1999
;
64
:
360
–4.
28
Keski-Oja J, Raghow R, Sawdey M, et al. Regulation of mRNAs for type-1 plasminogen activator inhibitor, fibronectin and type I procollagen by transforming growth factor-β: divergent responses in lung fibroblasts and carcinoma cells.
J Biol Chem
1988
;
263
:
3111
–5.
29
Borsi L, Castellani P, Risso AM, Leprini A, Zardi L. Transforming growth factor-β regulates the splicing pattern of fibronectin messenger RNA precursor.
FEBS Lett
1990
;
261
:
175
–8.
30
Wrana JL, Overall CM, Sodek J. Regulation of the expression of a secreted acidic protein rich in cyteine (SPARC) in human fibroblasts by transforming growth factor β. Comparison of transcriptional and post-transcriptional control with fibronectin and type I collagen.
Eur J Biochem
1991
;
197
:
519
–28.
31
Akhurst RJ, Derynck R. TGF-β signaling in cancer—a double-edged sword.
Trends Cell Biol
2001
;
11
:
S44
–51.
32
Cui W, Fowlis DJ, Bryson S, et al. TGF-β1 inhibits the formation of benign skin tumours but enhances progression to invasive spindle cell carcinomas in transgenic mice.
Cell
1996
;
86
:
531
–42.
33
Glick AB. TGFβ1, back to the future: revisiting its role as a transforming growth factor.
Cancer Biol Ther
2004
;
3
:
276
–83.
34
Dunning AM, Ellis PD, McBride S, et al. A transforming growth factorβ1 signal peptide variant increases secretion in vitro and is associated with increased incidence of invasive breast cancer.
Cancer Res
2003
;
63
:
2610
–5.