Differentiation induction is an effective therapy for acute promyelocytic leukemia (APL), which dramatically responds to all-trans-retinoic acid (ATRA). Recent studies have indicated that combinatorial use of retinoid and nonretinoid compounds, such as histone deacetylase inhibitors, arsenics, and PKA agonists, has higher therapeutic value in this disease and potentially in other malignancies. In a screen of 370 compounds, we identified benzodithiophene analogues as potent enhancers of ATRA-induced APL cell differentiation. These effects were not associated with changes in global histone acetylation and, for the most potent compounds, were exerted at very low nanomolar concentrations, and were paralleled by enhancement of some, but not all, ATRA-modulated gene expressions. Investigating the mechanism underlying the effects of these drugs on ATRA-induced APL cell differentiation, we have shown that benzodithiophenes enhance ATRA-mediated dissociation and association of corepressor N-CoR and coactivator p300 acetyltransferase, respectively, with retinoic acid receptor (RAR) α proteins. These data suggest that benzodithiophenes act at the level of receptor activation, possibly by affecting posttranslational modification of the receptor (and/or coregulators), thus leading to an enhancement in ATRA-mediated effects on gene expression and APL cell differentiation. Given the specificities of these low benzodithiophene concentrations for PML-RARα and RARα, these drugs may be useful for combinatorial differentiation therapy of APL and possibly other acute myelogenous leukemia subtypes in which the overall ATRA signaling is suppressed.

Acute promyelocytic leukemia (APL) is characterized by the t(15;17)(q22;q21) translocation, which results in the fusion of retinoic acid receptor α gene (RARα) on chromosome 17 to the promyelocytic leukemia (PML) gene on chromosome 15 (see ref. 1 for review and references therein). The resulting fusion oncoprotein PML-RARα has been shown to play a central role in the pathogenesis of APL (24). It disrupts the normal structure of the PML nuclear body (5), interferes with cell growth regulatory functions of PML (6), and blocks the RARα pathway regulating myelomonocytic differentiation (7).

The retinoid X receptor (RXR)/RAR heterodimers normally bind to retinoic acid response elements (RARE) in the absence of ligands, repressing transcription by recruiting nuclear receptor corepressor complexes that contain histone deacetylases (HDAC; see ref. 8 for review and references therein). All-trans-retinoic acid (ATRA) at physiologic concentrations triggers the dissociation of corepressors and the association of coactivators with histone acetyltransferase activities, such as CREB binding protein or p300 (8). This process leads to activation of ATRA-responsive genes via alteration of chromatin structure and enables cellular differentiation of normal myelomonocytic progenitor cells. In APL cells, PML-RARα/RXR tetramers (9), which bind to RAREs and a variety of other nuclear receptor hormone response elements (9, 10), interact with corepressors more strongly than RARα/RXR heterodimers, and only at pharmacologic doses ATRA can trigger the corepressor/coactivator exchange, leading to activation of gene transcription and differentiation of leukemic blasts (see refs. 1113 for reviews and references therein).

Important therapeutic implications of these findings are that agents capable of inhibiting enzymatic components of the corepressor complexes, such as HDAC inhibitors, could stimulate the effects of ATRA on gene expression and enhance the differentiation of leukemic cells. Indeed, a number of studies have shown enhancement of ATRA response by various HDAC inhibitors on APL cells both in vitro (14, 15) and in vivo (16) and some effects were also observed using such drug combination on non-APL acute myelogenous leukemia (AML) cells in vitro (1719). Nevertheless, other agents, such as hexamethylene bisacetamide and DMSO, which do not possess HDAC inhibitory activities, can also potentiate ATRA responses in APL (20). The mechanisms by which these effects are mediated are not understood.

We have used NB4 cells with reduced ATRA sensitivity to screen for additional drugs, which synergize with ATRA to induce APL cell differentiation and which may prove to be more clinically useful than currently known HDAC inhibitors or HMBA. Among 370 different compounds screened, benzodithiophenes were identified as agents that potently stimulated ATRA effects on leukemic cell differentiation.6

6

Y. Jing, N. Hellinger, L. Xia, et al. Dithiophenes induce differentiation and apoptosis in human leukemia cells. Cancer Res. Vol. 2005, submitted for publication.

Benzodithiophene analogues were previously shown to have potent antineoplastic activities in a number of cancer cell lines, including HL-60 acute myeloid leukemia cells (2123). When biological effects of benzodithiophenes in selected cell lines were evaluated using COMPARE computations against National Cancer Institute (NCI) screening data from test compounds, they did not correlate with any mechanisms defined in the NCI “Standard Agent” data base (23).

We have now discovered that at nanomolar concentrations, benzodithiophene analogues, which alone have no obvious biological activities at these low levels, can effectively potentiate induction of APL cell differentiation with suboptimal concentrations of ATRA, although proapoptotic effects of benzodithiophenes are seen only at micromolar concentration.6 The underlying mechanism for the effects of benzodithiophenes on ATRA-mediated differentiation seems to involve enhancement in the rate of exchange of corepressors for coactivators with RARα proteins.

Cell lines and reagents. Human monocytic cell line U-937 and human kidney cell line 293T were obtained from American Type Culture Collection (Manassas, VA). Human APL cell line NB4 was a gift of M. Lanotte (Hôpital St. Louis, Paris, France). Cells were grown in RPMI 1640 (Life Technologies Ltd., Paisley, United Kingdom) containing 100 units/mL penicillin, 100 μg/mL streptomycin, 20 mmol/L glutamine, and 10% fetal bovine serum, in a humidified atmosphere of 95% air and 5% CO2 at 37°C. ATRA was purchased from Sigma-Aldrich Company Ltd. (Dorset, United Kingdom). Benzodithiophenes were obtained from NCI.

Reverse transcription and real-time PCR reagents were purchased from Life Technologies and Eurogentec, Inc. (Seraing, Belgium), respectively. Anti–acetyl-histone H4 antiserum was purchased from Upstate Ltd. (Lake Placid, NY) and horseradish peroxidase (HRP)–conjugated goat anti-rabbit immunoglobulin G (IgG) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Luciferase and β-galactosidase assays and calcium phosphate transfection reagents were purchased from Promega Ltd. (Madison, WI).

Nitroblue tetrazolium assay. Cell suspension (1 × 106 cells/mL, 1 mL) in HBSS (Invitrogen Ltd., Paisley, United Kingdom) was mixed with an equal volume of HBSS containing 1 mg/mL nitroblue tetrazolium (NBT; Sigma) and 0.4 μg/mL phorbol 12-myristate 13-acetate (Sigma), and incubated at 37°C for 30 minutes. After centrifugation at 12,000 × g for 1 minute, the supernatant was discarded and formazan deposits were dissolved in 0.1 mL of DMSO. Absorption of the formazan solution was measured at 580 nm.

Transient transfections. Electroporation was done using a Bio-Rad Gene Pulser II at 800 μF and 270 V. Approximately 20 × 106 U-937 cells were transfected with 18 μg of pREP4-(RARE)3-tk-luc and with 2 μg of pCMV-β-galactosidase as an internal control. Cells were rested for 3 hours after transfection, and then incubated with or without ATRA and indicated benzodithiophene compounds for 16 hours. Luciferase and β-galactosidase assays were done following commercial protocols (Promega). Transfection of 293T cells was carried out using the calcium phosphate precipitation method. 293T cells were plated in a 24-well plate at 0.5 × 105 to 1.0 × 105 cells/well (not exceeding 60% confluence). Cells were transfected with 200 ng of pREP4-(RARE)3-tk-luc, 50 ng of pPSG5-RARα1 or pPSG5-PML-RARα, and 100 ng of pCMV-βgalactosidase as an internal control. Sufficient DNA carrier was added to normalize the total amount of DNA to 0.5 μg. Luciferase activity was determined after 16 hours. Mammalian two-hybrid assays were done in U-937 cells using 8 μg of pGAL4-(UAS)5-tk-Luc, 2.2 μg of pGAL4(DBD)-NCoR or pGAL4(DBD)-p300, 7.8 μg of pVP16-RARα, and 2 μg of pCMV-β-galactosidase as an internal control, with electroporation conditions described above. All plasmids listed above have been previously described (15, 24).

Reverse transcription. Total RNA was extracted from cells using RNA-Bee kit (Biogenesis Ltd., Poole, United Kingdom). Reverse transcription was done at the following conditions: RNA and random hexamers were denatured for 5 minutes at 65°C; after transferring the reaction tube to ice, M-MLV reverse transcriptase, deoxynucleotide triphosphates, RNase inhibitor, DTT, and reverse transcription buffer were added and incubated for 10 minutes at 25°C and 50 minutes at 37°C (see ref. 25 for detail).

Real-time PCR. Primers and probes were designed using Primer Express software (Perkin-Elmer, Foster City, CA); the sequences are presented in Table 1. Primers and probes for RARα2 and PBGD transcripts were synthesized by Applied Biosystems (Boston, MA); primers for other genes were synthesized by Invitrogen. Labeled probes were used for detection of RARα2 and PBGD mRNA levels, whereas SYBR Green was used to quantify other mRNA levels. All the real-time PCR reagents were from Eurogentec. PCR reactions were done at the following conditions: 2 minutes at 50°C, 10 minutes at 95°C, then 50 cycles at 95°C for 15 seconds and 65°C for 1 minute in the ABI Prism 7700 Sequence Detector System (ABI, Foster City, CA).

Table 1.

Real-time PCR primer and probe sequences

PrimersSequenceLength of amplicons (bp)
RIG-I Forward TAAACAACACCCGTACAATATGATCA 106 
 Reverse ACCAACCGAGGCAGTCAGC  
TGM-2 Forward GCCACTTCATTTTGCTCTTCAA 80 
 Reverse TCCTCTTCCGAGTCCAGGTACA  
IL-8 Forward GACTGCGGTCAATGGCTTTTA 97 
 Reverse GCAAGTCTTGTAGAAAGTGCACC  
 Probe-FAM TAAGACAGGACATGAGCTGGTTTGATGACC  
MYC Forward TCAAGAGGCGAACACACAAC 110 
 Reverse GGCCTTTTCATTGTTTTCCA  
PBGD Forward GGAGCCATGTCTGGTAACGGCA 81 
 Reverse GGTACCCACGCGAATCACTCTCA  
 Probe-VIC TGCGGCTGCAACGGCGGAAGAAA  
RARα2 Forward GCCTGTTTGCTCCCAGAGAA 237 
 Reverse AAAGCAAGGCTTGTAGATGCG  
 Probe-FAM AACCACTCCATTGAGACCCAGAGCAGC  
PrimersSequenceLength of amplicons (bp)
RIG-I Forward TAAACAACACCCGTACAATATGATCA 106 
 Reverse ACCAACCGAGGCAGTCAGC  
TGM-2 Forward GCCACTTCATTTTGCTCTTCAA 80 
 Reverse TCCTCTTCCGAGTCCAGGTACA  
IL-8 Forward GACTGCGGTCAATGGCTTTTA 97 
 Reverse GCAAGTCTTGTAGAAAGTGCACC  
 Probe-FAM TAAGACAGGACATGAGCTGGTTTGATGACC  
MYC Forward TCAAGAGGCGAACACACAAC 110 
 Reverse GGCCTTTTCATTGTTTTCCA  
PBGD Forward GGAGCCATGTCTGGTAACGGCA 81 
 Reverse GGTACCCACGCGAATCACTCTCA  
 Probe-VIC TGCGGCTGCAACGGCGGAAGAAA  
RARα2 Forward GCCTGTTTGCTCCCAGAGAA 237 
 Reverse AAAGCAAGGCTTGTAGATGCG  
 Probe-FAM AACCACTCCATTGAGACCCAGAGCAGC  

Abbreviations: RIG-I, retinoic acid-induced gene; TGM-2, transglutaminase 2; PBGD, porphobilinogen deaminase; RARα2, retinoic acid receptor α2; MYC, v-myc myelocytomatosis viral oncogene homologue.

DNA array analysis. NB4 cells were incubated with ATRA, NSC682994, or ATRA plus NSC682994 for indicated time points, and total RNA was extracted from cells using RNABee kit (Biogenesis Ltd., Poole, United Kingdom). Microarray experiment was done at the Genome Centre, Whitehead Institute/Massachusetts Institute of Technology, using Affymetrix human genome U133 chip A, containing 22,283 genes and expressed sequence tags. Data analysis was done using component plane presentation integrated self-organizing map, built in the Matlab environment (26).

Measurement of histone acetylation. U-937 cells (5 × 105/mL, 20 mL) were incubated with and without ATRA and benzodithiophenes for 24 hours, washed twice with ice-cold PBS, and the cell pellets lysed in 50 μL of lysis buffer [1% Nonidet P-40, 137 mmol/L NaCl, 10% glycerol, 1 mmol/L phenylmethylsulfonyl fluoride, aprotinin (0.15 units/mL), 1 mmol/L Na3VO4 and 20 mmol/L Tris-HCl (pH 8)] for 30 minutes on ice. Lysates were centrifuged (15,000 × g, 20 minutes, 4°C). Two-fold concentrated SDS sample buffer [217 mmol/L Tris-HCl (pH 6.7), 17.4% glycerol, 5% SDS, 9% 2-mercaptoethanol, 0.002% bromophenol blue] was added to cell lysate, boiled for 5 minutes, and electrophoresed on a 12% SDS-polyacrylamide gel at 20 mA for 2 hours. Rainbow protein molecular weight standards (Amersham, Little Chalfont, United Kingdom) were run concurrently. Proteins electrophoretically were transferred to nitrocellulose membranes (35 mA, 1 hour). Membranes were blocked for 1 hour at room temperature with 5% milk protein, 0.1% Tween 20 in PBS (PBS-Tween), rinsed twice, followed by three 10-minute washes with PBS-Tween. Membranes were probed at room temperature with rabbit anti–acetyl-histone H4 antiserum at 1:2,000 dilution in PBS-Tween with 3% milk protein for 1 hour. After washing, membranes were probed with HRP-conjugated goat anti-rabbit IgG at 1:5,000 dilution in PBS-Tween with 3% milk protein for 1 hour. After washing, blots were developed with the Enhanced chemiluminescence detection system (Amersham).

To investigate the possible mechanisms underlying the effects of benzodithiophene analogues on APL cell differentiation, we evaluated the effects of different benzodithiophene derivatives (Fig. 1)—NSC656243 (4,8-dioxo-benzo[1,2-b:5,4-b′]dithiophene-2-carboxylic acid), NSC656240 (2-hydroxymethyl-4,8-dihydrobenzo[1,2-b:5,4-b′]dithiophene-4,8-dione), and NSC682994 (4,8-dibutanoyl-benzo[1,2-b:4,5-b′]dithiophene)—on PML-RARα activity. After cotransfecting a luciferase reporter containing three copies of RARE with a PML-RARα expression vector in 293T cells, we found that benzodithiophene derivatives 1 to 3 (see Fig. 1 for chemical structures) effectively potentiated induction of PML-RARα with suboptimal concentration of ATRA (0.5 μmol/L), although these benzodithiophenes alone have no effect on the reporter activity (Fig. 2). Among these three benzodithiophenes, NSC656240, in which acidic group of NSC656243 at C-2 in the third ring was replaced with a hydroxy, and NSC682994 with an open quinone structure and no C-2 substitution, NSC682994 was the most potent. NSC656240 and NSC682994 stimulated ATRA activation of PML-RARα at 50 and 25 nmol/L, respectively, in contrast to NSC656243, which required micromolar concentrations (Fig. 2). The effects on PML-RARα were consistent with the results of cell differentiation assays where NSC682994 also displayed the most potent activity (23). It is worth noting that although NSC682994 was the most powerful differentiation inducer, higher concentrations of this compound than for the other benzodithiophenes were required to induce apoptosis (data not shown), suggesting that opening the quinone structure might have resulted in some loss of cytotoxic activity of NSC682994. Thus, it may be possible to separate the quinone cytotoxic effects from differentiation effects, which require benzodithiophene moieties, by further structural alterations. Differences in potencies among these compounds (13) in stimulating ATRA-induced gene expression and differentiation may be due to the potential differences in their membrane solubility. Because compounds NSC656240 and NSC682994 were more potent, they were chosen for further analysis.

Figure 1.

Chemical structures of benzodithiophene derivatives used in this study. 1, NSC656243 (4,8-dioxo-benzo[1,2-b:5,4-b′]dithiophene-2-carboxylic acid); 2, NSC656240 (2-hydroxymethyl-4,8-dihydrobenzo[1,2-b:5,4-b′]dithiophene-4,8-dione); 3, NSC682994 (4,8-dibutanoyl-benzo[1,2-b:4,5-b′]dithiophene).

Figure 1.

Chemical structures of benzodithiophene derivatives used in this study. 1, NSC656243 (4,8-dioxo-benzo[1,2-b:5,4-b′]dithiophene-2-carboxylic acid); 2, NSC656240 (2-hydroxymethyl-4,8-dihydrobenzo[1,2-b:5,4-b′]dithiophene-4,8-dione); 3, NSC682994 (4,8-dibutanoyl-benzo[1,2-b:4,5-b′]dithiophene).

Close modal
Figure 2.

Effects of different benzodithiophene analogues on PML-RARα activity. 293T cells were cotransfected with a luciferase reporter containing RARE binding sites and RARα or PML-RARα expression vector. Cells were incubated with indicated NSC compounds with or without ATRA for 16 hours. Sodium butyrate (NaB) was used as a positive control. Luciferase assays were done and the luciferase activities (relative to untransfected cells) were determined. Similar results have been obtained in at least three independent experiments. Columns, means; bars, SD.

Figure 2.

Effects of different benzodithiophene analogues on PML-RARα activity. 293T cells were cotransfected with a luciferase reporter containing RARE binding sites and RARα or PML-RARα expression vector. Cells were incubated with indicated NSC compounds with or without ATRA for 16 hours. Sodium butyrate (NaB) was used as a positive control. Luciferase assays were done and the luciferase activities (relative to untransfected cells) were determined. Similar results have been obtained in at least three independent experiments. Columns, means; bars, SD.

Close modal

To show whether the same effects of benzodithiophenes on PML-RARα activation by ATRA can be observed in APL cells, we transfected an APL cell line (NB4) with the luciferase reporter containing three copies of RARE and measured its activity after treatment with NSC656240 or NSC682994, with or without ATRA (Fig. 3A). Using NBT reduction assay, we also evaluated the effects of such combinatorial treatments on NB4 cell differentiation. Results of both assays were in agreement with the data derived from transfection experiments with 293T cells. Benzodithiophenes enhanced induction of both reporter activity and NB4 cell differentiation by ATRA (Fig. 3A and B). Previously, we have shown that expression of ATRA-inducible RARα2 isoform increases with myelomonocytic differentiation of normal hematopoietic progenitors as well acute myeloid leukemia cells (24, 27). Consistent with these earlier data, we find that enhancement of ATRA differentiation of APL cells by benzodithiophene correlates with enhancement of the RARα2 mRNA levels (Fig. 3C and D). The enhanced induction of RARα expression by benzodithiophene was time dependent and was more evident after 72 hours of treatment (Fig. 3C and D). These effects of benzodithiophenes on ATRA-induced gene expression and APL cell line differentiation were very similar to those observed with HDAC inhibitors such as sodium butyrate (Figs. 2 and 3). The most potent benzodithiophenes enhanced the levels of differentiation, reporter activity, and expression from an endogenous ATRA-responsive promoter, such as that of RARα2, to similar levels as sodium butyrate but at 100-fold lower concentrations. The levels of RARα2 increased with time and at 72 hours were equivalent to those obtained with ATRA and sodium butyrate treatment (Fig. 3D). To evaluate whether other primary ATRA-response genes are similarly coactivated by NSC682994, we also examined mRNA levels for RIG-I and TGM-2 genes, which contain RAREs in their promoters and are induced by ATRA during leukemic cell differentiation. As expected, both RIG-I (28) and TGM-2 (29) were induced by ATRA and, similarly to RARα2, the levels of their expression were potentiated by NSC682994 (Fig. 4A and B).

Figure 3.

In vivo ATRA-responsive gene expression induction of differentiation by benzodithiophene analogues. A, NB4 cells were transfected with a luciferase reporter containing three copies of RARE binding site, incubated with ATRA (0.5 μmol/L), NSC682994 (25 nmol/L), and/or NSC656240 (50 nmol/L) for 16 hours; then luciferase assays were done and the luciferase activities (relative to untreated cells) were determined. B, in parallel, NB4 cells that were incubated with ATRA (0.5 μmol/L), NSC682994 (25 nmol/L), and/or NSC656240 (50 nmol/L) for 48 hours were examined for differentiation using NBT assays. C and D, ATRA-inducible RARα2 mRNA levels were detected by real-time PCR after NB4 cells were incubated with NSC682994 and/or ATRA for 8 and 24 hours (C) or 72 hours (D). Similar results have been obtained in at least three independent experiments. In all experiments, NaB and ATRA were used as positive controls (A-D). Columns, means; bars, SD. In all cases, differences between control and ATRA or ATRA and ATRA plus benzodithiophene (P < 0.01), except for 8-hour treatment with ATRA and benzodithiophene (C) in which, relative to ATRA-treated sample, up-regulation of expression by ATRA and benzodithiophene was less significant (P < 0.05). Statistical analysis was done by Student's t test.

Figure 3.

In vivo ATRA-responsive gene expression induction of differentiation by benzodithiophene analogues. A, NB4 cells were transfected with a luciferase reporter containing three copies of RARE binding site, incubated with ATRA (0.5 μmol/L), NSC682994 (25 nmol/L), and/or NSC656240 (50 nmol/L) for 16 hours; then luciferase assays were done and the luciferase activities (relative to untreated cells) were determined. B, in parallel, NB4 cells that were incubated with ATRA (0.5 μmol/L), NSC682994 (25 nmol/L), and/or NSC656240 (50 nmol/L) for 48 hours were examined for differentiation using NBT assays. C and D, ATRA-inducible RARα2 mRNA levels were detected by real-time PCR after NB4 cells were incubated with NSC682994 and/or ATRA for 8 and 24 hours (C) or 72 hours (D). Similar results have been obtained in at least three independent experiments. In all experiments, NaB and ATRA were used as positive controls (A-D). Columns, means; bars, SD. In all cases, differences between control and ATRA or ATRA and ATRA plus benzodithiophene (P < 0.01), except for 8-hour treatment with ATRA and benzodithiophene (C) in which, relative to ATRA-treated sample, up-regulation of expression by ATRA and benzodithiophene was less significant (P < 0.05). Statistical analysis was done by Student's t test.

Close modal
Figure 4.

Benzodithiophenes potentiate ATRA-induced expression of RIG-I (A) and TGM-2 (B) genes in NB4 cells. Cells were treated with ATRA (0.5 μmol/L) and NSC682994 (25 μmol/L) for 24 hours and total RNAs were harvested for RT-PCR analysis. Columns, means; bars, SD.

Figure 4.

Benzodithiophenes potentiate ATRA-induced expression of RIG-I (A) and TGM-2 (B) genes in NB4 cells. Cells were treated with ATRA (0.5 μmol/L) and NSC682994 (25 μmol/L) for 24 hours and total RNAs were harvested for RT-PCR analysis. Columns, means; bars, SD.

Close modal

To further detail transcriptional changes synergistically induced by ATRA and NSC682994, high-density microarrays were done on the NB4 cells treated with NSC682994, ATRA, or ATRA plus NSC682994 at 8, 24, and 48 hour time points using Affymetrix Genechip. After a data normalization procedure, a total of 5,884 genes revealed reliable expression values across all the nine samples. Based on these numerical values, self-organizing map, an artificial intelligent algorithm, was applied to cluster coregulated genes using 400 hexagonal prototype vectors on a two-dimensional lattice (20 × 20 grids). To detail transcriptional changes of each sample at the global scale, the self-organizing map outputs were visualized by component plane presentations (26). As shown in Fig. 5, each presentation illustrates a sample-specific global transcriptional map in which all up-regulated, moderately regulated, and down-regulated genes are well delineated, permitting direct determination of functional significances of genes clustered to each map unit with respect to each sample. By comparing regulatory patterns in identical positions between presentations, it is clearly shown that NSC682994 alone has a limited impact on the modulation of gene expression throughout the time course (NSC 8, 24, and 48 hours). In the combined treatments, however, NSC682994 significantly potentiates the ATRA-mediated gene regulation, as shown by modulatory statues of genes mapped to top right and bottom left corner/edge areas of the map (NSC and ATRA 48 hours of Fig. 5). Among the 1,179 modulated genes of which expression varied at least 2-fold compared with untreated sample in at least one of the nine samples, 302 genes were synergistically modulated. Most of these genes were modulated at 24 and 48 hours. Table 2 lists examples of genes regulated by ATRA, which were (groups B and D) and were not (groups A and C) potentiated by benzodithiophene. Expression profiles of selected genes in groups B and D were then confirmed using real-time PCR. Using RNA isolated from a different experiment, real-time PCR analysis generated data highly similar to that derived from the microarray (for example, see Fig. 6A and B) for interleukin 8 (IL-8; expression potentiated by benzodithiophene) and MYC (expression further down-regulated by benzodithiopohene).

Figure 5.

Clustering and visualization of microarray data by component plane presentation integrated self-organizing map. Each presentation illustrates a treatment-specific transcriptional map in which all up-regulated (red), down-regulated (blue), and moderately regulated genes (yellow and green) are well delineated. Color coding index stands for log 2 ratios. The brighter the color, the higher the value.

Figure 5.

Clustering and visualization of microarray data by component plane presentation integrated self-organizing map. Each presentation illustrates a treatment-specific transcriptional map in which all up-regulated (red), down-regulated (blue), and moderately regulated genes (yellow and green) are well delineated. Color coding index stands for log 2 ratios. The brighter the color, the higher the value.

Close modal
Table 2.

Examples of genes modulated by ATRA and ATRA plus NSC682994

Accession numberNameDescription
AI818488 ADD3 adducin 3 (γ)  
NM_000688.1 ALAS1 aminolevulinate, δ-, synthase 1  
NM_001262.1 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)  
NM_001268.1 CHC1L chromosome condensation 1–like  
AI733465 COL9A2 collagen, type IX, α2  
NM_004084.2 DEFA1 defensin, α1, myeloid-related sequence  
NM_012199.1 EIF2C1 eukaryotic translation initiation factor 2C, 1  
U32645 ELF4 E74-like factor 4 (ets domain transcription factor)  
NM_021999.1 ITM2B integral membrane protein 2B  
NM_002631.1 PGD phosphogluconate dehydrogenase  
M24779.1 PIM1 pim-1 oncogene  
NM_002800.1 PSMB9 proteasome (prosome, macropain) subunit, β type, 9  
U43522.1 PTK2B PTK2 protein tyrosine kinase 2 β  
NM_002908.1 REL v-rel reticuloendotheliosis viral oncogene homologue (avian)  
U12707 WAS Wiskott-Aldrich syndrome (eczema-thrombocytopenia)  
NM_003387.2 WASPIP Wiskott-Aldrich syndrome protein interacting protein  
NM_000700.1 ANXA1 Annexin A1  
NM_001166.2 BIRC2 baculoviral IAP repeat-containing 2  
NM_000560.1 CD53 CD53 antigen  
NM_005890.1 GAS7 growth arrest–specific 7  
NM_000852.2 GSTP1 glutathione S-transferase π  
NM_004964.2 HDAC1 histone deacetylase 1  
NM_002162.2 ICAM3 intercellular adhesion molecule 3  
NM_003641.1 IFITM1 IFN-induced transmembrane protein 1 (9-27)  
NM_000584.1 IL-8 interleukin 8  
NM_000210.1 ITGA6 integrin, α6  
NM_002294.1 LAMP2 lysosomal-associated membrane protein 2  
AI827941 MYH9 myosin, heavy polypeptide 9, nonmuscle  
NM_004688.1 NMI N-myc (and STAT) interactor  
BC000519.1 RUVBL1 RuvB-like 1 (E. coli 
M97935 STAT1 signal transducer and activator of transcription 1  
AB015718 STK10 serine/threonine kinase 10  
NM_003810.1 TNFSF 10 tumor necrosis factor (ligand) superfamily, member 10  
BC001388.1 ANXA2 Annexin A2  
NM_001630.1 ANXA8 Annexin A8  
U69127.1 FUBP3 far upstream element (FUSE) binding protein 3  
D30658.1 GARS glycyl-tRNA systhetase  
NM_003550.1 MAD1L1 MAD1 mitotic arrest deficient–like 1 (yeast)  
AV703465 NR2F2 nuclear receptor subfamily 2, group F, member 2  
U79718.1 NTHL1 nth endonuclease III–like 1 (E. coli 
NM_006117.1 PECI peroxisomal D3,D2-enoyl-CoA isomerase  
AA911231 PPP3CA protein phosphatase 3, catalytic subunit, α isoform  
NM_014226.1 RAGE renal tumor antigen  
AI302106 RAP2A RAP2A, member of RAS oncogene family  
BC002827.1 TPM4 tropomyosin 4  
U84404.1 UBE3A ubiquitin protein ligase E3A  
AI002002 ABCE1 ATP-binding cassette, subfamily E (OABP), member 1  
NM_003905.1 APPBP1 amyloid β precursor protein binding protein 1, 59 kDa  
AF053641.1 CSE1L CSE1 chromosome segregation 1–like (yeast)  
NM_004398.2 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10  
BC003360.1 DDX18 DEAD (Aso-Glu-Ala-Asp) box polypeptide 18  
NM_003752.2 EIF3S8 eukaryotic translation initiation factor 3, subunit 8, 110 kDa  
NM_003751.1 EIF3S9 eukaryotic translation initiation factor 3, subunit 9 η, 116 kDa  
NM_001968.1 EIF4E eukaryotic translation initiation factor 4E  
AB044548.1 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1  
U66065.1 GRB10 growth factor receptor bound protein 10  
NM_001536.1 HRMT1L2 HMT1 hnRNP methyltransferase–like 2 (S. cerevisiae 
NM_002707.1 PPM1G protein phosphatase 1G, magnesium-dependent, γ isoform  
U49245.1 RABGGTB Rab geranylgeranyltransferase, β subunit  
NM_006666.1 RUVBL2 RuvB-like 2 (E. coli 
NM_002467.1 MYC Homo sapiens v-myc avian myelocytomatosis viral oncogene homologue  
Accession numberNameDescription
AI818488 ADD3 adducin 3 (γ)  
NM_000688.1 ALAS1 aminolevulinate, δ-, synthase 1  
NM_001262.1 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)  
NM_001268.1 CHC1L chromosome condensation 1–like  
AI733465 COL9A2 collagen, type IX, α2  
NM_004084.2 DEFA1 defensin, α1, myeloid-related sequence  
NM_012199.1 EIF2C1 eukaryotic translation initiation factor 2C, 1  
U32645 ELF4 E74-like factor 4 (ets domain transcription factor)  
NM_021999.1 ITM2B integral membrane protein 2B  
NM_002631.1 PGD phosphogluconate dehydrogenase  
M24779.1 PIM1 pim-1 oncogene  
NM_002800.1 PSMB9 proteasome (prosome, macropain) subunit, β type, 9  
U43522.1 PTK2B PTK2 protein tyrosine kinase 2 β  
NM_002908.1 REL v-rel reticuloendotheliosis viral oncogene homologue (avian)  
U12707 WAS Wiskott-Aldrich syndrome (eczema-thrombocytopenia)  
NM_003387.2 WASPIP Wiskott-Aldrich syndrome protein interacting protein  
NM_000700.1 ANXA1 Annexin A1  
NM_001166.2 BIRC2 baculoviral IAP repeat-containing 2  
NM_000560.1 CD53 CD53 antigen  
NM_005890.1 GAS7 growth arrest–specific 7  
NM_000852.2 GSTP1 glutathione S-transferase π  
NM_004964.2 HDAC1 histone deacetylase 1  
NM_002162.2 ICAM3 intercellular adhesion molecule 3  
NM_003641.1 IFITM1 IFN-induced transmembrane protein 1 (9-27)  
NM_000584.1 IL-8 interleukin 8  
NM_000210.1 ITGA6 integrin, α6  
NM_002294.1 LAMP2 lysosomal-associated membrane protein 2  
AI827941 MYH9 myosin, heavy polypeptide 9, nonmuscle  
NM_004688.1 NMI N-myc (and STAT) interactor  
BC000519.1 RUVBL1 RuvB-like 1 (E. coli 
M97935 STAT1 signal transducer and activator of transcription 1  
AB015718 STK10 serine/threonine kinase 10  
NM_003810.1 TNFSF 10 tumor necrosis factor (ligand) superfamily, member 10  
BC001388.1 ANXA2 Annexin A2  
NM_001630.1 ANXA8 Annexin A8  
U69127.1 FUBP3 far upstream element (FUSE) binding protein 3  
D30658.1 GARS glycyl-tRNA systhetase  
NM_003550.1 MAD1L1 MAD1 mitotic arrest deficient–like 1 (yeast)  
AV703465 NR2F2 nuclear receptor subfamily 2, group F, member 2  
U79718.1 NTHL1 nth endonuclease III–like 1 (E. coli 
NM_006117.1 PECI peroxisomal D3,D2-enoyl-CoA isomerase  
AA911231 PPP3CA protein phosphatase 3, catalytic subunit, α isoform  
NM_014226.1 RAGE renal tumor antigen  
AI302106 RAP2A RAP2A, member of RAS oncogene family  
BC002827.1 TPM4 tropomyosin 4  
U84404.1 UBE3A ubiquitin protein ligase E3A  
AI002002 ABCE1 ATP-binding cassette, subfamily E (OABP), member 1  
NM_003905.1 APPBP1 amyloid β precursor protein binding protein 1, 59 kDa  
AF053641.1 CSE1L CSE1 chromosome segregation 1–like (yeast)  
NM_004398.2 DDX10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10  
BC003360.1 DDX18 DEAD (Aso-Glu-Ala-Asp) box polypeptide 18  
NM_003752.2 EIF3S8 eukaryotic translation initiation factor 3, subunit 8, 110 kDa  
NM_003751.1 EIF3S9 eukaryotic translation initiation factor 3, subunit 9 η, 116 kDa  
NM_001968.1 EIF4E eukaryotic translation initiation factor 4E  
AB044548.1 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1  
U66065.1 GRB10 growth factor receptor bound protein 10  
NM_001536.1 HRMT1L2 HMT1 hnRNP methyltransferase–like 2 (S. cerevisiae 
NM_002707.1 PPM1G protein phosphatase 1G, magnesium-dependent, γ isoform  
U49245.1 RABGGTB Rab geranylgeranyltransferase, β subunit  
NM_006666.1 RUVBL2 RuvB-like 2 (E. coli 
NM_002467.1 MYC Homo sapiens v-myc avian myelocytomatosis viral oncogene homologue  

NOTE: Of 1,179 ATRA modulated genes, 302 were potentiated by NSC682994. Among these 302 genes, 163 were up-regulated and 139 were down-regulated. Examples of genes up-regulated and down-regulated by ATRA alone, with NSC having no potentiating effect, are given in groups A and C; examples of genes that are up-regulated or down-regulated by ATRA with further enhancement of either effect due to addition of NSC are given in groups B and D. Bar graphs on the right were made based on the average of gene expression patterns. The numerical value shown in y axis of each diagram is logarithm of ratio with base 2 (i.e., log 2 1/1 = 0 means no change, 1 means ≥2-fold, and −1 means ≤2-fold).

Figure 6.

Modulation of ATRA effects by NSC682994 on IL-8 and MYC expression. Expression patterns observed using microarray analysis were confirmed with quantitative RT-PCR using IL-8 and MYC as examples. NB4 cells were treated with ATRA and/or NSC682994 as before and total RNA was harvested 24 hours posttreatment. Relative expression levels for IL-8 (A) and MYC (B) derived from array (gray) and RT-PCR (black) are indicated.

Figure 6.

Modulation of ATRA effects by NSC682994 on IL-8 and MYC expression. Expression patterns observed using microarray analysis were confirmed with quantitative RT-PCR using IL-8 and MYC as examples. NB4 cells were treated with ATRA and/or NSC682994 as before and total RNA was harvested 24 hours posttreatment. Relative expression levels for IL-8 (A) and MYC (B) derived from array (gray) and RT-PCR (black) are indicated.

Close modal

Given the similarity in RARα2 induction profile of ATRA and sodium butyrate to ATRA plus NSC682994, we asked whether benzodithiophenes could constitute a novel class of HDAC inhibitors, and therefore we examined whether they affect the overall state of histone acetylation. In contrast to sodium butyrate, none of the benzodithiophenes change the overall levels of acetylation of histone H4 (Fig. 7). Although we cannot exclude the possibility that benzodithiophenes can affect histone acetylation in a limited way that could not be detected by analysis of total acetylated histone H4 levels, these results suggest that these compounds exert their effects on ATRA-dependent gene expression and transcriptional activation of RARs by a different mechanism.

Figure 7.

Effects of benzodithiophene analogues on acetylation of histone H4. NB4 cells were incubated with benzodithiophene analogues and ATRA for 24 hours. The levels of histone acetylation were assessed by Western blot using an anti–acetyl-histone H4 antiserum.

Figure 7.

Effects of benzodithiophene analogues on acetylation of histone H4. NB4 cells were incubated with benzodithiophene analogues and ATRA for 24 hours. The levels of histone acetylation were assessed by Western blot using an anti–acetyl-histone H4 antiserum.

Close modal

To evaluate whether the effects of benzodithiophenes on ATRA-mediated activation of gene expression could be due to enhancement of corepressor disassociation and recruitment of coactivator, we carried out a mammalian two-hybrid assay using RARα fused with the VP16 activation domain (RARα-VP16) and either N-CoR or p300 fused to the DNA binding domain of GAL4 [GAL4(DBD)-NCoR or GAL4(DBD)-p300]. After cotransfection of luciferase reporter containing thymidine kinase basal promoter and five GAL4 binding sites with expression vectors for RARα-VP16 and either GAL4(DBD)-N-CoR or GAL4(DBD)-p300 into U-937 cells, the relative luciferase activity was determined. The decrease of luciferase activity in the case of RARα and N-CoR due to ATRA treatment indicates the dissociation of RARα-VP16 and GAL4(DBD)-N-CoR proteins (Fig. 8A), whereas increase in luciferase activity with ATRA treatment when RARα-VP16 and GAL4(DBD)-p300 were coexpressed indicated the association between the two test proteins (Fig. 8B). In both instances, dithiophene potentiated the ATRA effects, although NSC682994 alone had no effect on reporter activity.

Figure 8.

Effect of benzodithiophene analogues on ATRA-modulated interactions of RARα with coactivator p300 or corepressor N-CoR. U937 cells were cotransfected with a luciferase reporter containing five GAL4 DNA binding sites, VP16-RARα, and either GAL4-NCoR (A) or GAL4-p300 (B) expression vectors. Transfected cells were incubated with ATRA and/or NSC682994 for 16 hours, then luciferase assays were done and the relative luciferase activities (untreated cells) were determined. Similar results have been obtained in at least three independent experiments. Columns, means; bars, SD. In all cases, changes in luciferase activities were very significant (P < 0.01), with lesser significance (P < 0.05) corresponding to the result reflecting difference in effects on N-CoR dissociation (A) between ATRA versus “no treatment control”. Statistical analysis was done by Student's t test.

Figure 8.

Effect of benzodithiophene analogues on ATRA-modulated interactions of RARα with coactivator p300 or corepressor N-CoR. U937 cells were cotransfected with a luciferase reporter containing five GAL4 DNA binding sites, VP16-RARα, and either GAL4-NCoR (A) or GAL4-p300 (B) expression vectors. Transfected cells were incubated with ATRA and/or NSC682994 for 16 hours, then luciferase assays were done and the relative luciferase activities (untreated cells) were determined. Similar results have been obtained in at least three independent experiments. Columns, means; bars, SD. In all cases, changes in luciferase activities were very significant (P < 0.01), with lesser significance (P < 0.05) corresponding to the result reflecting difference in effects on N-CoR dissociation (A) between ATRA versus “no treatment control”. Statistical analysis was done by Student's t test.

Close modal

The ability of retinoids to arrest growth, induce differentiation, and cause apoptosis of a variety of malignant cell types has distinguished them as potentially important anticancer agents (30). Nevertheless, when used therapeutically as single agents, retinoids are highly effective only in treatment of APL in which they induce differentiation of malignant cells (3133). This ability of APL cells to respond to ATRA with terminal differentiation is likely due to the presence of RARα gene translocation and expression of the RARα chimeric proteins, which do not respond to physiologic levels of ATRA (12, 13). Although other differentiation inducers, such as HMBA or sodium butyrate, produce some clinical response in patients with myelodysplastic syndrome and myelogenous leukemia (34), a high-dosage requirement for these compounds renders them clinically undesirable. One possible way of enhancing the effects of retinoids on hematopoietic or other malignancies is to combine them with agents, which converge on a common therapeutic target (i.e., RARs). Sodium butyrate and other HDAC inhibitors, which target the enzymatic activity of unliganded RAR/corepressor complexes, are another class of such agents (14, 15, 35). Recently, Ikeda et al. (36) reported that triterpenoid CDDO-Im could potentiate the differentiation of NB4 APL cell line by ATRA, possibly through down-regulation of PML-RARα levels. Now we show that structurally and functionally different classes of molecules of HDAC inhibitors exert similar effects on activities of wild-type RARα as well as the PML-RARα chimeric proteins and ATRA-induced APL cell differentiation. The effects of benzodithiophenes on ATRA-mediated cell differentiation and changes in gene expression were observed at 100-fold lower concentrations than those seen with butyrates, suggesting that benzodithiophenes may be clinically more useful drugs than short fatty acids such as butyrate or valproate. Furthermore, at nanomolar concentrations, NSC682994 alone had no effects on gene transcription, suggesting a higher degree of specificity towards RAR signaling and reduced potential cellular toxicities that may be due to nonspecific effects.

The results of our experiments using ATRA-responsive systems suggest that benzodithiophenes directly target the RAR and/or coregulator activities. Consistent with this, the results of two hybrid experiments addressing the effects of benzodithiophenes on ATRA-induced dissociation of corepressor and association of coactivator indicate that benzodithiophenes have specific effects on the ligand-mediated coregulator exchange that are mechanistically different from that of HDAC inhibitors, which target and inhibit enzymatic activity of associated HDAC. Although the mechanisms accounting for these effects are presently not clear, these effects could be due to the role of benzodithiophenes in affecting posttranslational modification of the receptor which structurally enables a higher rate of coregulator exchange. For example, phosphorylation of RARs by a number of different kinases (3740) has been shown to be both cell context dependent and to play a role in regulating their activities. Furthermore, others and we have reported observations highlighting a cross talk between ATRA and mitogen-activated protein (MAP) kinase signaling in AML cell differentiation (24, 41, 42). Benzodithiophenes could exert effects through direct or indirect interaction with these kinase signaling pathways or an as yet unidentified pathway. Nevertheless, given that at concentrations sufficient to enhance ATRA effects benzoditiophenes do not exert significant effect on gene expression (see Results), it is unlikely that these compounds alone affect the activities of extracellular signal-regulated kinases (ERK) or other MAP kinases. In light of findings that ATRA can induce ERK2 activation in leukemic cells (42), however, it remains to be examined whether benzodithiophenes could stimulate ATRA activation of this or other MAP kinases.

Action of benzodithiophenes on the activity of the RAR obligatory heterodimerization partner RXR is also possible, as RXR activating functions seem to be essential for many, but not all, RAR-dependent developmental functions (4345), suggesting target gene–specific activities. Such an effect would be consistent with the results of microarray experiments, which indicate that expression of some, but not all, ATRA-regulated genes is potentiated by benzodithiophenes.

Benzodithiophenes may also affect function of the nuclear receptor corepressors, rendering them less accessible to the receptors and, thus, shifting the equilibrium from repression towards activation. It has been shown that SMRT can be phosphorylated, and phosphorylation of SMRT is thought to cause loss of affinity for various transcription factors and its export into the cytoplasm (46, 47). It is not clear, however, whether benzodithiophenes exert effects on receptor and/or coregulator phosphorylation. Effects of benzodithiophenes on translation and/or cellular localization of proteins that may affect RARα and PML-RARα function are also possible. Precise mechanisms that underlie cooperation between ATRA and benzodithiophenes in regulating gene expression and cellular differentiation remain to be established and their thorough understanding should contribute to the most effective combinatorial use of these drugs in future therapeutic application.

Grant support: Samuel Waxman Cancer Research Foundation, Leukemia Research Fund of Great Britain, and National Natural Science Foundation of China (grant nos. 30328028 and 30300409).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank George Acs, Ari Melnick, and Jonathan Licht for comments and discussion.

1
Zelent A, Guidez F, Waxman S, Licht JD. Translocations of the RARα gene in acute promyelocytic leukemia.
Oncogene
2001
;
20
:
7186
–203.
2
He LZ, Tribioli C, Rivi R, et al. Acute leukemia with promyelocytic features in PML/RARα transgenic mice.
Proc Natl Acad Sci U S A
1997
;
94
:
5302
–7.
3
Grisolano JL, Wesselschmidt RL, Pelicci PG, Ley TJ. Altered myeloid development and acute leukemia in transgenic mice expressing PML-RARα under control of cathepsin G regulatory sequences.
Blood
1997
;
89
:
376
–87.
4
Brown D, Kogan S, Lagasse E, et al. A PML-RARα transgene initiates murine acute promyelocytic leukemia.
Proc Natl Acad Sci U S A
1997
;
94
:
2551
–6.
5
Doucas V, Evans RM. The PML nuclear compartment and cancer.
Biochimica Et Biophysica Acta-Reviews On Cancer
1996
;
1288
:
M25
–9.
6
Rego EM, Wang ZG, Peruzzi D, He LZ, Cordon-Cardo C, Pandolfi PP. Role of promyelocytic leukemia (PML) protein in tumor suppression.
J Exp Med
2001
;
193
:
521
–9.
7
Grignani F, Pelicci PG. Pathogenetic role of the Pml/RAR-α fusion protein in acute promyelocytic leukemia.
Curr Top Microbiol Immunol
1996
;
211
:
269
–78.
8
Glass CK, Rosenfeld MG. The coregulator exchange in transcriptional functions of nuclear receptors.
Genes Dev
2000
;
14
:
121
–41.
9
Kamashev D, Vitoux D, De The H. PML-RARA-RXR oligomers mediate retinoid and rexinoid/cAMP cross-talk in acute promyelocytic leukemia cell differentiation.
J Exp Med
2004
;
199
:
1163
–74.
10
Perez A, Kastner P, Sethi S, Lutz Y, Reibel C, Chambon P. PMLRAR homodimers: distinct DNA binding properties and heteromeric interactions with RXR.
EMBO J
1993
;
12
:
3171
–82.
11
Minucci S, Pelicci PG. Retinoid receptors in health and disease: co-regulators and the chromatin connection.
Semin Cell Dev Biol
1999
;
10
:
215
–25.
12
Guidez F, Zelent A. Role of nuclear receptor corepressors in leukemogenesis.
Curr Top Microbiol Immunol
2001
;
254
:
165
–85.
13
Lin RJ, Egan DA, Evans RM. Molecular genetics of acute promyelocytic leukemia.
Trends Genet
1999
;
15
:
179
–84.
14
Lin R, Nagy L, Inoue S, Shao W, Miller Jr W, Evans R. Role of histone deacetylase complex in acute promyelocytic lekaemia.
Nature
1998
;
391
:
811
–4.
15
Guidez F, Ivins S, Zhu J, Soderstrom M, Waxman S, Zelent A. Reduced retinoic acid-sensitivities of nuclear receptor co-repressor binding to PML- and PLZF-RARα underlie molecular pathogenesis and treatment of acute promyelocytic leukemia.
Blood
1998
;
91
:
2634
–42.
16
Warrell RP Jr, He LZ, Richon V, Calleja E, Pandolfi PP. Therapeutic targeting of transcription in acute promyelocytic leukemia by use of an inhibitor of histone deacetylase.
J Natl Cancer Inst
1998
;
90
:
1621
–5.
17
Ferrara FF, Fazi F, Bianchini A, et al. Histone deacetylase-targeted treatment restores retinoic acid signaling and differentiation in acute myeloid leukemia.
Cancer Res
2001
;
61
:
2
–7.
18
Gottlicher M, Minucci S, Zhu P, et al. Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells.
EMBO J
2001
;
20
:
6969
–78.
19
Kosugi H, Towatari M, Hatano S, et al. Histone deacetylase inhibitors are the potent inducer/enhancer of differentiation in acute myeloid leukemia: a new approach to anti-leukemia therapy.
Leukemia
1999
;
13
:
1316
–24.
20
Chen A, Licht JD, Wu Y, Hellinger N, Scher W, Waxman S. Retinoic acid is required for and potentiates differentiation of acute promyelocytic leukemia cells by nonretinoid agents.
Blood
1994
;
84
:
2122
–9.
21
Huang LJ, Kuo SC, Perng CY, et al. Synthesis and cytotoxicity of acetyl-4H,9H-naphtho[2,3-b]thiophene-4,9-diones.
Bioorg Med Chem Lett
1998
;
8
:
2763
–8.
22
Chao YH, Kuo SC, Wu CH, et al. Synthesis and cytotoxicity of 2-acetyl-4,8-dihydrobenzodithiophene-4, 8-dione derivatives.
J Med Chem
1998
;
41
:
4658
–61.
23
Chao YH, Kuo SC, Ku K, et al. Synthesis and cytotoxicity of methyl-4,8-dihydrobenzo[1,2-b:5,4-b′]dithiophene-4,8-dione derivatives.
Bioorg Med Chem
1999
;
7
:
1025
–31.
24
Glasow A, Prodromou N, Xu K, von Lindern M, Zelent A. Retinoids and myelomonocytic growth factors cooperatively activate RARA and induce human myeloid leukemia cell differentiation via MAP kinase pathways.
Blood
2005
;
105
:
341
–9.
25
Zelent A. PCR cloning of N-terminal RAR isoforms and APL-associated PLZF-RARα fusion proteins. In: Redfern C, editor. Methods in molecular biology. Vol. 89. Retinoid protocols. Totowa (NJ): Humana Press, Inc.; 1997; p. 307–32.
26
Xiao L, Wang K, Teng Y, Zhang J. Component plane presentation integrated self-organizing map for microarray data analysis.
FEBS Lett
2003
;
538
:
117
–24.
27
Zhu J, Heyworth CM, Glasow A, et al. Lineage restriction of the RARα gene expression in myeloid differentiation.
Blood
2001
;
98
:
2563
–7.
28
Imaizumi T, Yagihashi N, Hatakeyama M, et al. Up-regulation of retinoic acid-inducible gene-I in T24 urinary bladder carcinoma cells stimulated with interferon-γ.
Tohoku J Exp Med
2004
;
203
:
313
–8.
29
Davies PJ, Murtaugh MP, Moore WT Jr, Johnson GS, Lucas D. Retinoic acid-induced expression of tissue transglutaminase in human promyelocytic leukemia (HL-60) cells.
J Biol Chem
1985
;
260
:
5166
–74.
30
Altucci L, Gronemeyer H. The promise of retinoids to fight against cancer.
Nat Rev Cancer
2001
;
1
:
181
–93.
31
Huang ME, Ye YC, Chen SR, et al. Use of all-trans-retinoic acid in the treatment of acute promyelocytic leukemia.
Blood
1988
;
72
:
567
–72.
32
Castaigne S, Chomienne C, Daniel MT, et al. All-trans retinoic acid as a differentiation therapy for acute promyelocytic leukemia. I. Clinical results.
Blood
1990
;
76
:
1704
–9.
33
Warrell RP, Frankel SR, Miller WH, et al. Differentiation therapy of acute promeylocytic leukemia with tretinoin (all-trans-retinoic acid).
N Engl J Med
1991
;
324
:
1385
–93.
34
Andreeff M, Stone R, Michaeli J, et al. Hexamethylene bisacetamide in myelodysplastic syndrome and acute myelogenous leukemia: a phase II clinical trial with a differentiation-inducing agent.
Blood
1992
;
80
:
2604
–9.
35
Grignani F, Kinsella T, Mencarelli A, et al. High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein.
Cancer Res
1998
;
58
:
14
–9.
36
Ikeda T, Kimura F, Nakata Y, et al. Triterpenoid CDDO-Im down-regulates PML/RARα expression in acute promyelocytic leukemia cells.
Cell Death Differ
2005
;
12
:
523
–31.
37
Rochette-Egly C, Adam S, Rossignol M, Egly JM, Chambon P. Stimulation of RARα activation function AF-1 through binding to the general transcription factor TFIIH and phosphorylation by CDK7.
Cell
1997
;
90
:
97
–107.
38
Gianni M, Bauer A, Garattini E, Chambon P, Rochette-Egly C. Phosphorylation by p38MAPK and recruitment of SUG-1 are required for RA-induced RARγ degradation and transactivation.
EMBO J
2002
;
21
:
3760
–9.
39
Taneja R, Rochette-Egly C, Plassat J, Penna L, Gaub M, Chambon P. Phosphorylation of activation functions AF-1 and AF-2 of RARα and RARγ is indispensable for differentiation of F9 cells upon retinoic acid and cAMP treatment.
EMBO J
1997
;
16
:
6425
–65.
40
Rochette Egly C, Adam S, Rossignol M, Egly JM, Chambon P. Stimulation of RARα activation function AF-1 through binding to the general transcription factor TFIIH and phosphorylation by CDK7.
Cell
1997
;
90
:
97
–107.
41
Wang X, Studzinski GP. Activation of extracellular signal-regulated kinases (ERKs) defines the first phase of 1,25-dihydroxyvitamin D3-induced differentiation of HL60 cells.
J Cell Biochem
2001
;
80
:
471
–82.
42
Yen A, Roberson MS, Varvayanis S, Lee AT. Retinoic acid induced mitogen-activated protein (MAP)/extracellular signal-regulated kinase (ERK) kinase-dependent MAP kinase activation needed to elicit HL-60 cell differentiation and growth arrest.
Cancer Res
1998
;
58
:
3163
–72.
43
Kastner P, Mark M, Ghyselinck N, et al. Genetic evidence that the retinoid signal is transduced by heterodimeric RXR/RAR functional units during mouse development.
Development
1997
;
124
:
313
–26.
44
Mascrez B, Mark M, Dierich A, Ghyselinck NB, Kastner P, Chambon P. The RXRα ligand-dependent activation function 2 (AF-2) is important for mouse development.
Development
1998
;
125
:
4691
–707.
45
Matt N, Ghyselinck NB, Wendling O, Chambon P, Mark M. Retinoic acid-induced developmental defects are mediated by RARβ/RXR heterodimers in the pharyngeal endoderm.
Development
2003
;
130
:
2083
–93.
46
Hong SH, Privalsky ML. The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export.
Mol Cell Biol
2000
;
20
:
6612
–25.
47
Wong CW, Privalsky ML. Components of the SMRT corepressor complex exhibit distinctive interactions with the POZ domain oncoproteins PLZF, PLZF-RARα, and BCL-6.
J Biol Chem
1998
;
273
:
27695
–702.