Thymosin β₁₀ Inhibits Angiogenesis and Tumor Growth by Interfering with Ras Function

Angiogenesis, the sprouting of new capillaries from preexisting vasculature, is an essential process in tumor growth (1, 2). Thus, angiogenesis-based therapies have become a very promising modality in the treatment of cancer (3). One of the key mediators of angiogenesis is the vascular endothelial growth factor (VEGF), which can promote the survival, proliferation, and migration of endothelial cells (4). VEGF expression and secretion are stimulated in tumor cells by activation of oncogenes such as Ras (5). VEGF-mediated Ras signaling in endothelial cells is also essential in angiogenic responses (6).

Previously, we reported that thymosin β₁₀ was down-regulated in human ovarian cancer tissues (7). When thymosin β₁₀ was overexpressed in ovarian cancer cells, it acted as a tumor suppressor by disrupting the actin structure. The β-thymosins are a family of highly conserved small peptides that inhibit barbed end actin polymerization by sequestering actin monomers (8). Among them, thymosin β₄ and thymosin β₁₀ are the two most abundant β-thymosins in the mammalian species and coexist in some tissue types at varying ratios (9). Although both peptides share a high degree of sequence homology, they show distinct patterns of expression in several tissues (10) and play different roles during rodent development (11). Recently, the angiogenic effects of several members of the thymosin family of peptides were studied in the chick chorioallantoic membrane model (12). Thymosin β₄, prothymosin, and thymosin α₁ were associated with enhancement of angiogenesis, whereas parathymosin, thymosin β₉, and thymosin β₁₀ were associated with inhibition of angiogenesis. Thymosin β₄ also stimulated tumor metastasis by activating cell migration and angiogenesis (13, 14).

Here, we did cDNA chip analysis to identify genes regulated by thymosin β₁₀. The expression of genes related to angiogenesis,cell migration, and proliferation was dramatically inhibited by thymosin β₁₀ in ovarian cancer cells, including Rac1 (15), nitric-oxide synthase (16), focal adhesion kinase (17), Lim kinase (LIMK1; ref. 18), Wave (WASF1; ref. 19), hypoxia-inducible factor-1α (20), platelet-derived growth factor receptor (21), ELK1 (22), and ARHGEF (23). From this data, it seems that thymosin β₁₀ is involved in the inhibition of angiogenesis and tumor growth, although the underlying mechanisms are not fully understood. Using an adenovirus vector expressing thymosin β₁₀, we found that thymosin β₁₀ significantly inhibited VEGF-induced angiogenesis and tumor growth in vitro, ex vivo, and in vivo. These effects were mediated by thymosin β₁₀ directly binding to Ras and interfering with its downstream signaling pathways. Therefore, thymosin β₁₀ is a multifunctional protein that inhibits Ras and its signaling pathways. These interactions regulate potent antiangiogenic and antitumor effects.

Cell Culture. Human umbilical vein endothelial cell (HUVEC; Clonetics, San Diego, CA) was grown on 0.3% gelatin (Sigma, St. Louis, MO) coated dishes using the EGM-2 Kit (Clonetics). Human ovarian cancer cells (2774) and 293 cells were cultured in DMEM and EMEM, respectively, and were supplemented with 10% fetal bovine serum (FBS) and antibiotics (Life Technologies, Gaithersburg, MD).

Animals. Specific pathogen-free BALB/c and nu/nu mice were supplied by Biogenomics (Seoul, Korea) and Charles River Labs (Wilmington, MA), respectively. All animal studies were approved by the Animal Care and Use Committee of Samsung Medical Center.

Adenovirus and Vector Construction. The construction of an adenovirus vector for green fluorescence protein-thymosin β₁₀ (GFP-AdTβ₁₀) was done as described previously (7). For the adenovirus vector for thymosin β₁₀ (AdTβ₁₀) construct, PCR-amplified full-length human thymosin β₁₀ fragment was cloned into a HindIII/XhoI site of pΔACMVp(A) vector. The adenoviruses were used at 100 multiplicity of infection for infection experiments. To construct pcDNA3.1-thymosin β₄, pcDNA3.1-thymosin β₁₀, and pcDNA4HisMax-thymosin β₄, PCR-amplified full-length human thymosin β₄ and thymosin β₁₀ fragments were cloned into the EcoRI/XhoI site of the pcDNA3.1 vector (Invitrogen) and of the pcDNA4HisMax vector (Invitrogen), respectively.

Small Interfering RNA Construction and Transfection. The siRNA oligonucleotide sequence targeting thymosin β₁₀ (AAGCGGAGUGAAAUUUCCUAA) corresponded to nucleotides 199 to 217 in the human sequence. Small interfering RNA (siRNA) was synthesized by using asiRNA construction kit (Ambion, Austin, TX) and transfected by using the RNAi shuttle (Orbigen, San Diego, CA) according to the manufacturer's protocols. HUVECs were then infected with either GFP-AdTβ₁₀ alone or GFP-AdTβ₁₀ with siRNA transfection. GFP images were captured using a fluorescence microscope (Zeiss, Oberoken, Germany). Total RNA was isolated with TRIZOL Reagent (Life Technologies) and reverse transcription-PCR was done.

[³H]Methylthymidine Incorporation Assay. To measure cell proliferation, HUVECs were infected with either empty adenovirus, AdTβ₁₀, or AdTβ₁₀ + siRNA. To determine the effect of thymosin β₄, HUVECs were transfected with either pcDNA3.1 or pcDNA3.1-thymosin β₄ using the FuGENE 6 reagent (Roche, Mannheim, Germany). After 18 hours, cells were incubated for 6 hours in M199 containing 1% FBS and then stimulated with VEGF (10 ng/mL, R&D Systems, Minneapolis, MN) for 24hours in M199 containing 1% FBS. [³H]methylthymidine (0.5 μCi/mL, Amersham, Arlington Heights, IL) was added 4 hours prior to the assay. The cpm values from cultures were counted with a liquid scintillation counter (Beckman, Fullerton, CA). Independent experiments were repeated thrice and each value represents the mean ± SD of triplicate samples.

Migration and Invasion Assay. Migration and invasion were assayed using Transwells (8-μm pore size, Costar, Cambridge, MA) as described previously (24). For the migration assay, the lower surface of filter was coated with 10-μm of gelatin. M199 containing 1% FBS with VEGF (25ng/mL) was placed in the lower wells. Uninfected, Ad-, AdTβ₁₀-, or AdTβ₁₀ + siRNA–infected HUVECs at a final concentration of 1 × 10⁴cells/100 μL were seeded into each of the upper wells and incubated for 24 hours. Cells were fixed and stained with H&E. Nonmigrating cells on the upper surface of the filter were removed by wiping with a cotton swab. The number of cells that migrated to the lower side of the filter was counted under a light microscope and mean values of eight fields were determined. For the invasion assay, the lower surface and upper surface of filter was coated with 10 μg of gelatin and 10 μg of Matrigel (BD Biosciences, Bedford, MA), respectively. Uninfected, Ad-, AdTβ₁₀-, or AdTβ₁₀ + siRNA–infected HUVECs at a final concentration of 1 × 10⁴cells/100 μL in M199 containing 1% FBS with VEGF (25 ng/mL) were seeded into each of the upper wells and incubated for 30 hours. The fixation and quantification methods are the same as that of the migration assay. To determine the effect of thymosin β₄, HUVECs were transfected with either pcDNA3.1 or pcDNA3.1-thymosin β₄ using the FuGENE 6 reagent. Independent experiments were repeated thrice and each value represents the mean ± SD of triplicate samples.

Tube Formation Assay. Growth factor–reduced Matrigel (200 μL of 10mg/mL) was added into a 24-well plate and polymerized for 30minutes at37°C. Uninfected, Ad-, GFP-AdTβ₁₀–, or GFP-AdTβ₁₀ + siRNA–infected HUVECs (1 × 10⁵ cells) were seeded on the surface of the Matrigel. Cells were then incubated for 48 hours with or without 10ng/mL of VEGF in M199 containing 1% FBS. Morphologic changes of the cells were photographed at ×40 magnification. HUVEC tube length was determined using an inverted microscope with a digital CCD camera (Zeiss) and quantified using ImageLab imaging software (MCM Design). To determine the combined effect of thymosin β₄ and thymosin β₁₀, HUVECs were transfected with either pcDNA3.1, pcDNA3.1-thymosin β₄, or pcDNA3.1-thymosin β₁₀ using the FuGENE 6 reagent. Independent experiments were repeated thrice and each value represents the mean ±SD of triplicate samples.

Ex vivo Angiogenesis Assay. A novel ex vivo angiogenesis assay using explant culture of mouse skeletal muscle on Matrigel was done with some modifications, according to Jang et al. (25). Six-week-old BALB/c mice were anesthetized and the legs were shaved. The tibialis anterior muscle was extracted and then cross-sections of muscle were washed thrice with PBS. The washed muscle was placed in a 24-well plate containing 200 μL of growth factor-reduced Matrigel and polymerized for 30 minutes at 37°C. M199 containing 1% FBS with or without 10 ng/mL of VEGF was added. After 6 days, outgrowth of capillary-like structures was observed and then fresh medium containing either 2 × 10⁸ plaque-forming unit (pfu) of adenovirus or 10 nmol/L of paclitaxel was added. Media were changed every other day. After an additional 5 days, the mean area of microvessels was measured by an optical imaging technique and quantified using ImageLab imaging software. Independent experiments were repeated thrice and each value represents the mean ±SD of triplicate samples.

Yeast Two Hybrid Analysis. LexA-human thymosin β₁₀ or thymosin β₄ fusion protein was constructed and used to screen binding proteins from a human ovary cDNA library (Clontech, Palo Alto, CA). The binding proteins were expressed as B42 fusion proteins. cDNA encoding full length human K-Ras or H-Ras were PCR amplified and ligated separately into the EcoRI/XhoI sites of the B42. Positive interactions were confirmed by cell growth on leucine-depleted yeast synthetic medium and blue colony formation on 5-bromo-4-chloro-3-indolyl-β-d-galactoside (X-gal, 5mmol/L)-containing medium. The activity of the interaction between thymosin β₁₀ or thymosin β₄ and Ras was determined by measuring the relative expression level of β-galactosidase. The β-galactosidase activity was calculated using the formula units = [1,000 × (A₄₂₀ − 1.75 × A₅₅₀)]/(time × volume × A₆₀₀).

Glutathione S-transferase Pull-Down Assay and Coimmunoprecipitation. Glutathione S-transferase–fused thymosin β₁₀ and His-fused K-Ras were purified on a glutathione Sepharose 4B (Amersham Pharmacia Biotech, Piscataway, NJ) and on a Ni-NTA Agarose (Qiagen, Chatsworth, CA) according to the manufacturers' instructions, respectively. Equal amounts of glutathione S-transferase or glutathione S-transferase-thymosin β₁₀ immobilized on glutathione Sepharose beads were incubated with His-K-Ras. Coimmunoprecipitated K-Ras was detected by Western blot with anti-His antibody. For coimmunoprecipitation invivo, HUVECs were transiently transfected with GFP or GFP-Tβ₁₀ using the FuGENE 6 reagent. The endogenous Ras was immunoprecipitated with anti-Ras antibody (Oncogene, Uniondale, NY) and coimmunoprecipitated thymosin β₁₀ was detected by Western blot with an anti-GFP antibody. For coimmunoprecipitation with Ras and thymosin β₄, 2774 cells were transiently transfected with GFP-thymosin β₁₀ or His-thymosin β₄ using the FuGENE 6 reagent. The thymosin β₁₀ or thymosin β₄ was immunoprecipitated with anti-GFP antibody or anti-His antibody, respectively. The coimmunoprecipitated Ras was detected by Western blot with an anti-Ras antibody.

Labeling of the Actin Cytoskeleton. HUVECs were transfected with either pcDNA3.1, pcDNA3.1-thymosin β₄, pcDNA3.1-thymosin β₁₀, or pcDNA3.1-thymosin β₄ with pcDNA3.1-thymosin β₁₀ (1:1) using the FuGENE 6 reagent. After 72 hours, the cells were incubated for 2 hours in M199 containing 1% FBS and then stimulated with or without 50 ng/mL of VEGF for 15 minutes. Cells were fixed and stained with Alexa fluor 488 phalloidin (Molecular Probes, Eugene, OR). Images were analyzed using a fluorescence microscope with a digital CCD camera (Olympus, Lake Success, NY).

Ras activation Assay. Uninfected, Ad-, or AdTβ₁₀-infected HUVECs were serum-deprived overnight and stimulated with or without VEGF (50ng/mL) for 5 minutes in M199 containing 1% FBS (6). The cell lysate was incubated with glutathione S-transferase-Raf1-Ras-binding domain (RBD) in the presence of an immobilized Glutathione Disc (Pierce). The assay was done according to the manufacturers' instructions. The pull-down active Ras was detected by Western blot analysis using anti-Ras antibody.

Ras Guanidine Nucleotide Binding Assay. The assay was done as described (26) with minor modifications. Uninfected, Ad-, or AdTβ₁₀ infected HUVECs were serum-deprived overnight, labeled with 0.2 mCi/mL of [³²P] orthophosphate (Amersham) for 3 hours in a phosphate-free medium (Life Technologies), and stimulated with or without VEGF (50ng/mL) for 5 minutes. Cell lysates were harvested and Ras proteins were immunoprecipitated with anti-Ras antibody. Bound guanine nucleotides were eluted from precipitated protein complexes and analyzed by TLC using polyethyleneimine-cellulose plates (Sigma). The presence of Ras GDP and GTP was assessed by autoradiography and the ratio of GTP to GTP + GDP was determined by densitometry. Similar results were obtained in three independent experiments.

Subcellular Fractionation of Cell Lysates, Western Blot, and Immunoprecipitation. Uninfected, Ad-, or GFP-AdTβ₁₀–infected HUVECs were stimulated with or without VEGF (50 ng/mL) for 5minutes and separated into cytosol, membrane, and nuclear fractions according to the manufacturer's protocols (Calbiochem, La Jolla, CA). Fractionated or total proteins were immunoblotted with specific antibodies to GFP, pMEK, pERK, extracellular signal-regulated kinase (ERK), and VEGF (all obtained from Santa Cruz Biotechnology, Santa Cruz, CA), as well as tubulin antibody (Innogenex, San Ramon, CA). For VEGF immunoprecipitation, concentrated 2774 cell conditioned medium (27) was incubated with VEGF antibody as previously described (28).

S.C. and Orthotopic Tumor Models and Immunohistochemistry. To establish tumors in mice, 1 × 10⁶ of 2774 tumor cells were injected s.c. in the mid-dorsal region. Tumors were allowed to grow for 14 days. Then, an intratumor al injection of 1 × 10⁹ pfu/40 μL of AdTβ₁₀ was done thrice, once every 3 days. Tumor size was evaluated by caliper measurements every 3 days. Mice were sacrificed on day 27 after final virus injection. Tumors were then excised and prepared for immunohistochemistry. For the orthotopic model of 2774 tumor growth, 1 × 10⁶ of GFP-2774 cells were injected into the right ovary through the fat pad. GFP-2774 cells were prepared by stable transfection of pEGFP-C1 (Clontech). GFP-expressing tumors were examined using the Illumatool tunable lighting system (Lightools Research, Encinitas, CA). An intratumoral injection of 1× 10⁹ pfu/20 μL of AdTβ₁₀ was done on day 7 after tumor injection. Mice were sacrificed on day 10 after virus injection. Tumors were then excised and prepared for immunohistochemistry. Frozen sections were stained with rat monoclonal anti-mouse CD31 (PECAM-1) antibody (PharMingen, San Diego, CA). Vascular density in the tumors was calculated by counting the number of blood vessels in three separate tumor cross-sections per group. The specificity of the staining was confirmed with isotype-matched antibodies (normal rat IgG1κ).

Data Analysis and Statistics. Values are presented as the mean ± SD or ± SE. Statistical comparisons between groups were done using the Student's t test. P < 0.05 was considered statistically significant.

Thymosin β₁₀ Inhibits VEGF-Induced Proliferation, Migration, and Invasion of HUVECs. To determine the effects of thymosin β₁₀ on endothelial cell functions crucial to angiogenesis, its effects on VEGF-induced proliferation, migration and invasion of endothelial cells were investigated (Fig. 1). HUVECs were either uninfected or infected with Ad, AdTβ₁₀, or AdTβ₁₀ with siRNA (thymosin β₁₀–targeted small interfering RNA), then DNA synthesis was assayed using [³H]thymidine incorporation (Fig. 1A). As expected, VEGF increased DNA synthesis of uninfected HUVECs and of empty virus-infected HUVECs when compared with unstimulated cells (29). Overexpression of thymosin β₁₀ significantly inhibited VEGF-induced DNA synthesis. This inhibitory effect was not due to cytotoxicity of thymosin β₁₀ in endothelial cells, since thymosin β₁₀ had no effect on the viability of HUVECs in the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (data not shown). In addition, thymosin β₁₀ did not have cytotoxic effects on other normal cell types tested, such as normal fibroblasts, MRC-5 and IMR-90 (data not shown). To further confirm the effect of thymosin β₁₀ on endothelial proliferation, we used RNA interference (30). As shown in Fig. 1B, siRNA markedly inhibited the expression of GFP-thymosin β₁₀ protein and mRNA in HUVECs. However, siRNA did not affect the expression of an irrelevant gene (GAPDH). The inhibitory effect of thymosin β₁₀ on VEGF-induced endothelial cell proliferation was completely restored by siRNA transfection. The results indicate that VEGF-induced endothelial cell proliferation is specifically inhibited by thymosin β₁₀.

To investigate whether overexpressed thymosin β₁₀ modulates the effects of VEGF on endothelial cell migration and invasion, we did Transwell migration and invasion assays. VEGF enhanced the migration (Fig. 1C) and invasion (Fig. 1D) of uninfected HUVECs and of empty virus-infected HUVECs when compared with that of unstimulated cells as expected. However, overexpression of thymosin β₁₀ significantly reduced VEGF-induced migration and invasion of HUVECs. The ablation of overexpressed thymosin β₁₀ by siRNA maintained the stimulatory effects of VEGF on migration and invasion of HUVECs. Therefore, overexpressed thymosin β₁₀ potently inhibited key events of the angiogenic process induced by VEGF, such as proliferation, migration, and invasion of endothelial cells in vitro.

Thymosin β₁₀ Inhibits Tube Formation In vitro and Vessel Sprouting Ex vivo. To confirm that thymosin β₁₀ has direct antiangiogenic effects, we investigated whether overexpression of thymosin β₁₀ could alter endothelial tube formation. Uninfected or empty virus-infected cells incubated with VEGF formed an organized network of endothelial cells on Matrigel (Fig. 2A). In contrast, overexpression of thymosin β₁₀ markedly inhibited VEGF-induced tube formation. The inhibitory effect of thymosin β₁₀ on VEGF-induced tube formation was completely restored by siRNA transfection.

To evaluate whether the thymosin β₁₀ inhibits vessel sprouting, an ex vivo explant assay (25) was done (Fig. 2B). Abundant vessel sprouting was detected in uninfected or empty virus-infected explants in the presence of VEGF. In contrast, overexpression of thymosin β₁₀ showed significantly reduced VEGF-induced vessel sprouting at levels lower than paclitaxel, a cytotoxic cancer drug with antiangiogenic activities. These observations suggest that thymosin β₁₀ effectively suppressed capillary formation in vitro and ex vivo.

Thymosin β₁₀ Interacts With Ras. We next tried to determine the mechanism involved in the inhibition of angiogenesis by identifying proteins which bind to thymosin β₁₀. Thus, we screened for thymosin β₁₀ binding proteins using the yeast two-hybrid system. One prominent gene identified was Ras. Positive interaction was verified by both cell growth and the β-galactosidase assay (Fig. 3A). Direct interaction of Ras with thymosin β₁₀ in vitro wasconfirmed using a glutathione S-transferase pull-down assay (Fig. 3B). The interaction of the two proteins was also shown by co-immunoprecipitation between the endogenous Ras and the exogenously introduced GFP-tagged thymosin β₁₀ (GFP-Tβ₁₀; Fig. 3C). These results indicate that thymosin β₁₀ directly interacts with Ras.

Thymosin β ₄ neither Interacts with Ras nor Inhibits Angiogenesis. To establish the functional consequence of the binding of thymosin β₁₀ to Ras, we compared the Ras binding ability and the effects on angiogenesis of thymosin β₄ with those of thymosin β₁₀, since these proteins apparently share some structural features and functionalities (8, 9), but have divergent effects on angiogenesis (12, 14). First, we determined whether thymosin β₄ also binds to Ras. Interestingly, thymosin β₄ did not bind to Ras in vivo (Fig. 4A and B). Furthermore, consistent with other reports (14, 31), thymosin β₄ had no effect on proliferation and invasion of HUVECs (Fig. 4C and D), whereas thymosin β₁₀ showed inhibitory effects on the activities (Fig. 1). In addition, thymosin β₄ increased migration and tube formation of HUVECs (Fig. 4EF) in contrast to thymosin β₁₀ which was inhibitory (Figs. 1 and 2). To investigate the combined effect of thymosin β₄ and thymosin β₁₀ on the tube formation, both thymosins were simultaneously overexpressed (Fig. 4G). The positive effect of thymosin β₄ on tube formation was overridden by increasing concentrations of thymosin β₁₀, and vice versa. However, thymosin β₄ and thymosin β₁₀ disrupted VEGF-induced stress fiber formation of HUVECs at a similar degree (Fig. 4H). In addition, simultaneous overexpression significantly inhibited the reorganization of the actin architecture in response to VEGF. Therefore, the effects of thymosin β₁₀ when compared with that of thymosin β₄, suggest that inhibition of angiogenesis by thymosin β₁₀ is via a direct interaction with Ras, independent of actin binding.

Thymosin β₁₀ Interferes With Ras Function. To understand the role of thymosin β₁₀ binding to Ras, we first investigated whether thymosin β₁₀ is involved in Ras activity. The stimulation of Ras and subsequent activation of its downstream effector molecules is crucial in angiogenesis (6, 32). Based on the high affinity of active Ras (Ras-GTP) for the RBD of Raf, a downstream effector of activated Ras (33), Ras activation was assayed. Stimulation of serum-deprived HUVECs with VEGF resulted in arobust increase of Raf bound Ras-GTP. On the other hand, overexpression of thymosin β₁₀ in these cells resulted in the absence of the active Ras (Fig. 5A).

We next characterized the molecular mechanism by which thymosin β₁₀ inhibits Ras function. To determine whether thymosin β₁₀ decreases the amount of Ras-GTP or interferes with Raf binding of Ras-GTP, we did a Ras guanidine nucleotide binding assay (Fig. 5B). Very little GTP was detected in untreated cells, but significant amounts of GTP were found in cells treated with VEGF. Contrary to our expectation, thymosin β₁₀ markedly increased the level of GTP. Therefore, it is possible that thymosin β₁₀ interferes with Raf binding of Ras-GTP rather than decreasing the amount of Ras-GTP. This may result in the inhibition of the GTPase activity of Ras and the subsequent accumulation of Ras-GTP. The subcellular localization of thymosin β₁₀ supports this notion (Fig. 5C). GFP-Tβ₁₀ was not only detected in the cytosolic fraction, but also in the membrane fraction (top), indicating that thymosin β₁₀ may bind Ras in the membrane and interfere with Ras signaling. However, thymosin β₁₀ did not affect Ras localization (middle).

Thymosin β₁₀ Inhibits ERK Signaling in Endothelial Cells and Reduces VEGF Expression in Both Endothelial and Tumor Cells. Based on the above findings, we investigated whether thymosin β₁₀ inhibits Ras downstream mitogen-activated protein kinase kinase (MEK) and ERK activation (Fig. 5D). Ras-ERK mediated transcriptional up-regulation of angiogenic factors, such as VEGF, is a well-known mechanism that promotes angiogenesis (29). VEGF-stimulated MEK and ERK phosphorylation were markedly reduced by overexpressed thymosin β₁₀. However, the total ERK level was unaffected by thymosin β₁₀. Therefore, it seems that thymosin β₁₀ inhibits the Ras-ERK signaling pathway in HUVECs. Consistent with these findings, overexpressed thymosin β₁₀ completely inhibited VEGF expression in HUVECs (Fig. 5E). This suggests that thymosin β₁₀ inhibits the autocrine effect of VEGF in endothelial cells and thus, has a direct antiangiogenic effect.

Next, we investigated the effect of thymosin β₁₀ on VEGF production in tumor cells. VEGF is mainly secreted by tumor cells to recruit VEGF receptor–expressing endothelial cells to the tumor (29). Overexpression of thymosin β₁₀ in 2774 ovarian cancer cells resulted in a marked reduction of VEGF expression and secretion into the medium (Fig. 5F). Thus, thymosin β₁₀ decreases VEGF production in tumor cells leading to a suppressed paracrine effect of VEGF on angiogenesis.

Thymosinβ₁₀ Inhibits Tumor Growth and Associated Angiogenesis. To explore whether thymosin β₁₀ has direct antitumor activity, we tested the effects of overexpressed thymosin β₁₀ on tumor cell growth in vitro. We found that thymosin β₁₀ markedly decreased 2774 ovarian cancer cell growth when compared with controls (Fig. 6A).

The antitumor and antiangiogenic activity of thymosin β₁₀ was then evaluated in vivo. Cells (2774) were implanted s.c. in nude mice. We allowed the tumors to grow until they reached a mean volume of 100 mm³. On day 14, an intratumoral injection of 1×10⁹ pfu/40 μL of thymosin β₁₀ was done and repeated every 3days for 9 days. Tumor growth was significantly inhibited by thymosin β₁₀ (Fig. 6B) with no signs of body weight loss or liver toxicity (data not shown). Tumors from thymosin β₁₀–treated mice were excised on day 27 after the final virus injection. The volume of thymosin β₁₀–treated tumors was 77% smaller than those from control mice (Fig. 6C). Moreover, immunohistologic staining of endothelial cells in the thymosin β₁₀–treated mice showed an 89% decrease in the number of blood vessels stained with CD 31.

These antitumor and antiangiogenic effects of thymosin β₁₀ were confirmed in orthotopically injected tumor cells (Fig. 6D). We injected GFP-2774 tumor cells into the right ovary and did intratumoral injections of thymosin β₁₀ on day 7 after tumor injection. GFP-expressing tumors were significantly decreased in thymosin β₁₀–treated mice. The volume of excised tumors on day 10 after virus injection was 54% smaller than those from control mice. Also, the erythema of the tumor due to induction of angiogenesis was dramatically reduced in thymosin β₁₀–treated mice when compared with control mice. Immunohistologic staining of endothelial cells in thymosin β₁₀–treated tumors showed a 77%decrease in the number of blood vessels. Together these resultsshow that overexpressed thymosin β₁₀ potently suppresses angiogenesis and tumor growth in vivo.

This study shows the crucial function of a monomeric actin-sequestering protein, thymosin β₁₀, as a new potent antiangiogenic and antitumor molecule that targets Ras. Here, we suggest a possible mechanism for the inhibition of angiogenesis and tumor growth by thymosin β₁₀, which involves direct binding to Ras thereby inhibiting the Ras-activated MEK/ERK signaling pathway. Ras effector pathways not only affect tumor cell proliferation and survival (34) but also lead to the induction of angiogenesis (5, 6). Induction occurs mainly by means of ERK-mediated transcriptional up-regulation of angiogenic factors and increased invasiveness through both ERK-mediated expression of matrix metalloproteinases and Rac-mediated effects on the cytoskeleton (35). Therefore, Ras-targeted thymosin β₁₀ could play a key role in inhibiting tumor growth and angiogenesis.

In this study, overexpressed thymosin β₁₀ potently inhibited multiple angiogenic processes, including endothelial cell proliferation, migration, invasion, tube formation, and vessel sprouting Figs. 1 and 2. Cell viability was not affected by empty adenoviruses or by thymosin β₁₀–expressing adeonovirus in the angiogenesis assays (data not shown). The combined inhibitory effects of thymosin β₁₀ on critical endothelial functions in angiogenesis may result in a synergistic effect greater than that of blocking any one cellular response alone. This could be explained by the fact that Ras proteins operate as molecular switches in signaling pathways that regulate diverse cell growth and differentiation processes (34, 36). Ras proteins are involved in intracellular signaling from receptor tyrosine kinases which results in the activation of a phosphorylation cascade (37). Growth factors, such as VEGF, fibroblast growth factor, platelet-derived growth factor, nerve growth factor, epidermal growth factor, and insulin activate Ras proteins, but in some cases other factors, such as transforming growth factor-β (38) and angiotensin-2 (39) activate Ras as well. Multiple downstream effectors have also been identified which may lead to alternate pathways. Indeed, we found that thymosin β₁₀ also inhibited Rac activation by suppressing the mRNA expression of the guanosine nucleotide exchange factor, vav (40).³

We had expected another possible mechanism by which thymosin β₁₀ inhibits angiogenesis via disruption of the actin cytoskeleton of HUVECs, because depolymerization of actin stress fiber is well known function of β-thymosins (8, 9). However, thymosin β₄ and thymosin β₁₀ showed the same inhibitory effect on actin polymerization, although they had opposite effects on angiogenesis (Fig. 4). In addition, within the β-thymosin family, the actin binding motif (LKKTETQ) is highly conserved (41), and the seven amino acids motif is essential for their angiogenic activity (42). Thus, angiogenesis inhibition by thymosin β₁₀ is distinct from the common actin binding property of β-thymosins. One possible explanation is that thymosin β₄ and thymosin β₁₀ bind to G-actin ina 1:1 complex forming a large pool of unpolymerized actin that can be easily released when needed for polymerization of actin filaments. However, thymosin β₁₀ inhibits multiple signaling molecules needed for polymerization of actin filaments, such as Rac and Wave⁴

On the other hand, thymosin β₄ and thymosin β₁₀ showed distinct patterns of expression in several tissues (10) and played different roles during rodent development (11). Thymosin β₁₀ mRNA levels were very low in the cardiovascular system of early mouse embryo, in contrast to thymosin β₄ mRNA levels (43). Angiogenesis actively occurs in early development and is commonly controlled by the balance between angiogenic and antiangiogenic factors depending on the demand of the physiologic environment in a development-dependent manner. These literature findings further support the assumption that thymosin β₄ and thymosin β₁₀ act on vessel development in a complementary way in vivo, and this may also be extended to the angiogenesis process. This hypothesis is also supported by the fact that overexpression ofthymosin â₄ and thymosin β₁₀ induces an increased (14) and decreased (Fig. 5E and F) expression of VEGF, respectively.

Thymosin β₁₀ has direct effects on tumor cells. It inhibits 2774 ovarian cancer cell growth. In addition, we found that thymosin β₁₀ inhibited Ras-ERK signaling (data not shown) as well as VEGF secretion (Fig. 5) in these cells. Together, these observations suggest that overexpression of thymosin β₁₀ in whole tumors could disrupt tumor growth and associated angiogenesis through both tumor cell-mediated effects and effects on endothelial cells. This would be expected to be more potent than targeting either cell type alone. It was also observed that thymosin β₁₀ increased phospho-p53 in ovarian cancer cells (data not shown) suggesting the possibility thatthymosin β₁₀ may be related to multiple effector pathways.

Targeting the Ras proteins and their signaling pathways could be very valuable in developing cancer therapies (35). Over 20 cancer therapeutic agents have been developed thus far, but specific inhibitors of upstream activators or downstream mediators showed limited effect on Ras activity. Prenylation, the post-translational modification step, is required for the localization and function of Ras. However, attempting to inhibit prenylation by using farnesyltransferase inhibitors has not been successful in human trials. Although H-Ras is exclusively modified by farnesyltransferase, K-Ras and, to a lesser extent, N-Ras can also be modified by geranylgeranyltransferase. The combined use of farnesyltransferase inhibitors and geranylgeranyltransferase inhibitors (44) has failed because they act on other proteins which are necessary for normal cell growth and show cellular toxicity. We now propose that thymosin β₁₀ may overcome the deficiencies of these existing therapies that target Ras or its signaling pathways. Because thymosin β₁₀ directly binds to Ras and interferes with Ras itself, it acts selectively in its specific inhibition of Ras. Therefore, thymosin β₁₀ could have a greater inhibitory effect on tumor cells and/or tumor vessels containing highly activated Ras compared with normal cells.

In conclusion, thymosin β₁₀ is not only an actin-sequestering protein. It has also been found to block the cellular signaling cascades involved in angiogenesis and in tumor growth. This newly discovered mechanism may lead to the future development of effective cancer therapies using thymosin β₁₀.

Grant support: Korea Science and Engineering Foundation SRC (J-H. Lee) and National Institute of Toxicological Research (S-H. Lee).

The cost of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Hyun Seok Song and Seung Hee Hong for critically reviewing the manuscript.