Depletion of Methionine Aminopeptidase 2

In the article on Depletion of Methionine Aminopeptidase 2 in the May 1, 2004, issue of Cancer Research (1), there is an error on page 2984, in the section under “Materials and Methods” on “Cell and Enzyme Assays”. The text near the end of the section should have read the following: “The targeting sequence was AAUGCCGGUGACACAACAGUA (Dharmacon Research). The control mismatch sequence was AAUGCCGGCGCUACAACAGUA.”

1. Kim S, LaMontagne K, Sabio M, Sharma S, Versace RW, Yusuff N, Phillips PE. Depletion of methionine aminopeptidase 2 does not alter cell response to fumagillin or bengamides. Cancer Res 2004;64:2984–7.