herg1 Gene and HERG1 Protein Are Overexpressed in Colorectal Cancers and Regulate Cell Invasion of Tumor Cells

Cancer development is a multistep process, which includes not only alterations in cell growth and survival, but also the acquisition of the ability to invade surrounding tissues (1, 2). The final step of tumor progression is the establishment of metastases, which represent the major hindrance to cancer therapy (1, 2).

It has been proposed that the altered setting of the plasma membrane electric potential (V_rest) of cancer cells can contribute to tumor growth (3). Our studies have shown that V_rest in tumor cells can often be modulated by the activity of K⁺ channels, encoded by the human ether a-gò-gò related gene (herg; Ref. 4). The corresponding current, I_HERG, can contribute to driving the V_rest of tumor cells to more depolarized values, due to the peculiar biophysical properties of I_HERG (5). Both the herg gene and HERG protein are indeed expressed in tumor cell lines of differing histogenesis (4), as well as in primary human cancers, such as endometrial adenocarcinomas (6), acute myeloid leukemias (7), and lymphoid leukemias (8). In leukemia (7, 8) and neuroblastoma cells (5, 9), HERG channel activity modulates the progression through the mitotic cycle; in these cells an alternative transcript of the herg1 gene, herg1b, was cloned and shown to be mainly expressed during the S phase of the cell cycle (9). On the whole, data gathered thus far suggest that HERG channels may play a prominent role in the control of tumor cell proliferation (7, 8, 9) and apoptosis (10). On the other hand, direct proof for the role of HERG channels in the regulation of tumor progression is lacking thus far, except for the demonstration of a functional association of HERG channels with integrin receptors (11, 12), which are the adhesion receptors mainly involved in tumor cell migration and invasion (1, 2).

Colorectal cancer is the third leading cause of cancer death worldwide (13), and the genetic steps involving mutations of suppressor genes (14, 15, 16) are well known. On the other hand, there is a paucity of molecular predictive indicators for regional disease invasion and metastasis in this type of cancer.

On the basis of these premises, we studied the expression of HERG channels and their role in the process of tumor progression in colorectal cancers.

Human colon cancer cell lines (H630, HCT8, DLD1, and HCT116) were cultured in RPMI 1640 containing 10% FCS and antibiotics (penicillin 100 units/ml and streptomycin 100 μg/ml). H630 cell clones were isolated by limiting dilution. HEK 293 cells were stably transfected with the herg1 gene in the pCDNA3.1(+) vector (Invitrogen; HEK-HERG1 cells) or with the empty vector (HEK-MOCK). Cells were routinely tested for HERG channel expression by RNase protection assay, Western Blot, and patch clamp (see below).

Tissue specimens of paired neoplastic and normal mucosa (collected at least at 10 cm distant from the primary tumor), were obtained from surgical operations in patients suffering from colorectal cancers, after informed written consent was obtained. Patients were all treated at the First Division of General Surgery and Transplantation of Careggi Hospital, Firenze. Patients affected by viral hepatitis or who underwent previous combined neoadjuvant radiochemotherapy were excluded from data collection. Clinicopathological characteristics of patients enrolled in the study (evaluated by L. M.) are reported in Table 1. Eleven polyps obtained from both colonoscopies and surgical operations were also examined. Tissue samples were taken in the operating room and immediately frozen or fixed in 4% formaldehyde in PBS in preparation for being embedded in paraffin. Particular care was taken in sampling normal mucosa to avoid the presence of muscolaris propria, which has been demonstrated to express the herg1 gene and HERG1 protein (17).

Cell invasion was studied essentially as reported in (18). Two hundred μl of cell suspension were inoculated into the upper well of a Boyden chamber in the presence or in the absence of the specific I_HERG inhibitor Way 123,398 (Way; a kind gift from Dr. Walter Spinelli at Wyeth-Ayerst Research, Princeton, NJ) at 40 μm final concentration. After different times of incubation at 37°C, the migrated cells that remained trapped on the lower surface of the filter were fixed, stained with Diff-Quik stain kit (Dade Behering), and counted.

RNase protection assay was performed essentially as reported in Crociani et al. (9), using the herg probe, which is capable of recognizing both the herg1 and the herg1b genes.

Reverse transcription-PCR for the herg1 and gapdh genes was performed as reported previously (7, 8).

The cDNA encoding amino acids 1106–1158 of the HERG1 protein was PCR amplified (5′ primer: GTCGACGGACTCGCTTTCTCAGGT, SalI site italicized; 3′ primer: GCGGCCGCACTGCCCGGGT, NotI site italicized) and cloned in frame with GST gene into pGEX 4T-2 vector (Pharmacia). Rabbit immunization, collection, and testing of the serum were performed as reported for the anti-HERG NH₂ terminus antibody (8).

Membrane protein extraction from HEK 293, H630, and HCT8 cells was performed as described previously (9). Tissues from both cancerous tissues and the corresponding mucosa were lysed by homogenizing samples in cold Tris HCl (pH 7.4) 50 mm, NaCl 125 mm, NP40 0.1%, EDTA 5 mm, and NaF 0.1 m, plus a complete protease inhibitors mixture (Roche). Western blots were obtained as reported (9), loading different amounts of protein extracts (15 μg for HEK-HERG1 cells, 60 μg for H630, HCT116, and HCT8 cells; and 60 μg for neoplastic and normal tissues), and membranes were decorated with the anti-HERG1 COOH-terminus antibody (see above) at 1:1000 dilution. In some experiments the antibody was preincubated with an excess of the antigenic peptide used for immunization.

IHC was performed on 7-μm sections mounted on polylysine-coated slides. After dewaxing and blocking endogenous peroxidases, sections were treated with proteinase K (Roche; 5 μg/ml in PBS) and UltraVBlock solution (LabVision) containing 0.1% Triton X100, and then incubated with the primary antibody (anti-HERG1 COOH-terminus antibody; see above) diluted 1:100 in PBS-UltraVBlock (10:1 v/v) overnight at 4°C. Immunostaining was carried out using a commercially available kit (PicTure Plus kit; Zymed). For the negative control preimmune serum replacing the primary antibody was used.

Patch-clamp recordings were performed on colon carcinoma cell lines at room temperature with an Axopatch 1-D amplifier (Axon Instruments, Foster City, CA), as reported previously (12). The antiarrhythmic drug Way was used at a 1 μm concentration. For data acquisition and analysis, the pClamp hardware and software (Axon Instruments) and Origin (Microcal Software, Northampton, MA) were routinely used.

herg1 gene expression was tested by RNase protection assay in various human colon cancer cell lines (DLD1, HCT8, HCT116, and H630) as performed previously in various cancer cell lines (9). As shown in Fig. 1,A, the herg1 gene was expressed in all of the cell lines examined although at different degrees (see Fig. 1, inset). In particular, HCT116 and H630 cells expressed herg1 at the highest level, whereas HCT8 cells expressed it at the lowest level. No expression of the alternative transcript herg1b could be detected in colon cancer cell lines, whereas it was present in the heart, as expected (9, 19).

The above results were also confirmed by Western blots with a novel anti-HERG1 COOH-terminus antibody developed in our laboratory. The immunoreactivity and specificity of the antibody was first tested on proteins extracted from herg1-transfected HEK 293 cells (Fig. 1,B). The protein pattern was the same as that obtained with commercial anti-COOH-terminus antibodies (9). When tested on colon cancer cells (Fig. 1 C), the antibody recognized the HERG1 protein in its immature (M_r 135,000) and mature (M_r ∼155,000) forms (9). No HERG1B protein was detectable. These experiments also confirmed that H630 and HCT116 cells express the HERG1 protein at higher levels compared with HCT8 cells.

A typical I_HERG could also be recorded in colon cancer cells: a representative example is shown in Fig. 1,D. The inward current that was observed in high potassium extracellular solution (Fig. 1,D′), was completely blocked by Way, specific inhibitor of I_HERG (Fig. 1,D″). The current resulting from the subtraction of traces obtained in the presence and absence of Way (Fig. 1 D‴) displays the typical features of the I_HERG described previously in many tumor cell lines (4, 5).

The role of HERG channels in the invasiveness of colon cancer cells was first studied by analyzing the effect of HERG channel activity on cell migration through Matrigel-coated porous membranes inserted into Boyden chambers. Experiments were performed in the absence or in the presence of the HERG current inhibitor Way (5, 9). As shown in Fig. 2 the addition of Way significantly reduced cell migration in H630, HCT116, and, although to a lesser extent, HCT8 cells; on the other hand, migration of HEK 293 cells, an epithelial cell line devoid of HERG channels, was unaffected by Way addition (Ref. 20; see also Fig. 1 B).

These data show that HERG activity is an important factor regulating cell invasion of colon cancer cells. Moreover, data on Fig. 2 show a trend of correlation between the amount of HERG1 expressed and the invasion potential in the various cell lines, suggesting that the amount of HERG1 protein could somehow modulate the invasive capacity of colon cancer cells.

Because the cells in Fig. 2 were derived from potentially divergent sources (and may have many genetic differences in addition to their HERG expression), to test whether HERG1 expression could be specifically responsible for the difference in invasive capacity in colonic cancer cells, we developed a set of cell lines with various levels of HERG expression from a homogeneous background. Different clones from the H630 cell line were selected to obtain cells displaying low and high HERG expression. Cloning by limiting dilution yielded ∼20 clones, with roughly the same amount of clones with low and high HERG expression. Two clones were chosen displaying both the herg1 mRNA (Fig. 3,A) and the HERG1 protein (Fig. 3,B) at high (clone 3C8) and low (clone 3D3) levels, respectively. A correlation between the amount of HERG1 protein and the average amount of I_HERG expressed in the cell population was confirmed (data not shown). When analyzed regarding their migration through Matrigel, the 3C8 clone displayed an invasion capacity almost three times higher than the 3D3 clone (Fig. 3,C, black bars). The invasive phenotype of the 3C8 clone reverted to the less invasive phenotype (associated with low HERG activity) when the activity of the HERG channels was specifically blocked by Way addition (Fig. 3 C, white bars). The difference in both HERG expression and invasion capacity of the two clones was maintained between 4 and 20 passages, and after freezing and thawing. On the other hand no difference in the growth in soft agar of the two clones was ever detected (10.8 ± 2.9 large colonies/microscopic field in 3D3 versus 11.0 ± 7.0 in 3C8).

The relationship between HERG1 expression and invasion capacity was confirmed by experiments on HEK 293 cells transfected with either a herg1-containing plasmid (HEK-HERG1) or an empty vector (HEK-MOCK). As shown in Fig. 4, cell migration through Matrigel was strongly increased in HEK 293 cells overexpressing herg1 as compared with HEK-MOCK. Here again cell invasion turned out to depend on HERG channel activity (see the inhibitory effect of Way on HEK-HERG1 cells reported in Fig. 4, inset). It is worth noting that Way addition did not alter cell invasion capacity in HEK-MOCK cells (data not shown), as stated above for HEK 293 wild-type cells.

To assess the pathophysiological significance in vivo of the results gathered thus far, we investigated whether HERG channels were expressed also in primary colorectal cancers, and if a correlation existed between such expression and the acquisition of an invasive and metastatic phenotype.

The expression of the herg1 gene and protein was determined in a set of primary colorectal adenocarcinomas (Adk) displaying different anatomical localizations and tumor grades (see Table 1). For each tumor, a sample of the corresponding normal colonic mucosa (M) was also included in the study; some adenomas (Ad) obtained either from surgical operations or endoscopies were also studied. All of the samples were analyzed for herg1 gene expression by reverse transcription-PCR, and HERG1 expression by Western blot and IHC.

As shown in Fig. 5,A the PCR band related to the herg1 transcript was easily detectable in representative samples belonging to Adk, whereas a corresponding band was undetectable both in M and Ad. This result was confirmed by Western blot experiments: a typical experiment is reported in Fig. 5 B. The molecular weight of the band was M_r 145,000, as described in human hearts by Pond et al. (21). Here again HERG1B was not expressed.

A complete IHC analysis of HERG1 protein expression on paraffin sections of all of the cases collected was performed. As shown in Fig. 6 no specific signal relative to HERG1 protein was evident either in epithelial tubules of M (Fig. 6,A) or in Ad (Fig. 6,B); on the other hand, Adk samples were positive for HERG1 (Fig. 6,C), showing a specific labeling of epithelial cells. A focal pattern of staining was always detected in positive Adk samples. Control experiments performed with preimmune serum resulted in no positive staining (a representative example of an Adk sample is shown in Fig. 6 C, inset).

The comparison of data obtained by reverse transcription-PCR and IHC resulted in essentially concordant results: a quantitative analysis of all of the results obtained is reported in Fig. 6,D and shows that the HERG1 protein was never expressed in M (60 of 60 specimens examined), but was expressed in 9% (1 of 11) Ad, and in 75% (39 of 52 cases) of nonmetastatic Adk (Dukes’ A-C). Metastatic (Dukes’ D) Adk turned out to be 100% positive for HERG1 protein expression (8 of 8). Hepatic and peritoneal metastases (Fig. 6 E) not only were positive, but also displayed a widespread and homogeneous staining (rather than showing a focal pattern of HERG1 expression).

We studied the role of HERG channels in colon cancer cell invasiveness, and showed that: (a) almost all of the colon cancer cell lines express the herg1 gene and HERG1 protein; (b) the activity of HERG channels regulates cell invasiveness in many colon cancer cell lines; (c) the amount of HERG1 protein correlates with a more invasive phenotype of colon cancer cells; and (d) whereas no expression of HERG channels was detected in normal human colonic mucosa and adenomas, a high percentage of primary colorectal cancers expressed the HERG channel, with a higher incidence in metastatic cancers. Therefore, these results provide evidence that K⁺ channels belonging to the HERG family are involved in the establishment of an invasive phenotype in colorectal cancer cells both in vitro and in vivo.

Data reported in this article point to the conclusion that the role of HERG channels in primary solid tumors like colorectal cancers could be that of determining the acquisition of features leading to the establishment of a true invasive and metastatic cancer. Therefore, the immunohistochemical detection of HERG1 protein could represent an independent prognostic factor in the future.

On the whole, voltage-dependent K⁺ channels, especially those belonging to the HERG subfamily, could represent oncogenic products, because they promote cell proliferation and survival (7, 8, 9, 10), and contribute to conferring a malignant, invasive phenotype to cancer cells.

Targeted therapies promise to revolutionize the care of cancer patients: HERG channels and their inhibitors could be used not only as novel prognostic factors but also as novel molecular targets in the future.

We thank Dr. Giacomo Trallori (Gastroenterology Unit, Careggi Hospital, Firenze) and the operation room staff of the First Division of General Surgery and Transplantation, Careggi Hospital, Firenze, Italy.