We developed a novel microarray system to assess gene expression, DNA methylation, and histone acetylation in parallel, and to dissect the complex hierarchy of epigenetic changes in cancer. An integrated microarray panel consisting of 1507 short CpG island tags located at the 5′-end regions (including the first exons) was used to assess effects of epigenetic treatments on a human epithelial ovarian cancer cell line. Treatment with methylation (5-aza-2′-deoxycytidine) or deacetylation (trichostatin A) inhibitors alone resulted in up-regulation of 1.9 or 1.1% of the genes analyzed; however, the combined treatment resulted in synergistic reactivation of more genes (10.4%; P < 0.001 versus either treatment alone). On the basis of either primary or secondary responses to the treatments, genes were identified as methylation-dependent or -independent. Synergistic reactivation of the methylation-dependent genes by 5-aza-2′-deoxycytidine plus trichostatin A revealed a functional interaction between methylated promoters and deacetylated histones. Increased expression of some methylation-independent genes was associated with enhanced histone acetylation, but up-regulation of most of the genes identified using this technology was because of events downstream of the epigenetic cascade. We demonstrate proof of principle for using the triple microarray system in analyzing the dynamic relationship between transcription factors and promoter targets in cancer genomes.

Microarray approaches used to study functional DNA-protein interactions (1, 2, 3) have revealed recently that many transcription regulators are linked to chromatin remodeling (3, 4), placing this type of epigenetic change at the center of gene regulation. Repressed chromatin and gene silencing are associated with changes in DNA methylation and histone acetylation (5), and whereas these epigenomic modifications are widely recognized as contributing factors in human tumorigenesis, their molecular basis is not understood yet. One model suggests that methylated DNAs at the 5′-end regulatory regions recruit MBD4 proteins, which are known to complex with HDACs and other transcriptional corepressors (6). Deacetylation of lysine groups on histones 3 and 4 occurs via HDACs, resulting in a tighter interaction between negatively charged DNA and positively charged lysine, and a closed, repressive chromatin configuration (5, 6). How repressive chromatin structures assemble onto DNA is not clear, but changes in methylation status of CpG islands in gene promoters presumably play a central role (5). We developed recently a microarray approach called differential methylation hybridization for screening CpG methylation and identifying loci susceptible to epigenetic modifications in various cancers (7, 8, 9). However, to fully elucidate the functional relationship between DNA methylation and histone acetylation in gene silencing, a genomic microarray system for detecting changes in gene expression, DNA methylation, and histone acetylation would be necessary.

We developed an integrated “triple” microarray system to decipher the hierarchies of epigenetic regulation of gene expression in cancer cells. The microarray panel used in this novel approach contains 1507 ECISTs, short genomic fragments (0.2–2-kb) located at the 5′-end regulatory regions of genes (10). We used the GC-rich components of ECISTs for screening methylated CpG sites, the exon-containing portions (i.e., the first exons) for measuring levels of the corresponding transcripts, and the promoter sequences within ECISTs for identifying chromatins immunoprecipitated with antibodies against acetylated histones. It is well known that DNA methylation and histone acetylation work in concert to regulate gene expression, and this new microarray system provides an effective means of segregating at specific loci expression changes that occurred as a consequence of reversing promoter hypermethylation status by epigenetic treatments.

Cell Culture.

A human epithelial ovarian cancer cell line CP70 (gift from Dr. Robert Brown, University of Glasgow, Glasgow, United Kingdom) was cultured in the presence of vehicle (PBS) or DAC (0.5 μm; medium changed every 24 h). After 4 days, cells were either harvested or treated with TSA (0.5 μm) for 12 h and then harvested. Some cells were also treated with TSA alone for 12 h before harvest. DNA and RNA were isolated using the QIAamp Tissue and RNeasy kits (Qiagen), respectively.

Microarray Screening of ECISTs.

To identify ECISTs (including the first exons), RLCS (11) was used to prepare targets for screening of CpG island clones derived from a genomic library, CpG Island library (12). In the presence of T4 RNA ligase, an RNA adapter (0.5 nmol, 5′-ACC GGA GCG GCA CGG GAA AUA GAG CAA CAG GAA A) was ligated to the 5′-ends of decapped mRNAs derived from the Stratagene Human Universal Reference RNAs. After reverse transcription, full-length cDNAs were amplified by long RT-PCR (TaqPlus Long PCR system; Stratagene) with the flanking 5′- and 3′-adapters (5′-GCA CGG GAA ATA GAG CAA CAG and 5′-GGC CGA CTC ACT GCG CGT CTT CTG, respectively). A low number of PCR cycles (18–25) were used to preserve the linearity of amplification. Amplified products were labeled with Cy3 fluorescent dyes as described (10) and hybridized to the CGI microarray panel. Hybridization and posthybridization procedures were performed.5 Hybridized slides were scanned with the GenePix 4000A (Axon). The acquired images and data were transferred to Excel spreadsheets for additional analysis using GenePix Pro 3.0. CGI loci with signal intensities 2-fold greater than local background were scored as positive for containing expressed sequences.

Methylation Microarray Analysis.

Preparation of methylation amplicons was carried out essentially as described (7). Briefly, CP70 DNA (∼1 μg) was digested with MseI and then ligated to a PCR-linker. The ligated DNA was digested with methylation-sensitive endonucleases BstUI and HpaII, and amplified with a linker primer by PCR. DNA obtained from a normal ovary tissue was prepared similarly. Genomic fragments containing methylated sites were protected from enzymatic restrictions and could be amplified; however, fragments containing unmethylated sites were digested and, thus, not present in the amplified samples. CP70 amplicon was labeled with Cy5 (red), whereas the control amplicon was labeled Cy3 (green). Both samples were cohybridized onto an ECIST microarray slide and processed as described (7).

Expression Microarray Analysis.

Total RNA (100 μg) was prepared from control (vehicle treated) CP70 cells, or cells cultured with TSA and/or DAC. The RLCS method was used to generate full-length cDNAs. For quality control, the Rapid Amplification of cDNA Ends method was used to determine the integrity of 5′-ends of a few cDNA sequences (10). Cy5-labeled cDNAs from treated cells and Cy-3-labeled cDNAs from untreated cells were cohybridized to the ECIST panel, and microarray images obtained were processed accordingly.

ChIP Microarray Analysis.

The protocol used to identify immunoprecipitated E2F1 targets (2) was adapted for this study. To obtain a network of DNA-protein biopolymers, treated or untreated CP70 cells (2 × 107 cells/assay) were cross-linked using 1% formaldehyde. Cell nuclei were collected by microcentrifugation, and cross-linked chromatin fibers were isolated and fragmented to ∼600-bp by sonication. Immunoprecipitation was carried out with 5 μg of antiacetylated histone H3 or H4 rabbit polyclonal antibody (Upstate) or no-antibody (negative control). DNA was additionally released by digesting the immunocomplex with proteinase K. Purified chromatin DNA (a total of ∼1 μg) was recovered from 10–15 preparations for fluorescent labeling. Microarray hybridization, posthybridization washing, and slide scanning have been described previously by us (2).

Microarray Data Analysis.

The Cy3 and Cy5 fluorescence intensities of hybridized ECIST spots were obtained for each experiment. Because Cy5 and Cy3 labeling efficiencies varied among samples, the Cy5:Cy3 ratio of each spot was normalized according to the global ratio in each microarray image. As described in our previous studies (7, 9, 10), the derived normalization factor was additionally verified based on 14 internal controls of which the adjusted ratios were expected to be 1. Microarray experiments were repeated twice. A self-hybridization study using two equal portions of a test DNA sample was conducted for quality control. These self-hybridizing spots usually had adjusted Cy5:Cy3 ratios approaching 1.

Nucleotide Sequencing.

Plasmid DNA was prepared from ECISTs and sequenced using the DyeDeoxy Terminator reaction (Applied Biosystems) and the ABI PRISM 377 sequencer. The sequencing results were compared with GenBank for known sequence identities.

COBRA.

Sodium bisulfite modification of genomic DNA, which converts unmethylated but not methylated cytosine to uracil, was performed using the CpG Genome modification kit (Intergen). COBRA was performed as described (13). Briefly, ∼200 ng of treated DNA were used as the template for PCR with specific bisulfite primers (Table 1) for a given locus. 32P-labeled PCR products were digested with BstUI, separated on 8% polyacrylamide gels, and subjected to autoradiography using a PhosphorImager (Amersham-Pharmacia).

Semiquantitative RT- and ChIP-PCR.

cDNA and chromatin DNA were prepared as described earlier. Diplex PCR (for both test and control targets) was performed using the AmpliTaq Gold polymerase (Perkin-Elmer). For RT-PCR, primer pairs were used to amplify a region (average 200-bp) from the 3′-end of a test gene, whereas for ChIP-PCR, primers were designed to amplify a fragment in the promoter or first exon region (average 200-bp) of the test gene (see Table 1 for primer information). After 20–25 cycles of amplification, radiolabeled PCR products were run on 5–8% polyacrylamide gels. A PhosphorImager was used to analyze the dried gels, and densitometric analysis of the observed bands was performed using ImageQuant (Molecular Dynamics). The relative levels of gene expression or histone acetylation were normalized with the level of the control run in the same lane.

ECIST Microarray.

Using RLCS, we screened a library of ∼9000 CGIs (12) and recovered 1,507 ECIST-positive loci. To confirm whether these ECISTs were located at the 5′-ends of genes, nucleotide sequencing was performed on 250 of these loci. Sequencing data showed that: (a) 79% (198) contained sequences located in the promoter and first exon of known genes; (b) 16% (40) matched genomic sequences and may contain as yet uncharacterized expressed sequences; and (c) 5% (12) contained non-exon 1 expressed sequences. These results suggest that the ECIST loci identified here can be effectively used to assess epigenetic alterations in cancer cells.

Triple Microarray Screening.

To assess gene expression, DNA methylation, and histone acetylation in parallel, CP70 cells were treated with a demethylating agent, DAC, and/or an inhibitor of HDACs, TSA, and then subjected to triple microarray procedures (Fig. 1,A). Representative individual gene loci are marked by arrows in Fig. 1,B. At a hypermethylated locus in untreated CP70 cells (Fig. 1,B, top panels), DAC plus TSA treatments increased expression (normalized Cy5:Cy3 = 5.5) and histone hyperacetylation (3.4-fold relative to the control) of this gene. The combined treatment of DAC plus TSA also increased expression and histone hyperacetylation of a locus that was not hypermethylated in untreated CP70 cells (Fig. 1 B, bottom panels).

The total number of ECISTs up-regulated ≥4-fold by epigenetic treatments was determined. Treatment with DAC or TSA alone resulted in up-regulation of 29 (1.9% of 1507 loci) or 17 (1.1%) loci, respectively; however, a greater number of genes (150 or 10.4%; P < 0.001 versus either treatment alone) were up-regulated after the combined treatment (Fig. 2, A–C). The epigenetic treatments also resulted in down-regulation of a few ECIST loci (≤0.25-fold), but this response was not the focus of our investigation. Histone hyperacetylation was measured in the combined treatment and scored when a locus showed a normalized Cy5:Cy3 ratio 2-fold greater in the treated cells than that of untreated cells (2). Using this cutoff, hyperacetylated loci were detected in 3.6% (55; red circles in Fig. 2 C) of the 1507 ECISTs examined.

To identify hypermethylated ECISTs, a normalized Cy5:Cy3 ratio ≥1.5 relative to the control was used. This cutoff ratio was used by us to reliably identify hypermethylated CpG islands in various cancers (7, 9, 14). The genes up-regulated by the combined treatment of DAC plus TSA were additionally divided into two groups (Fig. 2,D): hypermethylated (group 1, yellow spots; see Table 2) and no detectable methylation (group 2, blue spots; see Table 3). As shown in Fig. 2 C, up-regulation of group 1 loci is more closely associated with histone hyperacetylation than that of group 2 loci (64%; 22 of 34 loci versus 28%; 33 of 116 loci).

Up-Regulation of Methylation-silenced Genes in Response to Epigenetic Treatments.

Within group 1 genes, increased expression of only a few loci (n = 11) was observed after treatment with DAC alone; however, the combined treatment of DAC and TSA resulted in up-regulation of 34 loci (Fig. 2,D). No significant change in expression of group 1 genes was seen in CP70 cells treated with TSA alone. To confirm the microarray findings, three gene loci from Group 1 (HSPA.2, CYP27B1, and EIF1A) were additionally analyzed. Hypermethylation of the HSPA.2 CpG island in CP70 cells was confirmed using COBRA (Fig. 3, row 1, left panel), and no expression of HSPA.2 was detected in untreated CP70 cells using RT-PCR (Fig. 3, row 1, middle panel). However, HSPA.2 expression was increased by DAC treatment, remained unchanged after treatment with TSA alone, and was markedly increased by the combined treatment of DAC and TSA (Fig. 3, row 1, middle panel). Furthermore, after treatment of CP70 cells with DAC plus TSA, histones H3 and H4 in the promoter region of HSPA.2 were determined to be hyperacetylated using ChIP-PCR (Fig. 3, row 1, right panel). These results support previous reports (3, 4) that the concerted action of DNA demethylation and histone hyperacetylation resulted in synergistic re-expression of methylation-silenced genes.

In untreated CP70 cells, partial methylation of the CYP27B1 CpG island was observed, and expression of CYP27B1 was low; however, treatment of CP70 cells with DAC plus TSA resulted in histone hyperacetylation and increased expression of CYP27B1 (Fig. 3, row 2). Contrariwise, despite the strong hyperacetylation observed at the EIF1A locus, expression of EIF1A remained largely unaffected by the epigenetic treatments. The EIF1A locus we identified, located on human chromosome 1 (15), was determined to be hypermethylated in CP70 cells by using COBRA. It has been reported that multiple copies of EIF1A exist at different chromosomal regions, e.g., chromosomes X and Y (16), and it seems reasonable to suggest that one or more of these loci remain unmethylated, and, thus, contribute to the basal expression of EIF1A detected by RT-PCR (Fig. 3, row 3).

Up-Regulation of Methylation-independent Genes in Response to Epigenetic Treatments.

A total of 116 loci were up-regulated (≥4-fold) by the epigenetic treatments (blue spots; see also Fig. 2,D), but expression of these loci appeared to be unrelated to DNA methylation. From this group, 8 loci were additionally analyzed using COBRA, RT-PCR, and ChIP-PCR (Fig. 4, A and B). The loci were unmethylated in CP70 cells, and expression of these loci was low or absent in untreated CP70 cells. Increased expression of some of these loci was observed after treatment with DAC or TSA alone. The combined treatment induced expression of all 8 of the loci, but histone hyperacetylation was seen in only the promoter regions of MDS1, SC13C2, and UNG2 (Fig. 4 A). On the basis of the response of these 8 loci to the epigenetic treatments, we additionally subdivided the methylation-independent loci into two groups: group 2a, methylation-independent, histone acetylation-enhanced genes (n = 33) and group 2b, methylation- and histone acetylation-independent genes (n = 83).

To additionally define epigenetic modifications and order of epigenomic events at CpG islands on a global scale, we have developed a microarray system that combines gene expression, DNA methylation, and DNA-protein interaction analyses. To our knowledge, this represents the first report of a genomic approach that is capable of dissecting the complex hierarchy of transcriptional controls orchestrated by the epigenomic machinery. This integrated microarray system allows for both the identification of individual genes and a systematic analysis of the relationship among the epigenetic machinery, promoter targets, and downstream responses regulated by the epigenome.

It has been demonstrated that pharmacological reversal of promoter hypermethylation status results in global and specific changes in gene expression (3, 5); in addition, inhibiting DNA methylation has both primary (direct) and secondary (indirect) effects on gene expression (3, 17, 18). Using the triple analysis approach, we identified both primary and secondary responses, and additionally categorized those responses into three groups of genes based on their methylation status: group 1, methylation-dependent, and groups 2a and b, methylation-independent. For group 1 genes, transcriptional silencing is dominated by methylation (Fig. 3). Reactivation of genes silenced by CpG methylation would presumably involve a series of steps, including removal of MBD proteins from demethylated DNA and/or transcriptional repressors that are recruited by MBD proteins (5). Epigenetic complexes have been shown to possess chromatin-remodeling activity and produce structures refractory to transcriptional activation (5). Disrupting these complexes would presumably diminish their activity and result in a more open, transcriptionally active chromatin configuration. A physical association between methylated DNAs and deacetylated histones has been shown recently (19), and our observation that synergistic reactivation of methylation-silenced genes (group 1) could only be achieved by the combined treatment is suggestive of a functional interaction between the epigenetic modifications. Whether this functional relationship is because of a direct or indirect interaction between the molecular targets remains to be elucidated.

The triple array analysis revealed an effect of the drug treatments on methylation-independent gene expression. Group 2a represents a class of distinct genes with unmethylated promoters of which the increased expression is produced by TSA alone or the combined treatment, but not by DAC alone. It is unclear how DAC and TSA act mechanistically on unmethylated promoters, but it was shown recently that DNA methyltransferase 1 (3), in the absence of DNA methylation, can directly suppress transcription through actions with HDACs (3, 19). Our observation that enhanced histone hyperacetylation of MDS1 required both DAC and TSA supports a role for a methylation-independent effect of DNA methyltransferase 1 in ovarian cancer cells; furthermore, these observations indicate that HDAC activity may play a role in the epigenetic-associated control of group 2a gene expression. The majority of genes we identified in this triple array analysis belonged to group 2b, which showed enhanced expression independent of both DNA demethylation and histone acetylation. Up-regulation of these loci by DAC plus TSA treatments is most likely because of an event downstream of modulations in the epigenetic cascade. There are several possible, but not mutually exclusive, mechanisms that may account for this secondary effect, including increased post-transcriptional processing (RNA stability), reactivation of an upstream transcription factor, or regulation by target genes in an induced signal transduction pathway (20).

Induction of some of the genes in group 2 is likely to be associated with cellular responses to drug toxicity or stress, as shown recently by several groups using microarrays to examine gene expression profiles in DAC-treated human cancer cell lines (3, 17, 21). Furthermore, many of the stress-response genes induced by DAC show similar early and transient expression characteristics (21). For example, early induction of the apoptosis promoting factor BIK was observed after DAC treatment of a human lung cancer cell line, and BIK expression returned to control levels by 72 h after treatment with DAC (21). Interestingly, the BIK gene, which does not contain a CpG island, is also induced in a methylation-independent manner by TSA (3). In contrast, DAC treatment gradually induces expression of methylation-dependent genes and their downstream targets (17, 21), and expression of these genes has been shown to be prolonged or increased as demethylation progresses (17, 21). In this regard, our triple microarray system is well suited for distinguishing early stress-response genes from late genes induced by epigenetic treatments over time, and our future studies will investigate this and the effect of other modulators on epigenetic pathways.

The current study offers proof of principle for a triple microarray system capable of interrogating the complex hierarchy of epigenetic changes often seen in human cancer. This integrated approach is useful for identifying novel therapeutic targets and more fully understanding the mechanisms underlying epigenetic gene silencing. The continued development of the triple microarray will be useful for assessing the specificity of emerging epigenetic therapies based on reactivating the expression of methylation-silenced genes in cancer and other diseases.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

Supported in part by National Cancer Institute Grants CA-85289 (to K. P. N.), -69065, and -84701 (to T. H-M. H.), and by Epigenomics, Inc. T. H-M. H. was a recipient of a travel fellowship from the Foundation for Promotion of Cancer Research, Japan.

4

The abbreviations used are: MBD, methyl-CpG binding domain; HDAC, histone deacetylase; ECIST, expressed CpG island sequence tag; DAC, 5-aza-2′-deoxycytidine; TSA, trichostatin A; RLCS, RNA ligase-mediated cDNA synthesis; ChIP, chromatin immunoprecipitation; COBRA, combined bisulfite restriction analysis; RT-PCR, reverse transcription-PCR.

5

Internet address: http://www.microarrays.org.

Fig. 1.

A, schematic flowchart for parallel assessment of gene expression, DNA methylation, and histone acetylation in ovarian cancer cell line CP70. B, representative microarray images for the triple analysis. Cy5- and Cy3-labeled targets were prepared as described in the text and cohybridized to the ECIST microarray panel. The hybridization images were acquired, and signal intensities of ECIST spots (see examples marked by arrows) were calculated. The normalized Cy5:Cy3 ratios are shown at the bottom of each microarray panel image.

Fig. 1.

A, schematic flowchart for parallel assessment of gene expression, DNA methylation, and histone acetylation in ovarian cancer cell line CP70. B, representative microarray images for the triple analysis. Cy5- and Cy3-labeled targets were prepared as described in the text and cohybridized to the ECIST microarray panel. The hybridization images were acquired, and signal intensities of ECIST spots (see examples marked by arrows) were calculated. The normalized Cy5:Cy3 ratios are shown at the bottom of each microarray panel image.

Close modal
Fig. 2.

Scatter plots (AC) of the triple analysis in CP70 cells using the ECIST microarray panel. Microarray hybridization was conducted as described in the text. Cy5:Cy3 ratios of ≥4 (red line) or ≤0.25 (green line) were used to identify up- or down-regulated genes, respectively, in response to epigenetic treatments. Yellow and blue spots depict hypermethylated and unmethylated loci, respectively, in CP70 cells. Red circles indicate hyperacetylated ECIST loci identified by microarray analysis (see additional description in the text). D, total number of up-regulated ECIST loci in response to various epigenetic treatments.

Fig. 2.

Scatter plots (AC) of the triple analysis in CP70 cells using the ECIST microarray panel. Microarray hybridization was conducted as described in the text. Cy5:Cy3 ratios of ≥4 (red line) or ≤0.25 (green line) were used to identify up- or down-regulated genes, respectively, in response to epigenetic treatments. Yellow and blue spots depict hypermethylated and unmethylated loci, respectively, in CP70 cells. Red circles indicate hyperacetylated ECIST loci identified by microarray analysis (see additional description in the text). D, total number of up-regulated ECIST loci in response to various epigenetic treatments.

Close modal
Fig. 3.

Analysis of DNA methylation, gene expression, and histone acetylation in methylation-dependent ECIST loci. Methylation analysis: COBRA was used to determine the methylation status of ECIST loci in ovarian cancer cell line CP70 (gene names are shown at left). Genomic DNA (2 μg) was bisulfite-treated and subjected to PCR using primers flanking the interrogating BstUI site(s) in each ECIST locus. 32P-labeled products were digested with BstUI and separated on 8% polyacrylamide gels. As shown, the digested fragments reflect BstUI methylation within a CpG island. Control DNA was methylated in vitro with the SSI methylase. +: BstUI digestion; −: without BstUI digestion. Expression analysis: total RNA (2 μg) isolated from treated (+) or untreated (−) CP70 cells was used to generate cDNA for RT-PCR. Arrows indicate the positions of amplified fragments. The level of each ECIST expression was compared with that of β-actin (marked by C). Acetylation analysis: chromatin DNA was immunoprecipitated with antiacetylated histone 3 (Anti AcH3) or 4 (Anti AcH4) and subjected to PCR using primers located at the 5′-ends of a test gene. Arrows indicate the positions of amplified products. The level of histone acetylation for an ECIST locus was compared with that of a control locus (C), either GTF2H4 or FLJ31996.

Fig. 3.

Analysis of DNA methylation, gene expression, and histone acetylation in methylation-dependent ECIST loci. Methylation analysis: COBRA was used to determine the methylation status of ECIST loci in ovarian cancer cell line CP70 (gene names are shown at left). Genomic DNA (2 μg) was bisulfite-treated and subjected to PCR using primers flanking the interrogating BstUI site(s) in each ECIST locus. 32P-labeled products were digested with BstUI and separated on 8% polyacrylamide gels. As shown, the digested fragments reflect BstUI methylation within a CpG island. Control DNA was methylated in vitro with the SSI methylase. +: BstUI digestion; −: without BstUI digestion. Expression analysis: total RNA (2 μg) isolated from treated (+) or untreated (−) CP70 cells was used to generate cDNA for RT-PCR. Arrows indicate the positions of amplified fragments. The level of each ECIST expression was compared with that of β-actin (marked by C). Acetylation analysis: chromatin DNA was immunoprecipitated with antiacetylated histone 3 (Anti AcH3) or 4 (Anti AcH4) and subjected to PCR using primers located at the 5′-ends of a test gene. Arrows indicate the positions of amplified products. The level of histone acetylation for an ECIST locus was compared with that of a control locus (C), either GTF2H4 or FLJ31996.

Close modal
Fig. 4.

Triple analysis of group 2a ECIST loci (A, methylation-independent and histone acetylation-enhanced) and group 2b loci (B, methylation- and histone acetylation-independent). See also “Results” section for nomenclature of group 2s. Methylation analysis: COBRA (combined bisulfite restriction analysis) was used to determine the methylation status of ECIST loci in ovarian cancer cell line CP70 (gene names are shown at left). Genomic DNA (2 μg) was bisulfite-treated and subjected to PCR using primers flanking the interrogating BstUI site(s) in each ECIST locus. 32P-labeled products were digested with BstUI and separated on 8% polyacrylamide gels. As shown, the digested fragments reflect BstUI methylation within a CpG island. Control DNA was methylated in vitro with the SSI methylase. +: BstUI digestion; −: without BstUI digestion. Expression analysis: total RNA (2 μg) isolated from treated (+) or untreated (−) CP70 cells was used to generate cDNA for RT-PCR. Arrows indicate the positions of amplified fragments. The level of each ECIST expression was compared with that of β-actin (marked by C). Acetylation analysis: CP70 cells were treated with DAC plus TSA (+) or untreated (−). Chromatin DNA was then immunoprecipitated with (+) or without (−) antiacetylated histone 3 (Anti AcH3) or 4 (Anti AcH4) and subjected to PCR using primers located at the 5-ends of a test gene. Arrows indicate the positions of amplified products. The level of histone acetylation for an ECIST locus was compared with that of a control locus (C), either GTF2H4 or FLJ31996.

Fig. 4.

Triple analysis of group 2a ECIST loci (A, methylation-independent and histone acetylation-enhanced) and group 2b loci (B, methylation- and histone acetylation-independent). See also “Results” section for nomenclature of group 2s. Methylation analysis: COBRA (combined bisulfite restriction analysis) was used to determine the methylation status of ECIST loci in ovarian cancer cell line CP70 (gene names are shown at left). Genomic DNA (2 μg) was bisulfite-treated and subjected to PCR using primers flanking the interrogating BstUI site(s) in each ECIST locus. 32P-labeled products were digested with BstUI and separated on 8% polyacrylamide gels. As shown, the digested fragments reflect BstUI methylation within a CpG island. Control DNA was methylated in vitro with the SSI methylase. +: BstUI digestion; −: without BstUI digestion. Expression analysis: total RNA (2 μg) isolated from treated (+) or untreated (−) CP70 cells was used to generate cDNA for RT-PCR. Arrows indicate the positions of amplified fragments. The level of each ECIST expression was compared with that of β-actin (marked by C). Acetylation analysis: CP70 cells were treated with DAC plus TSA (+) or untreated (−). Chromatin DNA was then immunoprecipitated with (+) or without (−) antiacetylated histone 3 (Anti AcH3) or 4 (Anti AcH4) and subjected to PCR using primers located at the 5-ends of a test gene. Arrows indicate the positions of amplified products. The level of histone acetylation for an ECIST locus was compared with that of a control locus (C), either GTF2H4 or FLJ31996.

Close modal
Table 1

Primer sequences used for triple analysisa

Clone IDGeneStrandCOBRA primers (5′→)ChIP-PCR primers (5′→)RT PCR primers (5′→)
SC21G11 HSPA.2 Forward TGTTGATGATGGGGTTGTAAATT TTCGATGGTGGGTCCCCGGAG GCACCGGTAAGGAAAACAAAA 
  Reverse ACAAAATCACCATCACCAATAAC GGGCAAGATTAGCGAGCAGGA GAGCCAGTTGATCACCTCCTG 
CpG5B6 CYP27B1 Forward AGGGGTTGAGATATGATGTTTAGG TCTGGCCGAACTTTTCTGCAA TCTGCTTGCTTGGCCCTTCTG 
  Reverse ACCATTTTCCCCAACACTCTATC CCTCAACTCGCCTTTTCCTTA TCCCTTCTGCCACATGGTTCA 
SC87F10 EIF1A Forward TTTATTTTTATTTTTGGGTATGG GCCGTCCATTTCCCAACATTTTG ATGCTAAAATCAATGAAACTG 
  Reverse CCATAAAACCACCCACCACA TGTCGCCCCTCAGAGCAGCAG TCTTCTACCCATAAGCTCCAT 
SC10H6 KIAA0560 Forward GTATAGAGGAGGTTAAAGTTTTTGG TGGGCTGTTGTACGGGTTCC CCTGCATGAACTTCCGGCTAC 
  Reverse CCATAACAACACTCTTCCCTCC GGTCACGAACTCCGCATTGAT GGTCACGAACTCCGCATTGAT 
DL3D6 FLJ31663 Forward TTTTATTAATGGTGGTGTAGAAG TCTTCCTCCATTCGCTGTC CCTGGCAGCCTAACCCTC 
  Reverse CCAACTTCCTCTTCCTCTTCTC CCTTTACACTTCCGGTTCACT CACCTTCTAGTGTCCGGTTGA 
SC28C11 TAF2K Forward GGTTGGTTTTTAGTTGGTTATATTA CCCCGAACTCTGTCCGCTGAATTCAC TGGAGGAGGTGCAGAAGGTGG 
  Reverse CTACTAACTTACCCTCCTATAATCC AGCCGGCAGGACGCTGTGAGT TCCTTGGGTCCTTTCGAATCA 
SC12E1 IER-3 Forward GTGATTTTTYGTATTTTTTAAGAAGAA CTGGCGACCGAACGAGACTGC GCCCCTAACGCCGCATCCCTG 
  Reverse AACCTAACCCCAACTAAACTATACC TTGGGCGGGTCCTTCTAACTC TCTCTGTGCGCCTCGGTCCCG 
SC13E11 TIGA1 Forward TTTGGGTTTTTTGGGATG CAGGGCCTGGAGCATAGTAAG GCATTGTGGGACGGAAGC 
  Reverse TATCTAAAAAACTCCCTAACATAATC CAGTGAGGGACCGAGGG AACTCCCTGGCATAGTCGATG 
SC13C2 Predicted Forward GATTTTTGTAATTAGGTTTGTATGTGT GCCTGATCCACGCCGATTG GTTTTCGGGTCGTCATGGCTG 
  Reverse AATTTCCACTCYCCTATCATACATAC GGCTGCCCGAGAAGGTAGGAG TTTCATCTGGTGGCCCTAGCG 
SC10B6 MDS1 Forward ATTTTTTTGGTGTTTTTGATG ACAAGCTTGTTGGCGATTCTA ATCCAGACCTTGAAAGTCGCT 
  Reverse CCTACCATAAAAATAAAATCACCA AGTTTGGACACCTTCGCAC CAAGTAATCTGGGGAACCGAT 
SC69A9 UNG2 Forward TTGTAAGTTGTTTAGTTGGTTGAT TCCAGTTTCCATTGCGTTTCT TCCAGTTTCCATTGCGTTTCT 
  Reverse ATAAATTCTAAAAACCCAACACTA CAGGCACAGCGACTCGAA CAGGCACAGCGACTCGAA 
Control GTF2H4 Forward TCAATCTCCAGGAGCCAATG TTTGTAGTCAGACGCGCTTCA ATTAAGCGACGGCCCGAGAC 
  Reverse CTATCTCTTAACCCACTTCTACTA CATTGGCTCCTGGAGATTGA CCAGAAAGAGCATCCGCATCA 
Control FLJ31996 Forward GTATTGAGTAGTTTTATTAYGGAGT CTCAGGCCGCTCTAGTCAAAT TTGCGGCTCCGTGGTG 
  Reverse AAAACAACTATCACTAAACCCCT GGAGCCGCAAGTAACGACA GGTTTCGGCCAGTGTTGACAT 
Control β-Actin Forward — — GGATTCCTATGTGGGCGACGAG 
  Reverse   CGCAGCTCATTGTAGAAGGTGTGG 
Clone IDGeneStrandCOBRA primers (5′→)ChIP-PCR primers (5′→)RT PCR primers (5′→)
SC21G11 HSPA.2 Forward TGTTGATGATGGGGTTGTAAATT TTCGATGGTGGGTCCCCGGAG GCACCGGTAAGGAAAACAAAA 
  Reverse ACAAAATCACCATCACCAATAAC GGGCAAGATTAGCGAGCAGGA GAGCCAGTTGATCACCTCCTG 
CpG5B6 CYP27B1 Forward AGGGGTTGAGATATGATGTTTAGG TCTGGCCGAACTTTTCTGCAA TCTGCTTGCTTGGCCCTTCTG 
  Reverse ACCATTTTCCCCAACACTCTATC CCTCAACTCGCCTTTTCCTTA TCCCTTCTGCCACATGGTTCA 
SC87F10 EIF1A Forward TTTATTTTTATTTTTGGGTATGG GCCGTCCATTTCCCAACATTTTG ATGCTAAAATCAATGAAACTG 
  Reverse CCATAAAACCACCCACCACA TGTCGCCCCTCAGAGCAGCAG TCTTCTACCCATAAGCTCCAT 
SC10H6 KIAA0560 Forward GTATAGAGGAGGTTAAAGTTTTTGG TGGGCTGTTGTACGGGTTCC CCTGCATGAACTTCCGGCTAC 
  Reverse CCATAACAACACTCTTCCCTCC GGTCACGAACTCCGCATTGAT GGTCACGAACTCCGCATTGAT 
DL3D6 FLJ31663 Forward TTTTATTAATGGTGGTGTAGAAG TCTTCCTCCATTCGCTGTC CCTGGCAGCCTAACCCTC 
  Reverse CCAACTTCCTCTTCCTCTTCTC CCTTTACACTTCCGGTTCACT CACCTTCTAGTGTCCGGTTGA 
SC28C11 TAF2K Forward GGTTGGTTTTTAGTTGGTTATATTA CCCCGAACTCTGTCCGCTGAATTCAC TGGAGGAGGTGCAGAAGGTGG 
  Reverse CTACTAACTTACCCTCCTATAATCC AGCCGGCAGGACGCTGTGAGT TCCTTGGGTCCTTTCGAATCA 
SC12E1 IER-3 Forward GTGATTTTTYGTATTTTTTAAGAAGAA CTGGCGACCGAACGAGACTGC GCCCCTAACGCCGCATCCCTG 
  Reverse AACCTAACCCCAACTAAACTATACC TTGGGCGGGTCCTTCTAACTC TCTCTGTGCGCCTCGGTCCCG 
SC13E11 TIGA1 Forward TTTGGGTTTTTTGGGATG CAGGGCCTGGAGCATAGTAAG GCATTGTGGGACGGAAGC 
  Reverse TATCTAAAAAACTCCCTAACATAATC CAGTGAGGGACCGAGGG AACTCCCTGGCATAGTCGATG 
SC13C2 Predicted Forward GATTTTTGTAATTAGGTTTGTATGTGT GCCTGATCCACGCCGATTG GTTTTCGGGTCGTCATGGCTG 
  Reverse AATTTCCACTCYCCTATCATACATAC GGCTGCCCGAGAAGGTAGGAG TTTCATCTGGTGGCCCTAGCG 
SC10B6 MDS1 Forward ATTTTTTTGGTGTTTTTGATG ACAAGCTTGTTGGCGATTCTA ATCCAGACCTTGAAAGTCGCT 
  Reverse CCTACCATAAAAATAAAATCACCA AGTTTGGACACCTTCGCAC CAAGTAATCTGGGGAACCGAT 
SC69A9 UNG2 Forward TTGTAAGTTGTTTAGTTGGTTGAT TCCAGTTTCCATTGCGTTTCT TCCAGTTTCCATTGCGTTTCT 
  Reverse ATAAATTCTAAAAACCCAACACTA CAGGCACAGCGACTCGAA CAGGCACAGCGACTCGAA 
Control GTF2H4 Forward TCAATCTCCAGGAGCCAATG TTTGTAGTCAGACGCGCTTCA ATTAAGCGACGGCCCGAGAC 
  Reverse CTATCTCTTAACCCACTTCTACTA CATTGGCTCCTGGAGATTGA CCAGAAAGAGCATCCGCATCA 
Control FLJ31996 Forward GTATTGAGTAGTTTTATTAYGGAGT CTCAGGCCGCTCTAGTCAAAT TTGCGGCTCCGTGGTG 
  Reverse AAAACAACTATCACTAAACCCCT GGAGCCGCAAGTAACGACA GGTTTCGGCCAGTGTTGACAT 
Control β-Actin Forward — — GGATTCCTATGTGGGCGACGAG 
  Reverse   CGCAGCTCATTGTAGAAGGTGTGG 
a

R, mixture of A and G; Y, mixture of G and T.

Table 2

List of methylation-dependent genes up-regulated by epigenetic treatments

CloneChromosomeGene bankGene nameDescriptionLocation
CpG17E7a 11p15 NM_013250 ZNF215 Novel imprinted zinc finger protein 215 Promoter and 1st exon 
CpG18A11a 11q24 NM_001274 CHEK1 CHK1 checkpoint homologue (S. pombePromoter and 1st exon 
CpG18G8a 19p12 NM_138330 TIZ TRAF6-binding zinc finger protein Promoter and 1st exon 
CpG21B1a 1q32 NM_015434 DKFZP434B168 DKFZP434B168 protein Promoter and 1st exon 
CpG27E8a 19q13 AK023102 FLJ13040 Hypothetical protein FLJ13040 First exon 
CpG42E10 18p11 NDb Predicted gene Twinscan gene predictions First exon 
CpG5B6a 12q13 NM_000785 CYP27B1 Cytochrome P450, subfamily XXVIIB Promoter and 1st exon 
CpG6B6a 20p12 AL137678 vyto SEL1L homologue Promoter and 1st exon 
CpG79F12a 15q25 AL110434 EST Function unknown ND 
MP2D2a 2p14 ND ND Genscan gene predictions ND 
MP3F2 19p13 X06581 ERCC-1 DNA excision repair protein Promoter 
SC11E2a 19p13 ND ND No gene identified in this region ND 
SC11H10 1q22 NM_032323 MGC13102 Hypothetical protein MGC13102 Exon 3 
SC15E7a 14q23 ND Predicted gene Genscan gene predictions Promoter and 1st exon 
SC15H6a 6p21 NM_021058 H2BFR H2B histone family, member R First exon 
SC18E9 19p13 X06581 ERCC-1 DNA excision repair protein Promoter 
SC18F11a 12p13 ND Predicted gene Genscan gene predictions ND 
SC18C9 3q21 BI833804 Seefor β-1,4 mannosyltransferase homologue Exon 5 
SC19F1a 1q23 AB029012 KIAA1089 Hypothetical protein KIAA1089 Promoter and 1st exon 
SC21G11a 14q23 NM_021979 HSPA2 Heat shock 70kD protein 2 First exon 
SC23B1 11q13 BI085096 Reemay β-1,4 mannosyltransferase homologue Exon 3 
SC26B7a 8p23 R18473 EST Function unknown ND 
SC2A2 Xq13 ND ND No gene identified in this region ND 
SC33C8a 2p23 NM_024322 MGC11266 Hypothetical protein MGC11266 Promoter and 1st exon 
SC40C8a 6p22 NM_003522 H2BFG H2B histone family, member G Promoter and 1st exon 
SC4H4a 6p21 NM_002121 HLA-DPB1 Major histocompatibility complex, class II, DP Promoter and 1st exon 
SC5A4a 8q21 ND Sneyly Acembly gene predictions First exon 
SC5D3 15q22 NM_032857 MRPL56 β-Lactamase Promoter and 1st exon 
SC74D2 10q24 BG208726 Kloymy Acembly gene predictions Promoter and 1st exon 
SC7B11a 19q13 BE646494 Sposee Acembly gene predictions Promoter and 1st exon 
SC87F10a 1p36 NM_001412 EIF1A Eukaryotic translation initiation factor 4C Promoter and 1st exon 
SC89F2 6q13 NM_018665 HAGE DEAD-box protein Promoter and 1st exon 
SC89G2 6q13 NM_018665 HAGE DEAD-box protein Promoter and 1st exon 
SC8A10 19q13 X06581 ERCC-1 DNA excision repair protein Promoter 
CloneChromosomeGene bankGene nameDescriptionLocation
CpG17E7a 11p15 NM_013250 ZNF215 Novel imprinted zinc finger protein 215 Promoter and 1st exon 
CpG18A11a 11q24 NM_001274 CHEK1 CHK1 checkpoint homologue (S. pombePromoter and 1st exon 
CpG18G8a 19p12 NM_138330 TIZ TRAF6-binding zinc finger protein Promoter and 1st exon 
CpG21B1a 1q32 NM_015434 DKFZP434B168 DKFZP434B168 protein Promoter and 1st exon 
CpG27E8a 19q13 AK023102 FLJ13040 Hypothetical protein FLJ13040 First exon 
CpG42E10 18p11 NDb Predicted gene Twinscan gene predictions First exon 
CpG5B6a 12q13 NM_000785 CYP27B1 Cytochrome P450, subfamily XXVIIB Promoter and 1st exon 
CpG6B6a 20p12 AL137678 vyto SEL1L homologue Promoter and 1st exon 
CpG79F12a 15q25 AL110434 EST Function unknown ND 
MP2D2a 2p14 ND ND Genscan gene predictions ND 
MP3F2 19p13 X06581 ERCC-1 DNA excision repair protein Promoter 
SC11E2a 19p13 ND ND No gene identified in this region ND 
SC11H10 1q22 NM_032323 MGC13102 Hypothetical protein MGC13102 Exon 3 
SC15E7a 14q23 ND Predicted gene Genscan gene predictions Promoter and 1st exon 
SC15H6a 6p21 NM_021058 H2BFR H2B histone family, member R First exon 
SC18E9 19p13 X06581 ERCC-1 DNA excision repair protein Promoter 
SC18F11a 12p13 ND Predicted gene Genscan gene predictions ND 
SC18C9 3q21 BI833804 Seefor β-1,4 mannosyltransferase homologue Exon 5 
SC19F1a 1q23 AB029012 KIAA1089 Hypothetical protein KIAA1089 Promoter and 1st exon 
SC21G11a 14q23 NM_021979 HSPA2 Heat shock 70kD protein 2 First exon 
SC23B1 11q13 BI085096 Reemay β-1,4 mannosyltransferase homologue Exon 3 
SC26B7a 8p23 R18473 EST Function unknown ND 
SC2A2 Xq13 ND ND No gene identified in this region ND 
SC33C8a 2p23 NM_024322 MGC11266 Hypothetical protein MGC11266 Promoter and 1st exon 
SC40C8a 6p22 NM_003522 H2BFG H2B histone family, member G Promoter and 1st exon 
SC4H4a 6p21 NM_002121 HLA-DPB1 Major histocompatibility complex, class II, DP Promoter and 1st exon 
SC5A4a 8q21 ND Sneyly Acembly gene predictions First exon 
SC5D3 15q22 NM_032857 MRPL56 β-Lactamase Promoter and 1st exon 
SC74D2 10q24 BG208726 Kloymy Acembly gene predictions Promoter and 1st exon 
SC7B11a 19q13 BE646494 Sposee Acembly gene predictions Promoter and 1st exon 
SC87F10a 1p36 NM_001412 EIF1A Eukaryotic translation initiation factor 4C Promoter and 1st exon 
SC89F2 6q13 NM_018665 HAGE DEAD-box protein Promoter and 1st exon 
SC89G2 6q13 NM_018665 HAGE DEAD-box protein Promoter and 1st exon 
SC8A10 19q13 X06581 ERCC-1 DNA excision repair protein Promoter 
a

Hyperacetylated histones detected based on microarray analysis (see detail in the text).

b

Not determined.

Table 3

List of methylation-independent genes up-regulated by epigenetic treatments

Clone NameChromosomeGene bankGene nameDescriptionLocation
CpG10D4 4q34 NDa ND No gene identified in this region ND 
CpG11D4 14q31 ND ND No gene identified in this region ND 
CpG11G12 19q13 BI194899 ND EST sequence ND 
CpG11H5b 11q12 NM_022830 FLJ22347 Hypothetical protein FLJ22347 Promoter and 1st exon 
CpG12E10b 20p13 X17567 snRNP B snRNP B protein Promoter 
CpG12F10b 19q13 NM_013362 ZNF225 Zinc finger protein 225 Promoter and 1st exon 
CpG13E10 16q24 AK056131.1 MGC13198 Hypothetical protein MGC13198 Promoter and 1st exon 
CpG13F10 16q22 NM_014062 ART-4 ART-4 protein Promoter and 1st exon 
CpG14B4 6p22.2 NM_003543 H4FH H4 histone family, member H First exon 
CpG14F10 8q11 X74794 MCM4 Maintenance deficient 4 homologue protein Promoter and 1st exon 
CpG15A3 18p11 ND ND No gene identified in this region ND 
CpG15B4 6p22 NM_003543 H4FH H4 histone family, member H First exon 
CpG15F10b ND ND ND Sequence not determined ND 
CpG18G1 10q11 ND ND No gene identified in this region ND 
CpG27E3b 19q13 ND ND FGENESH Gene Predictions (C19001774) Promoter and 1st exon 
CpG28H8 ND ND ND No matched sequence ND 
CpG32G1 1q21 NM_003528 H2BFO H2B histone family, member Q Promoter and 1st exon 
CpG32H5 22q12 ND ND FGENESH Gene Predictions (C22000342) Promoter and 1st exon 
CpG42B6 ND ND ND Sequence not determined ND 
CpG42B7 7q33 NM_033139 CALD1 Caldeson 1 transcript variant 4 Promoter and 1st exon 
CpG64A4 19q13 NM_002287 LAIR1 Leukocyte-associated Ig-like receptor 1, isoform Second intron 
CpG64F10 21q21 AF142099.1 ADAMTS5 Disintegrin-like and metalloprotease Promoter and 1st exon 
CpG66A4 6p22 NM_003543 H4FH H4 histone family, member H First exon 
CpG67D1 10q25 ND ND No gene identified in this region ND 
CpG6E6 17p11 BC020774 GNG2 Guanine nucleotide binding protein (G protein) Promoter and 1st exon 
CpG71A6 3q25 NM_022736 FLJ14153 Hypothetical protein FLJ14153 ND 
CpG79B10b 7p22 ND ND No gene identified in this region ND 
CpG79H5 5q13 ND ND No gene identified in this region ND 
CpG7A11 2q13 NM_019014 Rpo1-2 Similar to DNA-directed RNA polymerase I Promoter and 1st exon 
CpG7B6b 2q37 ND Predicted gene Genscan gene predictions ND 
DL2C8 4q34 ND ND No gene identified in this region ND 
DL3D1b 11q12 AK001301.1 FLJ10439 Hypothetical protein FLJ10439 Promoter 
DL3D6 7q33 AK056225 FLJ31663 cDNA FLJ31663, similar to myotrophin Promoter and 1st exon 
DL3G3b 19p13 NM_021235 EPS15R Epidermal growth factor receptor substrate Promoter and 1st exon 
MP1A9b 11q23 NM_000615 NCAM1 Neural cell adhesion molecule 1 Promoter and 1st exon 
MP1G1b 2q31 AB046824 KIAA1604 Hypothetic protein KIAA1604 First exon 
MP2A6b ND ND ND Sequence not determined ND 
MP2B9 6p21 NM_021064 H2AFP H2A histone family, member P Promoter and 1st exon 
MP2G7b 20q13 NM_007019 UBE2C Ubiquitin carrier protein E2-C Promoter and 1st exon 
MP2G9 7q36 ND ND No gene identified in this region ND 
MP2H11b 2p14 ND Predicted gene Twinscan gene predictions ND 
MP3B9 7p22 ND ND No gene identified in this region ND 
MP3E5b 3q23 AB002330 KIAA0332 Human mRNA for KIAA0332 gene Promoter and 1st exon 
PY1B11b 15q15 BQ417318 Reepor Acembly gene predictions First exon 
PY1E1b 1q21 NM_003548 H4F2 Histone H4 family 2 Promoter and 1st exon 
PY1F6 20p12 AK055700.1 C20orf30 Chromosome 20 open reading frame 30 Promoter and 1st exon 
SC10B6b 3q26 NM_004991 MDS1 Myelodysplasia syndrome protein 1 Exon 2 
SC10H3b NDa ND ND Sequence not determined ND 
SC10H6 15q14 AB011132 KIAA0560 KIAA0560 protein Promoter and 1st exon 
SC10H9 4q34 ND ND No gene identified in this region ND 
SC11D12 ND ND ND Sequence not determined ND 
SC12B7 7p15 NM_006547 KOC1 IGF-II mRNA-binding protein 3 Promoter and 1st exon 
SC12E1 6p21 NM_003897 IER3 Immediate early response 3, isoform Promoter and 1st exon 
SC13C2b 2p23 BC015430 Predicted gene Similar to transcription factor AKNA Promoter and 1st exon 
SC13E11 5q22 NM_053000 TIGA1 TIGA1 Promoter and 1st exon 
SC14F1 NDa ND ND No gene identified in this region ND 
SC15A10b 10q22 ND Predicted gene Twinscan gene predictions ND 
SC15A8b 7p14 AA478133 Beyku Acembly gene predictions Promoter and 1st exon 
SC15E3 Xq26 NM_006649 SDCCAG16 Serologically defined colon cancer antigen 16 Promoter and 1st exon 
SC17A9 4q31 ND ND No gene identified in this region ND 
SC17C6 14q23 ND ND No gene identified in this region ND 
SC18B4 ND ND ND Sequence not determined ND 
SC18E10 10p15 ND ND No gene identified in this region ND 
SC18E11 17p12 ND Predicted gene Genscan gene predictions ND 
SC18E12 ND ND ND No gene identified in this region ND 
SC18H8 20q11 AF287265 HCA90 Hepatocellular carcinoma-associated antigen 90 Promoter and 1st exon 
SC19D7 6q23 AA360824.1 KIAA1798 Hypothetical protein KIAA 1798 Promoter and 1st exon 
SC19F4 ND ND ND Sequence not determined ND 
SC22B8 1p31 AI435457.1 FOXD3.e Forkhead box D3 transcript e Promoter and 1st exon 
SC22C6 19p13 ND ND No gene identified in this region ND 
SC28C11 1p13 NM_005645 TAF2K TATA box binding protein (TBP)-associated Promoter and 1st exon 
SC29B12 1q21 NM_003557 PIP5K1A Phosphatidylinositol-4-phosphate 5-kinase Promoter and 1st exon 
SC29G3 1q32 AL526221.1 TatD-Dnase Acembly gene predictions Promoter and 1st exon 
SC2F9b 4q34 ND ND No gene identified in this region ND 
SC37C8 ND ND ND Sequence not determined ND 
SC37H3b 19q13 AB028987.2 C19orf7 Chromosome 19 open reading frame 7 First intron 
SC40H2 5q11 NM_021147 UNG2 Uracil-DNA glycosylase 2 Promoter and 1st exon 
SC41C2 1q21 NM_003557 PIP5K1A Phosphatidylinositol-4-phosphate 5-kinase First exon 
SC41D5 7p15 AI347402 EST Function unknown ND 
SC4A11 19q13 NM_015953 NOSIP eNOS interacting protein Promoter and 1st exon 
SC4B5 ND ND ND Sequence not determined ND 
SC4G5b 7q33 NM_145808 LOC136319 Granule cell differentiation protein Promoter and 1st exon 
SC4H11b 11q24 ND ND No gene identified in this region ND 
Clone NameChromosomeGene bankGene nameDescriptionLocation
CpG10D4 4q34 NDa ND No gene identified in this region ND 
CpG11D4 14q31 ND ND No gene identified in this region ND 
CpG11G12 19q13 BI194899 ND EST sequence ND 
CpG11H5b 11q12 NM_022830 FLJ22347 Hypothetical protein FLJ22347 Promoter and 1st exon 
CpG12E10b 20p13 X17567 snRNP B snRNP B protein Promoter 
CpG12F10b 19q13 NM_013362 ZNF225 Zinc finger protein 225 Promoter and 1st exon 
CpG13E10 16q24 AK056131.1 MGC13198 Hypothetical protein MGC13198 Promoter and 1st exon 
CpG13F10 16q22 NM_014062 ART-4 ART-4 protein Promoter and 1st exon 
CpG14B4 6p22.2 NM_003543 H4FH H4 histone family, member H First exon 
CpG14F10 8q11 X74794 MCM4 Maintenance deficient 4 homologue protein Promoter and 1st exon 
CpG15A3 18p11 ND ND No gene identified in this region ND 
CpG15B4 6p22 NM_003543 H4FH H4 histone family, member H First exon 
CpG15F10b ND ND ND Sequence not determined ND 
CpG18G1 10q11 ND ND No gene identified in this region ND 
CpG27E3b 19q13 ND ND FGENESH Gene Predictions (C19001774) Promoter and 1st exon 
CpG28H8 ND ND ND No matched sequence ND 
CpG32G1 1q21 NM_003528 H2BFO H2B histone family, member Q Promoter and 1st exon 
CpG32H5 22q12 ND ND FGENESH Gene Predictions (C22000342) Promoter and 1st exon 
CpG42B6 ND ND ND Sequence not determined ND 
CpG42B7 7q33 NM_033139 CALD1 Caldeson 1 transcript variant 4 Promoter and 1st exon 
CpG64A4 19q13 NM_002287 LAIR1 Leukocyte-associated Ig-like receptor 1, isoform Second intron 
CpG64F10 21q21 AF142099.1 ADAMTS5 Disintegrin-like and metalloprotease Promoter and 1st exon 
CpG66A4 6p22 NM_003543 H4FH H4 histone family, member H First exon 
CpG67D1 10q25 ND ND No gene identified in this region ND 
CpG6E6 17p11 BC020774 GNG2 Guanine nucleotide binding protein (G protein) Promoter and 1st exon 
CpG71A6 3q25 NM_022736 FLJ14153 Hypothetical protein FLJ14153 ND 
CpG79B10b 7p22 ND ND No gene identified in this region ND 
CpG79H5 5q13 ND ND No gene identified in this region ND 
CpG7A11 2q13 NM_019014 Rpo1-2 Similar to DNA-directed RNA polymerase I Promoter and 1st exon 
CpG7B6b 2q37 ND Predicted gene Genscan gene predictions ND 
DL2C8 4q34 ND ND No gene identified in this region ND 
DL3D1b 11q12 AK001301.1 FLJ10439 Hypothetical protein FLJ10439 Promoter 
DL3D6 7q33 AK056225 FLJ31663 cDNA FLJ31663, similar to myotrophin Promoter and 1st exon 
DL3G3b 19p13 NM_021235 EPS15R Epidermal growth factor receptor substrate Promoter and 1st exon 
MP1A9b 11q23 NM_000615 NCAM1 Neural cell adhesion molecule 1 Promoter and 1st exon 
MP1G1b 2q31 AB046824 KIAA1604 Hypothetic protein KIAA1604 First exon 
MP2A6b ND ND ND Sequence not determined ND 
MP2B9 6p21 NM_021064 H2AFP H2A histone family, member P Promoter and 1st exon 
MP2G7b 20q13 NM_007019 UBE2C Ubiquitin carrier protein E2-C Promoter and 1st exon 
MP2G9 7q36 ND ND No gene identified in this region ND 
MP2H11b 2p14 ND Predicted gene Twinscan gene predictions ND 
MP3B9 7p22 ND ND No gene identified in this region ND 
MP3E5b 3q23 AB002330 KIAA0332 Human mRNA for KIAA0332 gene Promoter and 1st exon 
PY1B11b 15q15 BQ417318 Reepor Acembly gene predictions First exon 
PY1E1b 1q21 NM_003548 H4F2 Histone H4 family 2 Promoter and 1st exon 
PY1F6 20p12 AK055700.1 C20orf30 Chromosome 20 open reading frame 30 Promoter and 1st exon 
SC10B6b 3q26 NM_004991 MDS1 Myelodysplasia syndrome protein 1 Exon 2 
SC10H3b NDa ND ND Sequence not determined ND 
SC10H6 15q14 AB011132 KIAA0560 KIAA0560 protein Promoter and 1st exon 
SC10H9 4q34 ND ND No gene identified in this region ND 
SC11D12 ND ND ND Sequence not determined ND 
SC12B7 7p15 NM_006547 KOC1 IGF-II mRNA-binding protein 3 Promoter and 1st exon 
SC12E1 6p21 NM_003897 IER3 Immediate early response 3, isoform Promoter and 1st exon 
SC13C2b 2p23 BC015430 Predicted gene Similar to transcription factor AKNA Promoter and 1st exon 
SC13E11 5q22 NM_053000 TIGA1 TIGA1 Promoter and 1st exon 
SC14F1 NDa ND ND No gene identified in this region ND 
SC15A10b 10q22 ND Predicted gene Twinscan gene predictions ND 
SC15A8b 7p14 AA478133 Beyku Acembly gene predictions Promoter and 1st exon 
SC15E3 Xq26 NM_006649 SDCCAG16 Serologically defined colon cancer antigen 16 Promoter and 1st exon 
SC17A9 4q31 ND ND No gene identified in this region ND 
SC17C6 14q23 ND ND No gene identified in this region ND 
SC18B4 ND ND ND Sequence not determined ND 
SC18E10 10p15 ND ND No gene identified in this region ND 
SC18E11 17p12 ND Predicted gene Genscan gene predictions ND 
SC18E12 ND ND ND No gene identified in this region ND 
SC18H8 20q11 AF287265 HCA90 Hepatocellular carcinoma-associated antigen 90 Promoter and 1st exon 
SC19D7 6q23 AA360824.1 KIAA1798 Hypothetical protein KIAA 1798 Promoter and 1st exon 
SC19F4 ND ND ND Sequence not determined ND 
SC22B8 1p31 AI435457.1 FOXD3.e Forkhead box D3 transcript e Promoter and 1st exon 
SC22C6 19p13 ND ND No gene identified in this region ND 
SC28C11 1p13 NM_005645 TAF2K TATA box binding protein (TBP)-associated Promoter and 1st exon 
SC29B12 1q21 NM_003557 PIP5K1A Phosphatidylinositol-4-phosphate 5-kinase Promoter and 1st exon 
SC29G3 1q32 AL526221.1 TatD-Dnase Acembly gene predictions Promoter and 1st exon 
SC2F9b 4q34 ND ND No gene identified in this region ND 
SC37C8 ND ND ND Sequence not determined ND 
SC37H3b 19q13 AB028987.2 C19orf7 Chromosome 19 open reading frame 7 First intron 
SC40H2 5q11 NM_021147 UNG2 Uracil-DNA glycosylase 2 Promoter and 1st exon 
SC41C2 1q21 NM_003557 PIP5K1A Phosphatidylinositol-4-phosphate 5-kinase First exon 
SC41D5 7p15 AI347402 EST Function unknown ND 
SC4A11 19q13 NM_015953 NOSIP eNOS interacting protein Promoter and 1st exon 
SC4B5 ND ND ND Sequence not determined ND 
SC4G5b 7q33 NM_145808 LOC136319 Granule cell differentiation protein Promoter and 1st exon 
SC4H11b 11q24 ND ND No gene identified in this region ND 
Table 3A

Continued

SC5C57q11BE258578GlojoyAcembly gene predictionsPromoter and 1st exon
SC62F2b 5q14 ND ND No gene identified in this region ND 
SC66A7 6p22 NM_003537 H3FL H3 histone family, member L Promoter and 1st exon 
SC69A9b 5q11 NM_021147 UNG2 Uracil-DNA glycosylase 2 Promoter and 1st exon 
SC71B6b 20q11 AK027550.1 ZNF341 e Zinc finger protein 341 transcript 2 First intron 
SC71E3 1q25 NM_032678 MGC3413 Hypothetical protein MGC3413 First exon 
SC71G10 19q13 AK024429 RhoGEF.16 Acembly gene predictions Promoter 
SC73E9 7p14 ND Predicted gene Genscan gene predictions Exon 3 
SC73G5b 6p21 BC000893 H2BFA H2B histone family, member A Promoter and 1st exon 
SC74C3 10p11 ND ND No gene identified in this region ND 
SC76D1 7p22 BI085096 spoyka Acembly gene predictions Promoter and 1st exon 
SC76H9 19q13 AI571106.1 DDX34 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide Promoter and 1st exon 
SC77F2 ND ND ND Sequence not determined ND 
SC77F4b 4q13 ND Predicted gene Genscan gene predictions ND 
SC77H8 8p22 NM_006094 DLC1 Deleted in liver cancer 1 First exon 
SC78C2 2q37 AI208033.1 Dudor Acembly gene predictions Exons 1 and 2 
SC78D5 1p35 NM_001703 BAI2 Brain-specific angiogenesis inhibitor 2 Promoter 
SC7E12b 17p11 ND ND No gene identified in this region ND 
SC7H5b 3p14 BC003364.1 ARF4 ADP-ribosylation factor 4. Promoter and 1st exon 
SC86B10 3p13 BI196363.1 Glorfy Acembly gene predictions Exon 2 
SC86B2 4q34 ND ND No gene identified in this region ND 
SC86B9 6q13 NM_133645 MTO1 MTO1 protein isoform IV Promoter and 1st exon 
SC86G9 6q13 NM_012123 CGI-02 CGI-02 protein Promoter and 1st exon 
SC87G12 11q13 NM_053056 CCND1 Cyclin D1 Promoter and 1st exon 
SC88C10 ND ND Predicted gene Genscan gene predictions ND 
SC88C8 12p13 BG940697 EST Function unknown ND 
SC88E12 12q13 NM_005371 METTL1 Methyltransferase-like protein 1, isoform a Promoter and 1st exon 
SC89A10 17q21 AK056941 FLJ32379 Polyprotein homologue Promoter and 1st exon 
SC89H7 12q23 AK001250.1 FLJ10388 Hypothetical protein FLJ10388, RNA polymerase First intron 
SC8D1 14q23 NM_002788 PSMA3 Proteasome (prosome, macropain) subunit, α First exon 
SC90B1 12p13 NM_000719 CACNA1C Calcium channel, voltage-dependent, L type, Exon 7 
SC90B12 7p15 NM_006547 KOC1 IGF-II mRNA-binding protein 3 Promoter and 1st exon 
SC90F10 9p23 ND Predicted gene Genscan gene predictions ND 
SC5C57q11BE258578GlojoyAcembly gene predictionsPromoter and 1st exon
SC62F2b 5q14 ND ND No gene identified in this region ND 
SC66A7 6p22 NM_003537 H3FL H3 histone family, member L Promoter and 1st exon 
SC69A9b 5q11 NM_021147 UNG2 Uracil-DNA glycosylase 2 Promoter and 1st exon 
SC71B6b 20q11 AK027550.1 ZNF341 e Zinc finger protein 341 transcript 2 First intron 
SC71E3 1q25 NM_032678 MGC3413 Hypothetical protein MGC3413 First exon 
SC71G10 19q13 AK024429 RhoGEF.16 Acembly gene predictions Promoter 
SC73E9 7p14 ND Predicted gene Genscan gene predictions Exon 3 
SC73G5b 6p21 BC000893 H2BFA H2B histone family, member A Promoter and 1st exon 
SC74C3 10p11 ND ND No gene identified in this region ND 
SC76D1 7p22 BI085096 spoyka Acembly gene predictions Promoter and 1st exon 
SC76H9 19q13 AI571106.1 DDX34 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide Promoter and 1st exon 
SC77F2 ND ND ND Sequence not determined ND 
SC77F4b 4q13 ND Predicted gene Genscan gene predictions ND 
SC77H8 8p22 NM_006094 DLC1 Deleted in liver cancer 1 First exon 
SC78C2 2q37 AI208033.1 Dudor Acembly gene predictions Exons 1 and 2 
SC78D5 1p35 NM_001703 BAI2 Brain-specific angiogenesis inhibitor 2 Promoter 
SC7E12b 17p11 ND ND No gene identified in this region ND 
SC7H5b 3p14 BC003364.1 ARF4 ADP-ribosylation factor 4. Promoter and 1st exon 
SC86B10 3p13 BI196363.1 Glorfy Acembly gene predictions Exon 2 
SC86B2 4q34 ND ND No gene identified in this region ND 
SC86B9 6q13 NM_133645 MTO1 MTO1 protein isoform IV Promoter and 1st exon 
SC86G9 6q13 NM_012123 CGI-02 CGI-02 protein Promoter and 1st exon 
SC87G12 11q13 NM_053056 CCND1 Cyclin D1 Promoter and 1st exon 
SC88C10 ND ND Predicted gene Genscan gene predictions ND 
SC88C8 12p13 BG940697 EST Function unknown ND 
SC88E12 12q13 NM_005371 METTL1 Methyltransferase-like protein 1, isoform a Promoter and 1st exon 
SC89A10 17q21 AK056941 FLJ32379 Polyprotein homologue Promoter and 1st exon 
SC89H7 12q23 AK001250.1 FLJ10388 Hypothetical protein FLJ10388, RNA polymerase First intron 
SC8D1 14q23 NM_002788 PSMA3 Proteasome (prosome, macropain) subunit, α First exon 
SC90B1 12p13 NM_000719 CACNA1C Calcium channel, voltage-dependent, L type, Exon 7 
SC90B12 7p15 NM_006547 KOC1 IGF-II mRNA-binding protein 3 Promoter and 1st exon 
SC90F10 9p23 ND Predicted gene Genscan gene predictions ND 
a

Not determined.

b

Hyperacetylated histones detected based on microarray analysis (see detail in the text).

We thank Diane Peckham for assistance in the preparation of this manuscript.

1
Ren B., Robert F., Wyrick J. J., Aparicio O., Jennings E. G., Simon I., Zeitlinger J., Schreiber J., Hannett N., Kanin E., Volkert T. L., Wilson C. J., Bell S. P., Young R. A. Genome-wide location and function of DNA binding proteins.
Science (Wash. DC)
,
290
:
2306
-2309,  
2000
.
2
Weinmann A. S., Yan P. S., Oberley M. J., Huang T. H-M., Farnham P. J. Isolating human transcription factor targets by coupling chromatin immunoprecipitation and CpG island microarray analysis.
Genes Dev.
,
16
:
235
-244,  
2002
.
3
Suzuki H., Gabrielson E., Chen W., Anbazhagan R., van Engeland M., Weijenberg M. P., Herman J. G., Baylin S. B. A genomic screen for genes upregulated by demethylation and histone deacetylase inhibition in human colorectal cancer.
Nat. Genet.
,
31
:
141
-149,  
2002
.
4
Cameron E. E., Bachman K. E., Myohanen S., Herman J. G., Baylin S. B. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer.
Nat. Genet.
,
21
:
103
-107,  
1999
.
5
Jones P. A., Baylin S. B. The fundamental role of epigenetic events in cancer.
Nat. Rev. Genet.
,
3
:
415
-428,  
2002
.
6
Ballestar E., Esteller M. The impact of chromatin in human cancer: linking DNA methylation to gene silencing.
Carcinogenesis (Lond.)
,
23
:
1103
-1109,  
2002
.
7
Yan P. S., Chen C-M., Shi H., Rahmatpanah F., Wei S. H., Caldwell C. W., Huang T. H-M. Dissecting complex epigenetic alterations in breast cancer using CpG island microarrays.
Cancer Res.
,
61
:
8375
-8380,  
2001
.
8
Ahluwalia A., Yan P., Hurteau J. A., Bigsby R. M., Jung S. H., Huang T. H-M., Nephew K. P. DNA methylation and ovarian cancer. I. Analysis of CpG island hypermethylation in human ovarian cancer using differential methylation hybridization.
Gynecol. Oncol.
,
82
:
261
-268,  
2001
.
9
Wei S. H., Chen C. M., Strathdee G., Harnsomburana J., Shyu C. R., Rahmatpanah F., Shi H., Ng S. W., Yan P. S., Nephew K. P., Brown R., Huang T. H-M. Methylation microarray analysis of late-stage ovarian carcinomas distinguishes progression-free survival in patients and identifies candidate epigenetic markers.
Clin. Cancer Res.
,
8
:
2246
-2252,  
2002
.
10
Shi H., Yan P. S., Chen C. M., Rahmatpanah F., Lofton-Day C., Caldwell C. W., Huang T. H-M. Expressed CpG island sequence tag microarray for dual screening of DNA hypermethylation and gene silencing in cancer cells.
Cancer Res.
,
62
:
3214
-3220,  
2002
.
11
Suzuki Y., Yoshitomo-Nakagawa K., Maruyama K., Suyama A., Sugano S. Construction and characterization of a full length-enriched and a 5′-end-enriched cDNA library.
Gene
,
200
:
149
-156,  
1997
.
12
Cross S. H., Charlton J. A., Nan X., Bird A. P. Purification of CpG islands using a methylated DNA binding column.
Nat. Genet.
,
6
:
236
-244,  
1994
.
13
Xiong A., Laird P. W. COBRA: a sensitive and quantitative DNA methylation assay.
Nucleic Acids Res.
,
25
:
2532
-2534,  
1997
.
14
Yan P. S., Efferth T., Chen H. L., Lin J., Rodel F., Fuzesi L., Huang T. H-M. Use of CpG island microarrays to identify colorectal tumors with a high degree of concurrent methylation.
Methods (Orlando)
,
27
:
162
-169,  
2002
.
15
Dever T. E., Wei C. L., Benkowski L. A., Browning K., Merrick W. C., Hershey J. W. Determination of the amino acid sequence of rabbit, human, and wheat germ protein synthesis factor eIF-4C by cloning and chemical sequencing.
J. Biol. Chem.
,
269
:
3212
-3218,  
1994
.
16
Lahn B. T., Page D. C. Functional coherence of the human Y chromosome.
Science (Wash. DC)
,
278
:
675
-680,  
1997
.
17
Liang G., Gonzales F. A., Jones P. A., Orntoft T. F., Thykjaer T. Analysis of gene induction in human fibroblasts and bladder cancer cells exposed to the methylation inhibitor 5-aza-2′-deoxycytidine.
Cancer Res.
,
62
:
961
-966,  
2002
.
18
Karpf A. R., Peterson P. W., Rawlins J. T., Dalley B. K., Yang Q., Albertsen H., Jones D. A. Inhibition of DNA methyltransferase stimulates the expression of signal transducer and activator of transcription 1, 2, and 3 genes in colon tumor cells.
Proc. Natl. Acad. Sci. USA
,
96
:
14007
-14012,  
1999
.
19
Robertson K., Keymarsi K., Gonzales F., Velicescu M., Jones P. Differential mRNA expression of the human DNA methyltransferases (DNMTs)1, 3a and 3b during the Go/G1 to S phase transition in normal and tumor cells.
Nucleic Acids Res.
,
28
:
2108
-2113,  
2000
.
20
Karpf A. R., Jones D. A. Reactivating the expression of methylation silenced genes in human cancer.
Oncogene
,
21
:
5496
-5503,  
2002
.
21
Milutinovic S., Zhuang Q., Niveleau A., Szyf M. Epigenomic stress response: Knock-down of DNA methyltransferase 1 triggers an intra S-phase arrest of DNA replication and induction of stress response genes.
J. Biol. Chem.
,
278
: (e-publication ahead of print) 
2003
.