The pathogenetic role of the P210 BCR/ABL1 fusion gene in the chronic phase of chronic myeloid leukemia (CML) has been well established.In contrast, the geneticmechanisms underlying the disease progression into the accelerated phase (AP) and the final blast crisis (BC) remain poorly understood. We have previously identified (A. Barbouti et al., Genes Chromosomes Cancer, 35: 127–137, 2002) two cryptic balanced translocations, t(7;17)(p15;q23) and t(7;17)(q32–34;q23), in CML AP/BC using multicolor fluorescence in situ hybridization. In this study, we show that a novel gene in 17q23, Musashi-2 (MSI2), encoding a putative RNA-binding protein, is rearranged in both cases and that a MSI2/HOXA9 fusion gene is formed in the case with the 7p15 breakpoint. The identified in-frame MSI2/HOXA9 fusion transcript retains both of the RNA recognition motif domains of MSI2, which is fused to the homeobox domain of HOXA9, and is likely to play an important role in the disease progression of CML.

CML3 is a malignant stem cell disorder that typically progresses from an initial relatively indolent CP, in which the leukemic cells retain their ability to differentiate, through an AP, and into an aggressive and usually fatal BC, which is characterized by the expansion of immature hematopoietic cells that have lost their capacity to differentiate (1, 2). During the CP, the Ph chromosome, resulting from the reciprocal chromosomal translocation t(9;22)(q34;q11), is usually the sole anomaly detected. This translocation generates a fusion gene, designated P210 BCR/ABL1, giving rise to a protein with deregulated tyrosine kinase activity that induces a wide range of phenotypes of relevance to leukemogenesis (1, 2). Although P210 BCR/ABL1 is strongly implicated in the CP, the pathogenetic mechanisms underlying the disease progression are poorly understood. Cytogenetic studies have revealed that on progression to AP/BC, secondary abnormalities, mainly unbalanced changes such as +8, i(17q), and +Ph, occur in 60–80% of the cases, indicating that genetic alterations play an important role in the disease evolution, but only limited knowledge is available about the molecular genetic correlates of these chromosomal abnormalities (3). Molecular genetic studies have mostly focused on well-known tumor suppressor genes (e.g., TP53, CDKN2A, and RB1) and oncogenes (e.g., RAS and MYC), but thus far, no consistent alterations have been detected (2, 3). Possible clues behind CML progression are given by the occurrence of AML-associated translocations/fusion genes, e.g., t(3;21)(q26;q22)/RUNX1-EVI1, t(7;11)(p15;p15)/NUP98-HOXA9, t(8;21)(q22;q22)/RUNX1/CBFA2T1, and inv(16)(p13p22)/CBFB-MYH11, occasionally seen during disease evolution.4 These alterations suggest that the maturation arrest observed in CML BC may be caused by genetic mechanisms similar to those in AML. To investigate whether balanced translocations that generate fusion genes might be more common in CML AP/BC what is indicated by chromosome banding analyses, we recently undertook a multicolor FISH study in a series of 33 CML AP/BC patients (4). Among these 33, we identified 2 cases with cryptic balanced translocations, t(7;17)(p15;q23) and t(7;17)(q32–34;q23), with seemingly identical breakpoints in 17q23. We here show that a novel gene in 17q23, designated MSI2, is disrupted by the two translocations and that an MSI2/HOXA9 fusion gene is formed in the case with the 7p15 breakpoint.

Case Reports, Cytogenetics, and Multicolor FISH.

The refined karyotypes in cases 1 and 2, obtained after multicolor FISH, have been reported previously (4). The two reciprocal t(7;17) that were identified as additional aberrations in AP/BC were not detectable by G-banding. Case 1 (case 6 in Ref. 4) was a 50-year-old woman diagnosed with CML in November 1995. Cytogenetic analysis revealed the karyotype 46,XX,t(9;22)(q34;q11)[25]. No HLA-matched sibling was available, and treatment was started with hydroxyurea, followed by IFN-α. No cytogenetic response was obtained, and an attempt in November 1996 to harvest Ph-negative stem cells for autografting, using an AML-type of chemotherapy (1-β-d-arabinofuranosylcytosine and daunorubicin), was unsuccessful. Instead, treatment with hydroxyurea was restarted, whereas IFN-α had to be omitted because of severe side effects. In August 1997, the patient entered an AP with marked peripheral basophilia (70%) and with 14% blasts and 49% basophils on bone marrow examination. The bone marrow karyotype as determined by G-banding and multicolor FISH was 46,XX,t(9;22)(q34;q11)[3]/46,idem,t(7;17)(p15;q23)[10]. Repeated treatment with 1-β-d-arabinofuranosylcytosine was given, but the patient expired in November 1998, 3 years after the initial diagnosis, with clinical signs consistent with BC.

Case 2 (case 5 in Ref. 4) was a 37-year-old woman diagnosed with CML in April 1986. Initial cytogenetic analysis yielded no metaphases. Hematological remission was obtained after hydroxyurea and IFN-α treatment, but 2 years later, the patient entered an AP with increasing leukocyte and platelet counts. Bone marrow examination revealed 15% blasts and 8% promyelocytes. The combined G-banded and multicolor FISH karyotype was 46,XX,t(9;22)(q34;q11)[4]/46,idem,t(7;17)(q32–34;q23)[6]. i.v. infusions with 1-β-d-arabinofuranosylcytosine were given, but 2 months later, a myeloid BC was diagnosed with 50% blasts in the bone marrow. No additional cytogenetic changes were identified. The patient expired 33 months after the initial diagnosis.

FISH Analyses.

FISH using BAC or PAC clones (obtained from BAC/PAC Resources, Children’s Hospital Oakland Research Institute, Oakland, CA) and whole chromosome painting probes (ALTechnologies, Arlington, VA) were performed essentially as described previously (4). Previous mapping by FISH of the 17q23 breakpoints in cases 1 and 2 had revealed that the breaks occurred within a 350-kb region, flanked by the BAC clones CTB-123J14 and RP11-60A24 (4). To further map the breakpoints, the following RP11-BAC clones were used (GenBank accession nos.5 are given within parentheses): 226M10 (AC015883), 118E18 (AC007431), 426D19 (AC073839), and 19F16 (AC007644). A series of RP11-BAC clones, including 341C17 (AC0011625), 297N5 (AC018643), 348A15 (AC009364), and 198E23 (AC009785), were used to map the 7q32–34 breakpoint in case 2. The mapping position of each BAC/PAC clone was retrieved from available human genome browsers.6-8

Southern Blot Analysis.

Extraction of high-molecular-weight DNA from bone marrow cells of case 1, restriction enzyme digestion with BamHI, EcoRI, HindIII, KpnI, and XhoI, followed by electrophoresis through 0.8% agarose gels, and transfer onto nylon membrane filters (GeneScreen Plus; NEN Life Science Products, Boston, MA) were performed using standard procedures. A genomic 664-bp repeat-free probe, derived from intron 1 of HOXA9, was generated by PCR (see below) using the primers 40705U19 and 41388L21 (Table 1) and DNA isolated from the HOXA9-containing PAC clone RP1-170O19. Probe labeling, hybridization, and washing were performed as outlined previously (5).

RT-PCR and Sequence Analysis.

Total RNA from case 1, obtained from bone marrow cells at AP and from the control cell lines K562 and U937, was extracted using the Trizol reagent according to the manufacturer’s instructions (Life Technologies, Inc., Stockholm, Sweden). Five μg of total RNA were reverse-transcribed and PCR-amplified under identical conditions as described previously (6). The primers used for PCR amplification and the GenBank accession numbers on which they are based are listed in Table 1. To detect a putative MSI2/HOXA9 fusion transcript, RT-PCR with the primer pair 692U22 and 7256L21 was carried out. To detect possible alternative MSI2/HOXA9 splicing variants, RT-PCR with the primer pair 480U21-7256L21, followed by second nested PCR reactions using the primer pairs 520U23-7215L21 or 750U21-7215L21, were also performed. For identifying a reciprocal HOXA9/MSI2 fusion, RT-PCR experiments with several primer combinations were carried out. The primer pair 11U19-741L21 was initially used to determine whether MSI2 was expressed in case 1 and in the control cell lines K562 and U937. PCR-amplified fragments were excised from the gels, purified, and directly sequenced using the Big Dye sequencing kit (PE Applied Biosystems, Warrington, United Kingdom).

Northern Blot Analysis.

To determine the expression pattern of MSI2, a Northern blot containing mRNA from various adult and embryonic human tissues (Human 12-lane; Clontech, Paolo Alto, CA) was hybridized with a 224-bp cDNA probe generated by RT-PCR with the primer pair 554U22 and 770L21 (Table 1).

We have previously demonstrated that the breakpoint in case 1 was located within a PAC clone (RP1-1790O19) containing seven genes belonging to the HOXA gene cluster in 7p15 (4). Among these, HOXA9, which is fused to NUP98 in leukemias with t(7;11)(p15;p15) (7, 8), was considered a likely target for the translocation. Indeed, Southern blot analysis using an intron-1-derived HOXA9 probe, revealed a rearrangement in EcoRI and HindIII digests, consistent with a breakpoint within the HOXA9 gene (not shown). To identify the breakpoint in 17q23, which previously had been mapped to a 350-kb region in both cases 1 and 2, we used FISH with several BAC clones covering this interval. In case 1, a split signal was obtained by BAC 118E18, whereas the partially overlapping BAC 224M10 was rearranged in case 2 (not shown). Genescan searches9 of these BAC clones revealed several peptides, two of which initially matched perfectly to an EST clone of 1423 nt (GenBank accession no. BC001526) and which more recently matched an electronically predicted protein supported by mRNA and EST alignments (GenBank accession no. XP_058819). This new gene was designated MSI2 because of its high similarity to a gene encoding the RNA-binding protein Musashi-1 (MSI1; GenBank accession no. NP_002433). To establish whether MSI2 was expressed in hematopoietic cells, RT-PCR with primers 11U21 and 741L21 was performed, resulting in an expected fragment of 714 bp in case 1 and in K562 and U937 cells (not shown). Together with the FISH data, this suggested that MSI2 could be the fusion partner of the rearranged HOXA9 gene. Because the split BAC 118E18 contains exons 7–10 of MSI2, we performed RT-PCR with several forward primers located within exons 1–10, in combination with a common reverse primer in the homeobox domain (exon 2) of HOXA9, to detect a putative MSI2/HOXA9 fusion transcript. A fragment of ∼400 bp was obtained with the primer pair 692U22 (exon 9 of MSI2) and 7256L21 (exon 2 of HOXA9) in case 1, but not in control samples (Fig. 1,A). Direct sequence analysis showed that nt 834 of MSI2 (exon 9; GenBank accession no. BC001526) was fused in frame with nt 4803 of HOXA9 (exon 1b; GenBank accession no. U81511; Fig. 1 B). When the forward primer 480U21 (exon 6 of MSI2) was combined with the reverse primer 7256L21 (exon 2 of HOXA9) no product was amplified in the first PCR reaction. However, on nested PCR, using the primer combinations 520U23 (exon 6 of MSI2) and 7215L21 (exon 2 of HOXA9) or 750U21 (exon 9 of MSI2) and 7215L21, additional in-frame fusion products were obtained; MSI2 exon 7 fused to the alternative IME of HOXA9 and MSI2 exon 9 fused directly to the homeobox-containing exon 2 of HOXA9. Whether these additional, seemingly less expressed, fusion products are of pathogenetic importance remains, however, to be established. Attempts to amplify a putative reciprocal HOXA9/MSI2 fusion gene using several primer combinations were unsuccessful.

To characterize further the MSI2 gene, RT-PCR with the primers 11U19 and 1147L20, amplifying the entire open reading frame, was performed showing an identical sequence with the in silico-identified EST clone. The open reading frame of the MSI2 transcript is 986 nt and results in a protein of 328 amino acids. Searching overlapping ESTs using the TIGR Human Gene Index browser10 extended the 3′ untranslated end an additional 4.4 kb (THC 602471). Human genome BLAST alignment11 of the entire 5.5-kb transcript revealed that MSI2 spans about 424 kb at the genomic level, containing at least 15 exons (Figs. 2 and 3 A). Northern blot analysis showed an ∼5.5-kb ubiquitously expressed transcript, with the highest expression levels in heart, skeletal muscles, and liver(Fig. 3B). ProfileScan analysis identified two RRMs in the NH2-terminal part (residues 22–91 and 111–170), whereas no other functional domains or consensus sequences were identified in the COOH-terminal end. RRMs are found in a variety of RNA binding proteins, involved in processing and transport of mRNA precursors, with the distinct feature of the motif being two short sequences, referred to as RNP1 and RNP2, embedded in a more weakly conserved sequence (9). The topological organization of MSI2, with two RRMs in the NH2-terminal end of the protein, is reminiscent of the A/B family of heterogeneous nuclear RNPs (10). Recently, the murine orthologue of MSI2, Msi2, was identified (11). Msi2 shows a ubiquitous tissue expression and is enriched in brain, in which it displays a cell type-specific and developmentally regulated expression pattern; and it has been suggested that Msi2, like its mouse paralogue Msi1 (with 75% overall amino acid identity), could play a role in the maintenance and/or proliferation of neuronal stem cells (11). The Msi1 and Msi2 proteins display similar binding preferences to RNA-homopolymers, and, interestingly, Msi1 has been shown to bind the 3’-untranslated region of mouse Numb mRNA, leading to decreased translation, thereby inhibiting the Notch-signaling cascade, which is required for the self-renewing activity of neuronal stem cells (12).

The identified MSI2/HOXA9 chimeric gene fuses exon 9 of MSI2 in-frame with the IME of HOXA9. Hence, the putative fusion protein retains two intact RRM domains fused to the homeobox domain of HOXA9 (Fig. 2). HOXA9 has been increasingly implicated in normal and leukemic hematopoiesis (13). Hoxa9 knockout mice show defects in myeloid, erythroid, and lymphoid hematopoiesis (14). Retrovirus-mediated overexpression of HoxA9 in mouse bone marrow cells induces hematopoietic stem cell expansion, paralleled by a partial block in B-lymphopoiesis, and, after a prolonged latency, also results in AML (15). Furthermore, in hematological malignancies with t(7;11)(p15;p15), a NUP98/HOXA9 fusion gene is formed in which the 5′ part of NUP98 becomes fused to the homeobox domain of HOXA9(7, 8, 16).

The 5′ part of NUP98, which is included in the NUP98/HOXA9 fusion, contains phenylalanine-glycine repeat regions that have been shown to be potent transactivators of gene transcription (16). This NUP98-derived activity is essential for transformation and also recruits the transcriptional coactivators CREBBP/EP300 (17). Using several alignment algorithms, no significant similarities between the 5′ parts of MSI2 and NUP98 included in the MSI2/HOXA9 and NUP98/HOXA9 fusions, respectively, were identified, whereas the HOXA9 part is identical. On the basis of the facts that only the MSI2/HOXA9 fusion, not the reciprocal HOXA9/MSI2, was detected on disease progression and that the predicted MSI2/HOXA9 chimeric protein encompasses most putative functional motifs encoded by each gene, it seems reasonable to assume that this fusion, perhaps in concert with BCR/ABL1, is capable of inducing the blocking of cellular differentiation associated with the AP/BC. Additional studies are needed to decipher how MSI2/HOXA9 may elicit its transforming activity and whether the disruption of MSI2, a deregulation of HOXA9-mediated gene expression, or a combination thereof, is the critical pathogenetic event.

Interestingly, as revealed by the split FISH signal of the BAC clone RP11-224M10, we also found evidence of a rearrangement of MSI2 in case 2. This BAC clone, which partially overlaps RP11-118E18, contains exon 6 of MSI2. To search for the putative fusion partner gene, we used several BAC clones in 7q32–34 and identified RP11-341C17 as being disrupted. Genscan searches of this fully sequenced BAC revealed a sema domain, characterizing semaforins and the plexin family of proteins (18). Furthermore, the adjacent centromeric BAC clones RP11-348A15 and -298E23 contained two other conserved domains, a plexin repeat and an immunoglobulin-like plexin transcription factors domain, which also are hallmarks of the plexin family (19). Thus, most likely this genomic region encodes a new plexin gene, previously described only as a partial cDNA clone and referred to as “plexin-A4 partial” (19). In addition, Genscan identified a predicted transcript encoded on the opposite strand (GenBank accession no. XM_069839), without similarities to other genes. Unfortunately, attempts to identify a putative fusion gene with MSI2 and any of the two putative genes were, however, hampered by the availability of only minute amounts of RNA.

The MSI2/HOXA9 fusion described in the present study adds to the list of fusion genes in human neoplasia involving genes-encoding proteins with RNA- and DNA-binding properties. Two prototypic examples are the EWSR1/FLI1 and FUS/DDIT3 fusion genes in Ewing sarcoma and myxoid liposarcoma, respectively. Both FUS and EWSR1 are RNA-binding proteins characterized by one RRM domain in the COOH-terminal part, which is replaced by the DNA-binding domains of their fusion partners (20). Recently, two novel genes, RBM15 and MKL1, were shown to become fused in acute megakaryoblastic leukemia. RBM15 is an RNA-binding protein containing three RNA-RRMs that are retained and fused to the DNA binding domain of MKL1 (21). Given the cryptic nature of the two t(7;17) in the present study and the recurrent rearrangement of MSI2, it will be interesting to study additional cases of CML BC, as well as other hematological malignancies, for the potential rearrangement of MSI2 and/or HOXA9.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

Supported by grants from the Swedish Cancer Society, the Swedish Child Cancer Fund, the Medical Faculty of Lund University, the IngaBritt and Arne Lundberg Foundation, and the Belgian program on Interuniversity Poles of Attraction initiated by the Belgian State, Prime Minister’s Office, Science Policy Programming.

3

The abbreviations used are: CML, chronic myeloid leukemia; CP, chronic phase; AP, accelerated phase; BC, blast crisis; Ph, Philadelphia chromosome; AML, acute myeloid leukemia; FISH, fluorescence in situ hybridization; BAC, bacterial artificial chromosome; PAC, phage artificial chromosome; RT-PCR, reverse transcription-PCR; RRM, RNA recognition motif; RNP, ribonucleoprotein; TIGR, The Institute for Genomic Research; IME, intermediate exon; nt, nucleotide(s); EST, espressed sequence tag.

4

Internet address: http://cgap.nci.nih.gov/Chromosomes/Mitelman.

5

Internet address: http://www.ncbi.nlm.nih.gov/GenBank/.

6

Internet address: http://www.ensembl.org.

7

Internet address: http://genome.cse.ucsc.edu/.

8

Internet address: http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/map_search.

9

Internet address: http://genes.mit.edu/GENSCAN.html.

10

Internet address: http://www.tigr.org/tdb/tgi/hgi/searching/reports.html.

11

Internet address: http://www.ncbi.nlm.nih.gov/BLAST/.

Fig. 1.

RT-PCR and sequence analysis of MSI2/HOXA9. A, RT-PCR analysis showing the detection of an MSI2/HOXA9 fusion transcript in case 1. Using the primers 692U22 (exon 9 of MSI2) and 7256L21 (exon 2 of HOXA9), we obtained a fragment of ∼400 bp in case 1 (Lane 1), but not in the negative control cell lines K562 and U937 (Lanes 2 and 3). Lane 4, blank water control; M, 100-bp DNA ladder. B, sequence analysis of the MSI2/HOXA9 fusion transcript. At the top, a partial sequence chromatogram of the MSI2/HOXA9 junction. At the bottom, the nucleotide sequence of the amplified fragment as determined by sequence analysis. Arrows, the in-frame fusion junction of MSI2 exon 9 with the IME contained within exon CD (exon 1b) of HOXA9.

Fig. 1.

RT-PCR and sequence analysis of MSI2/HOXA9. A, RT-PCR analysis showing the detection of an MSI2/HOXA9 fusion transcript in case 1. Using the primers 692U22 (exon 9 of MSI2) and 7256L21 (exon 2 of HOXA9), we obtained a fragment of ∼400 bp in case 1 (Lane 1), but not in the negative control cell lines K562 and U937 (Lanes 2 and 3). Lane 4, blank water control; M, 100-bp DNA ladder. B, sequence analysis of the MSI2/HOXA9 fusion transcript. At the top, a partial sequence chromatogram of the MSI2/HOXA9 junction. At the bottom, the nucleotide sequence of the amplified fragment as determined by sequence analysis. Arrows, the in-frame fusion junction of MSI2 exon 9 with the IME contained within exon CD (exon 1b) of HOXA9.

Close modal
Fig. 2.

Schematic representation of HOXA9, the predicted MSI2/HOXA9 chimera, and the MSI2 cDNA/proteins. The HOXA9 cDNA is based on GenBank accession no. U81511 (HOXA9-B) in which the CD exon (exon 1b), which contains an intermediate, alternatively spliced, exon (IME), is spliced to the homeobox-containing exon II (exon 2). Boxes, individual exons; Top, critical protein domains. Middle, the MSI2/HOXA9 chimera; exon 9 of MSI2 is fused to the IME of HOXA9. Below the individual boxes, the first nucleotide of each exon; within the boxes at the top, the corresponding amino acids; black boxes, the two RRM domains. Bottom, MSI2 contains at least 15 exons. The untranslated exons 14 and 15 are not drawn to scale. The nucleotide sequence of MSI2 is based on GenBank accession no. BC001526 and our own sequence data, using the primer combination 11U19/1147L20 (Table 1). Untranslated 5′ and 3′ ends were obtained using the TIGR Human Gene Index browser10 and human genome BLAST alignment11 of the assembled transcript. Arrows, the breakpoints at the cDNA level of HOXA9 and MSI2, respectively.

Fig. 2.

Schematic representation of HOXA9, the predicted MSI2/HOXA9 chimera, and the MSI2 cDNA/proteins. The HOXA9 cDNA is based on GenBank accession no. U81511 (HOXA9-B) in which the CD exon (exon 1b), which contains an intermediate, alternatively spliced, exon (IME), is spliced to the homeobox-containing exon II (exon 2). Boxes, individual exons; Top, critical protein domains. Middle, the MSI2/HOXA9 chimera; exon 9 of MSI2 is fused to the IME of HOXA9. Below the individual boxes, the first nucleotide of each exon; within the boxes at the top, the corresponding amino acids; black boxes, the two RRM domains. Bottom, MSI2 contains at least 15 exons. The untranslated exons 14 and 15 are not drawn to scale. The nucleotide sequence of MSI2 is based on GenBank accession no. BC001526 and our own sequence data, using the primer combination 11U19/1147L20 (Table 1). Untranslated 5′ and 3′ ends were obtained using the TIGR Human Gene Index browser10 and human genome BLAST alignment11 of the assembled transcript. Arrows, the breakpoints at the cDNA level of HOXA9 and MSI2, respectively.

Close modal
Fig. 3.

Sequence and Northern blot analysis of MSI2. A, the MSI2 cDNA sequence and predicted protein. The two boxes, the initiation and stop codons. Bold and underlined, the last three nucleotides of each exon. Shadowed in gray, the RRM domains. The nucleotide sequence of MSI2 is based on GenBank accession no. BC001526 and our own direct sequence data using the primer combination 11U19/1147L20 (horizontal arrows; Table 1). Vertical arrow, the breakpoint in MSI2 at the cDNA level. B, Northern blot analysis of the MSI2 gene. A 224-bp cDNA probe, generated by the primer pair 554U22/770L21, was hybridized to a human 12-lane filter (Clontech, Paolo Alto, CA) containing multiple mRNAs from various tissues. To the left, the size markers; black arrowhead, the ∼5.5-kb transcript of MSI2. A minor transcript of ∼1.8 kb (white arrowhead) was also detected, possibly representing an alternatively spliced variant or a homologous gene. Equal loading was verified by hybridization with a β-actin cDNA probe (not shown)

Fig. 3.

Sequence and Northern blot analysis of MSI2. A, the MSI2 cDNA sequence and predicted protein. The two boxes, the initiation and stop codons. Bold and underlined, the last three nucleotides of each exon. Shadowed in gray, the RRM domains. The nucleotide sequence of MSI2 is based on GenBank accession no. BC001526 and our own direct sequence data using the primer combination 11U19/1147L20 (horizontal arrows; Table 1). Vertical arrow, the breakpoint in MSI2 at the cDNA level. B, Northern blot analysis of the MSI2 gene. A 224-bp cDNA probe, generated by the primer pair 554U22/770L21, was hybridized to a human 12-lane filter (Clontech, Paolo Alto, CA) containing multiple mRNAs from various tissues. To the left, the size markers; black arrowhead, the ∼5.5-kb transcript of MSI2. A minor transcript of ∼1.8 kb (white arrowhead) was also detected, possibly representing an alternatively spliced variant or a homologous gene. Equal loading was verified by hybridization with a β-actin cDNA probe (not shown)

Close modal
Table 1

Primers used for PCR and sequencing

DesignationSequence (5′ → 3′)DirectionNucleotide positionGene (GenBank accession no.)
40705U19 AGGGAAGTGGCCGACACAA Forward 2444 HOXA9 intron 1 (U81511) 
41388L21 AGGCCCAGGAACTCTTTCGTT Reverse 1762 HOXA9 intron 1 (U81511) 
692U22 AGCTCAGCCGAAAGAAGTCATG Forward 734 MSI2 exon 9 (BC001526) 
7256L21 ATTTTCATCCTGCGGTTCTGG Reverse 6073 HOXA9 exon 2 (U81511) 
750U21 CCTTACACCATGGACGCGTTC Forward 792 MSI2 exon 9 (BC001526) 
7215L21 CTCGGTGAGGTTGAGCAGTCG Reverse 6033 HOXA9 exon 2 (U81511) 
11U19 ATGGGAGCCAAGGCACCTC Forward 193 MSI2 exon 1 (BC001526) 
480U21 GTAGGCGGGTTATCTGCGAAC Forward 522 MSI2 exon 6 (BC001526) 
520U23 AGCAATATTTCGAGCAGTTTGGC Forward 562 MSI2 exon 6 (BC001526) 
741L21 GCTGCTGCCACTGGTCCATAA Reverse 926 MSI2 exon 11 (BC001526) 
770L21 TACCTGATCCTCTTGCTGCCG Reverse 955 MSI2 exon 11 (BC001526) 
554U22 GGGAACATGACTTCTTTCGGCT Forward 739 MSI2 exon 9 (BC001526) 
1147L20 AAGGCCGTTGCAATCAAAGG Reverse 1131 MSI2 exon 13 (BC001526) 
DesignationSequence (5′ → 3′)DirectionNucleotide positionGene (GenBank accession no.)
40705U19 AGGGAAGTGGCCGACACAA Forward 2444 HOXA9 intron 1 (U81511) 
41388L21 AGGCCCAGGAACTCTTTCGTT Reverse 1762 HOXA9 intron 1 (U81511) 
692U22 AGCTCAGCCGAAAGAAGTCATG Forward 734 MSI2 exon 9 (BC001526) 
7256L21 ATTTTCATCCTGCGGTTCTGG Reverse 6073 HOXA9 exon 2 (U81511) 
750U21 CCTTACACCATGGACGCGTTC Forward 792 MSI2 exon 9 (BC001526) 
7215L21 CTCGGTGAGGTTGAGCAGTCG Reverse 6033 HOXA9 exon 2 (U81511) 
11U19 ATGGGAGCCAAGGCACCTC Forward 193 MSI2 exon 1 (BC001526) 
480U21 GTAGGCGGGTTATCTGCGAAC Forward 522 MSI2 exon 6 (BC001526) 
520U23 AGCAATATTTCGAGCAGTTTGGC Forward 562 MSI2 exon 6 (BC001526) 
741L21 GCTGCTGCCACTGGTCCATAA Reverse 926 MSI2 exon 11 (BC001526) 
770L21 TACCTGATCCTCTTGCTGCCG Reverse 955 MSI2 exon 11 (BC001526) 
554U22 GGGAACATGACTTCTTTCGGCT Forward 739 MSI2 exon 9 (BC001526) 
1147L20 AAGGCCGTTGCAATCAAAGG Reverse 1131 MSI2 exon 13 (BC001526) 
1
Sawyers C. L. Chronic myeloid leukemia.
N. Engl. J. Med.
,
340
:
1330
-1340,  
1999
.
2
Deininger M. W., Goldman J. M., Melo J. V. The molecular biology of chronic myeloid leukemia.
Blood
,
96
:
3343
-3356,  
2000
.
3
Johansson B., Fioretos T., Mitelman F. Cytogenetic and molecular genetic evolution of chronic myeloid leukemia.
Acta Haematol.
,
107
:
76
-94,  
2002
.
4
Barbouti A., Johansson B., Höglund M., Mauritzson N., Strömbeck B., Nilsson P., Tanke H., Hagemeijer A., Mitelman F., Fioretos T. Multicolor COBRA-FISH analysis of chronic myeloid leukemia reveals novel cryptic balanced translocations during disease progression.
Genes Chromosomes Cancer
,
35
:
127
-137,  
2002
.
5
Fioretos T., Nilsson P. G., Åman P., Heim S., Kristoffersson U., Malm C., Simonsson B., Turesson I., Mitelman F. Clinical impact of breakpoint position within M-bcr in chronic myeloid leukemia.
Leukemia (Baltimore)
,
7
:
1225
-1231,  
1993
.
6
Fioretos T., Panagopoulos I., Lassen C., Swedin A., Billström R., Isaksson M., Strömbeck B., Olofsson T., Mitelman F., Johansson B. Fusion of the BCR and the fibroblast growth factor receptor-1 (FGFR1) genes as a result of t(8;22)(p11;q11) in a myeloproliferative disorder: the first fusion gene involving BCR but not ABL..
Genes Chromosomes Cancer
,
32
:
302
-310,  
2001
.
7
Borrow J., Shearman A. M., Stanton V. P., Jr., Becher R., Collins T., Williams A. J., Dube I., Katz F., Kwong Y. L., Morris C., Ohyashiki K., Toyama K., Rowley J., Housman D. E. The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9.
Nat. Genet.
,
12
:
159
-167,  
1996
.
8
Nakamura T., Largaespada D. A., Lee M. P., Johnson L. A., Ohyashiki K., Toyama K., Chen S. J., Willman C. L., Chen I. M., Feinberg A. P., Jenkins N. A., Copeland N. G., Shaughnessy J. D., Jr. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia.
Nat. Genet.
,
12
:
154
-158,  
1996
.
9
Nagai K., Oubridge C., Ito N., Avis J., Evans P. The RNP domain: a sequence-specific RNA-binding domain involved in processing and transport of RNA..
Trends Biochem. Sci.
,
20
:
235
-240,  
1995
.
10
Krecic A. M., Swanson M. S. hnRNP complexes: composition, structure, and function..
Curr. Opin. Cell Biol.
,
11
:
363
-371,  
1999
.
11
Sakakibara S., Nakamura Y., Satoh H., Okano H. RNA-binding protein Musashi2: developmentally regulated expression in neural precursor cells and subpopulations of neurons in mammalian CNS..
J. Neurosci.
,
21
:
8091
-8107,  
2001
.
12
Imai T., Tokunaga A., Yoshida T., Hashimoto M., Mikoshiba K., Weinmaster G., Nakafuku M., Okano H. The neural RNA-binding protein Musashi1 translationally regulates mammalian numb gene expression by interacting with its mRNA.
Mol. Cell. Biol.
,
21
:
3888
-3900,  
2001
.
13
van Oostveen J., Bijl J., Raaphorst F., Walboomers J., Meijer C. The role of homeobox genes in normal hematopoiesis and hematological malignancies.
Leukemia (Baltimore)
,
13
:
1675
-1690,  
1999
.
14
Lawrence H. J., Helgason C. D., Sauvageau G., Fong S., Izon D. J., Humphries R. K., Largman C. Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis.
Blood
,
89
:
1922
-1930,  
1997
.
15
Thorsteinsdottir U., Mamo A., Kroon E., Jerome L., Bijl J., Lawrence H. J., Humphries K., Sauvageau G. Overexpression of the myeloid leukemia-associated Hoxa9 gene in bone marrow cells induces stem cell expansion.
Blood
,
99
:
121
-129,  
2002
.
16
Lam D. H., Aplan P. D. NUP98 gene fusions in hematologic malignancies.
Leukemia (Baltimore)
,
15
:
1689
-1695,  
2001
.
17
Kasper L. H., Brindle P. K., Schnabel C. A., Pritchard C. E., Cleary M. L., van Deursen J. M. CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity.
Mol. Cell. Biol.
,
19
:
764
-776,  
1999
.
18
Tamagnone L., Comoglio P. M. Signalling by semaphorin receptors: cell guidance and beyond..
Trends Cell Biol.
,
10
:
377
-383,  
2000
.
19
Tamagnone L., Artigiani S., Chen H., He Z., Ming G. I., Song H., Chedotal A., Winberg M. L., Goodman C. S., Poo M., Tessier-Lavigne M., Comoglio P. M. Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates.
Cell
,
99
:
71
-80,  
1999
.
20
Ron D. TLS-CHOP and the role of RNA-binding proteins in oncogenic transformation.
Curr. Top. Microbiol. Immunol.
,
220
:
131
-142,  
1997
.
21
Mercher T., Busson-Le Coniat M., Monni R., Mauchauffee M., Nguyen Khac F., Gressin L., Mugneret F., Leblanc T., Dastugue N., Olivier A. B. Involvement of a human gene related to the Drosophila spen gene in the recurrent t(1;22) translocation of acute megakaryocytic leukemia.
Proc. Natl. Acad. Sci. USA
,
99
:
5776
-5779,  
2001
.