Peroxisome proliferator-activated receptor γ (PPARγ) is a member of the nuclear hormonal receptor superfamily expressed in a large number of human cancers. Here, we demonstrate that PPARγ is expressed and transcriptionally active in breast cancer cells independent of their p53, estrogen receptor, or human epidermal growth factor receptor 2 status. 2-Cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), a novel synthetic triterpenoid, is a ligand for PPARγ. We investigated the molecular mechanisms of CDDO on proliferation and apoptosis in breast cancer cells. In all breast cancer cell lines studied, CDDO transactivated PPARγ, induced dose- and time-dependent cell growth inhibition, cell cycle arrest in G1-S and G2-M, and apoptosis. We then used differential cDNA array analysis to investigate the molecular changes induced by CDDO. After 16-h exposure of MCF-7 and MDA-MB-435 cells to CDDO, we found genes encoding the following proteins to be up-regulated in both cell lines: p21Waf1/CIP1; GADD153; CAAT/enhancer binding protein transcription factor family members; and proteins involved in the ubiquitin-proteasome pathway. Among the down-regulated genes, we focused on the genes encoding cyclin D1, proliferating cell nuclear antigen, and the insulin receptor substrate 1. Using Western blot analysis and/or real-time PCR, we confirmed that CDDO regulated the expression of cyclin D1, p21Waf1/CIP1, and Bcl-2. Cyclin D1 and p21Waf1/CIP1 were additionally confirmed as important mediators of CDDO growth inhibition in genetically modified breast cancer cell lines. CDDO was able to significantly reduce the growth of MDA-MB-435 tumor cells in immunodeficient mice in vivo. The finding that CDDO can target genes critical for the regulation of cell cycle, apoptosis, and breast carcinogenesis suggests usage of CDDO as novel targeted therapy in breast cancer.

Breast carcinoma is the most common malignancy among women in North America and Western Europe (1). Despite advances in earlier diagnosis and therapy, >44,000 women in the United States will die of metastatic disease each year (2). Drug resistance remains the major source of treatment failure in women with breast cancer. Two proteins implicated in drug resistance are HER24 and the cell cycle regulator, cyclin D1. Both are frequently overexpressed in breast cancer and are of prognostic significance (3, 4). PPARγ, a member of the nuclear hormone receptor superfamily that includes receptors for steroids, thyroid hormone, vitamin D, and retinoic acid, acts as ligand-sensitive transcription factor (5) and regulates gene transcription by binding as a heterodimer with retinoid X receptors to specific response elements (PPREs) in the promoter regions of target genes (6). Endogenous PPARγ ligands include fatty acid-like compounds such as 15-deoxy-Δ12,14-prostaglandin J2, and linoleic acid (7, 8, 9). Pharmaceutical PPARγ ligands include the thiazolidinediones, which are antidiabetic drugs that include troglitazone, BRL49653 (rosiglitazone), and pioglitazone. PPARγ was first found at high levels in adipose tissue, where it functions as a critical regulator of adipocyte differentiation and fat metabolism (10, 11, 12). However, PPARγ also exists in many other cell types, where it mediates anti-inflammatory effects, modulates insulin sensitivity and inhibits cellular proliferation (13, 14). It is expressed in a large number of human cancers, including breast, colon, stomach, prostate, pancreas, bladder, placenta, lung, chondrosarcoma, and in leukemias. In vitro studies have demonstrated that PPARγ ligands inhibit growth and induce differentiation and apoptosis in cancer cells (7, 15, 16, 17, 18, 19, 20, 21, 22, 23). In vivo immunodeficient mice with human tumors treated with troglitazone, a pharmaceutical ligand used as an antidiabetic agent, showed similar results (18, 21, 24). In addition, in clinical trials, PPARγ ligands induced cytological and biochemical differentiation in patients with advanced liposarcoma (25) and stabilized prostate-specific antigen levels in patients with advanced prostate cancer (26).

Breast tissue, in particular, was found to express PPARγ (7, 27) in amounts greater than those found in normal breast epithelium (24). In addition, mammary tumors developed much faster in offspring of transgenic mice expressing a constitutively active form of PPARγ in breast tissue bred to transgenic animals prone to breast cancer (28). PPARγ could therefore represent a novel therapeutic target for breast cancer. PPARγ ligands exert their antitumor effects through growth inhibition and cellular differentiation. A recent study showed that PPARγ ligands inhibit the proliferation of breast cancer cells by repressing cyclin D1 expression (29). The pivotal role of cyclin D1 in the development of mammary carcinomas in mice is underscored by several lines of evidence: (a) transgenic mice engineered to overexpress cyclin D1 in the mammary gland develop carcinomas after a long latency period (Ref. 4; this process is accelerated by the simultaneous overexpression of c-myc), (b) cyclin D1 expression was required for timely epithelial cell proliferation (30, 31), and (c) cyclin D1-deficient mice were resistant to mammary carcinomas induced by c-neu and v-Ha-ras but not to those induced by c-myc or Wnt-1 (32). Moreover, cyclin D1 antisense oligonucleotides inhibited neu-induced transformation and abolished the growth of Neu-transformed mammary cells in immunodeficient mice (33). Of importance, HER2-inhibitory antibodies failed to change cyclin D1 levels in HER2-overexpressing cells (34, 35).

CDDO, a novel synthetic triterpenoid, is a specific ligand for PPARγ (36). CDDO has potent differentiating, antiproliferative, and anti-inflammatory properties (37). Our group has shown that CDDO induced Bcl-2 down-regulation, mitochondrial depolarization, and caspase activation in myeloid leukemic cells (38). In the studies described here, we investigated the molecular effects of CDDO on proliferation, differentiation, and apoptosis of breast cancer cells.

Reagents.

CDDO was manufactured under the NIH RAID Program under good manufacturing practice conditions and kindly provided by Drs. Edward A. Sausville and Michael B. Sporn. A stock solution of 10 mm CDDO in DMSO was kept stored at −20°C. The working solution was prepared in DMSO and added directly to the culture medium. CDDO working concentrations varied from 0.05 to 10 μm. Appropriate amounts of DMSO (final concentration, <0.05%) were included as controls. Actinomycin D (1 μg/ml; Sigma Chemical Co., St. Louis, MO) was added to the culture 1 h before CDDO or vehicle was added.

Cell Lines and Media.

MCF-7 cells were cultured in RPMI supplemented with 10% FCS (Life Technologies, Inc., Gaithersburg, MD) and l-glutamine. MDA-MB-435 and MDA-MB-231 cells were cultured in MEM with Earle’s salts supplemented with 5% FCS, sodium pyruvate, nonessential amino acid solution for MEM, vitamin solution for MEM (Life Technologies, Inc.), and l-glutamine. HCT116 p21Waf1/CIP1 and HCT116 p21Waf1/CIP1−/− were kindly provided by Dr. Bert Volgelstein (Johns Hopkins University, Baltimore, MD; Ref. 39) and were maintained in McCoy’s 5A medium supplemented with 10% FCS and l-glutamine. T-47D breast cancer cells with constitutive cyclin D1 (D1 17-1) and a matched vector (empty) were cultured in RPMI 1640 supplemented with 5% FCS, human insulin, and gentamicin (40, 41). The cells were cultured at a density of 0.1 × 106 cells/ml in the presence or absence of indicated concentrations of CDDO. After 16–72 h, viable cells were counted using a hematocytometer and the trypan blue dye exclusion method.

Flow Cytometric Analysis of Cell Cycle.

The technique of Dolbeare et al. (42) was used to analyze cell cycle distribution. Briefly, cells were labeled for 1 h with 50 μm BrdUrd, fixed in 70% ethanol, and kept at 4°C until processed for the detection of BrdUrd. Cells were then rehydrated in PBS, treated with 2 n HCl for 20 min, and washed extensively in blocking buffer [0.5% BSA and 0.5% Tween 20 in PBS], incubated with FITC-conjugated antibody against BrdUrd (Becton Dickinson, San Jose, CA) and diluted 1:10 in the blocking buffer for 1 h. After three washes, cells were incubated for 20 min with 1 mg/ml RNase and 1.25 μg/ml PI in 4 mm citrate buffer (pH 7.8). Cell preparations were analyzed with a FACSCalibur flow cytometer (Becton Dickinson) equipped with a 15-mW, 488-nm air-cooled argon-ion laser. The following filters were used: 530 nm (FITC) and 585 nm (PI). Data acquisition and analysis were performed using CellQuestPro software (Becton Dickinson). PCNA expression was determined using an antibody from Becton Dickinson/PharMingen.

Annexin V Staining.

Cells were washed in PBS and resuspended in 100 μl of binding buffer containing Annexin V (Roche Diagnostic Corp., Indianapolis, IN). They were then analyzed by flow cytometry after the addition of PI (43). Annexin V binds to those cells that express phosphatidylserine on the outer layer of the cell membrane, and PI stains the cellular DNA of those cells with a compromised cell membrane. This allows live cells (unstained with either fluorochrome) to be distinguished from apoptotic cells (stained only with Annexin V) and necrotic cells (stained with both Annexin V and PI; Ref. 44).

Cytofluorometric Analysis of Δψm.

To measure Δψm, cells were loaded with CMXRos (300 nm) and MitoTracker Green (100 μm; both from Molecular Probes, Eugene, OR), and the reaction was allowed to continue for 1 h at 37°C. Δψm was then determined by measuring CMXRos retention (red fluorescence) while simultaneously adjusting for the mitochondrial mass (green fluorescence; Ref. 45).

Western Blotting and Antibodies.

An equal amount of cell lysate was separated by 10–12% SDS-PAGE, followed by immunoblotting on Hybond-P membranes (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom). Proteins were visualized using the enhanced chemiluminescence detection system (Amersham Pharmacia Biotech) after incubation for 2 h or overnight with the following primary antibodies: human cyclin D1 (mouse monoclonal HD-11), human cyclin E (rabbit polyclonal M-20), human cdk4 (rabbit polyclonal C-22), human cdk2 (mouse monoclonal D-12), human P21Waf1/CIP1 (mouse monoclonal 187), and PPARγ (mouse monoclonal E-8) from Santa Cruz Biotechnology (Santa Cruz, CA); human p27 (mouse monoclonal 554069) and human pRb (mouse monoclonal G3-245) were from PharMingen, San Diego, CA.

Quantitative Real-Time Reverse Transcription-PCR.

Total RNAs were prepared using Trizol reagent as described by the manufacturer (Life Technologies, Inc.). One μg of total RNA was reverse transcribed by avian myeloblastosis virus reverse transcriptase (Roche Diagnostic Corp.) under standard conditions. Duplicate samples of 1 μl of each cDNA were amplified by PCR in the ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA). The Primer Express program (PE Applied Biosystems) was used to design the primers and probes. The amplification reaction mixture (25 μl) contained cDNAs, forward primers, reverse primers, probes, and Taqman Universal PCR Master Mix (PE Applied Biosystems). BMG was coamplified as an internal control to normalize for variable amounts of cDNA in each sample. The thermocycler parameters were as follows: 50°C for 2 min; 95°C for 10 min; 40 cycles of 95°C for 15 s; and 60°C for 1 min. Results were collected and analyzed to determine the PCR cycle number that generated the first fluorescence signal above a threshold (threshold cycle, CT; 10 SDs above the mean fluorescence generated during the baseline cycles), after which a comparative CT method was used to measure relative gene expression. The following formula was used to calculate the relative amount of the transcript of interest in the treated sample (X) and the control sample (Y), both of which were normalized to an endogenous reference value (BMG): 2ΔΔCT, where ΔCT is the difference in CT between the gene of interest and BMG, with the ΔΔCT for sample X = ΔCT(X) − ΔCT(Y). The oligonucleotide and probe sequences used are listed in Table 1.

Plasmids.

For the luciferase assays, response elements were cloned into a TK-LUC reporter that contains the herpes virus thymidine kinase promoter. The response element consensus sequence for PPRE was kindly provided by Dr. Ronald M. Evans (9). Full-length human PPARγ1 (kindly provided by Dr. Krishna K. Chatterjee; Ref. 46) was cloned into the pEGFP-C2 vector (Clontech).

Transfection Assays.

One day before transfection, cells were plated at a density of 0.1 × 105 to 2 × 105 cells/ml. Cells were transfected with PPREx3-TK-LUC reporter (300 ng/105 cells) or with 1 μg of pEGFP-C2 or pEGFP-C2hPPARγ using the Fugene-6 transfection reagent (Roche Molecular Biochemicals) according to the manufacturer’s instructions. For the luciferase assay, transfected cells were treated with 1 μm CDDO or with vehicle for 24 h starting on day 1 after transfection. Cells were then harvested, and the luciferase assay was performed using Fluoroscan Ascent (Labsystems, Franklin, MS). MCF-7/pEGFP-C2 and MCF-7/pEGFP-C2hPPARγ stable transfectants were selected in the presence of G418 (800 μg/ml), and individual clones were isolated by limited dilution. In lysates from the selected clones, evaluated for transgene expression by immunoblot analyses using anti-PPARγ antibody, the fusion protein was detected at Mr 80,000.

Oligonucleotide Array-based Expression Profiling.

Hybridization was performed using Human Genome U95Av2 probe arrays (Affymetrix, Santa Clara, CA) containing probe sets from ∼12,000 previously characterized genes.5 The target was labeled and hybridized to the probe arrays, washed, stained, and scanned as described previously. Briefly, total RNAs were prepared using the RNeasy Total RNA Isolation kit (Qiagen, Valencia, CA) and double-stranded cDNA was synthesized from total RNA; an in vitro transcription reaction was done to produce biotin-labeled cRNA from the cDNA; and the cRNA was fragmented and hybridized to the oligonucleotide probes on the probe array during 16 h of incubation at 45°C. Immediately after hybridization, the hybridized probe array underwent an automated washing and staining protocol on the fluidics station, and the Genechip Microarray Suite 4.0 Software (Affymetrix) was used to measure the intensity of expression of each feature. DNA-Chip Analyzer software was designed to better analyze the quantified image (47, 48). The expression value for each target gene was determined by calculating the average of differences (perfect-match intensity minus mismatch intensity) of the 14–20 probe pairs used for the particular gene. Ratios of the average proportion of treated cells to control cells were determined in the respective experiments.

Statistical Analysis.

DNA-Chip Analyzer software was used to analyze the quantified images. The expression change for each target gene was estimated with the reduced Li Wong p.m.-MM difference model (47, 48). The statistical results for each target gene and the contrasting expression levels included the FC, 90% confidence interval on the FC, the difference in means or difference in mean expression, and the P testing the hypothesis Ho: FC = 1 versus the alternative Ha: FC ≠ 1. The statistical results were imported into the Result Viewer 2.0 software (49). This application allows investigators to browse through the results of bioinformatics experiments in a user-friendly environment to extract records based on a statistical or biological criterion.

In Vivo Studies.

Female nude immunodeficient mice were purchased from Harlan Laboratory (Indianapolis, IN). Two groups of nude mice (4–6 weeks) were inoculated s.c. with MDA-MB-435 cells (n = 25; 2 × 106 cells/mouse in 100 μl of PBS). Ten days after inoculation, one group (n = 10) of mice was treated with 40 mg/kg CDDO (sodium salt CDDO prepared as follows: 2 mg of CDDO, 0.6 mg of sodium carbonate, 0.84 mg of sodium bicarbonate, 7 mg of sodium chloride, and sodium hydroxide/hydrochloric acid to adjust the pH to 9.6) i.v. twice a week for 3 weeks. The rest of the mice (n = 15) received vehicle only. Tumors were measured twice weekly with microcalipers, and the tumor volume was calculated as length × width.

PPARγ Is Expressed in Breast Cancer Cell Lines.

First, we investigated the basal mRNA expression of PPARγ in five different breast cancer cell lines: MCF-7; SKBR-3; MDA-MB-231; MDA-MB-435; and MDA-MB-453. Quantitative real-time reverse transcription-PCR showed that PPARγ mRNA was expressed in all cell lines studied irrespective of their ER, HER2/neu, or p53 status. The highest PPARγ mRNA expression was in MDA-MB-231 cells, which are highly metastatic in mouse models. These mRNA expression data were then confirmed by Western blot analysis in MDA-MB-231, MDA-MB-435, and MCF-7 cells, with MDA-MB-231 and MDA-MB-435 cells expressing the highest levels of the receptor (Fig. 1). These three cell lines were therefore chosen for subsequent analyses. As CDDO (1 μm) increased PPARγ mRNA expression in both MCF-7 and MDA-MB-435 cells by 2-fold at 24 h and by >7-fold at 48 and 72 h, we then investigated whether CDDO could efficiently transactivate PPARγ. To determine this, cells were transfected with the PPRE-TK-LUC reporter, and luciferase assays were performed. In the absence of CDDO, the PPRE reporter was activated in all cell lines in a wide range, from low in MDA-MB-435 cells (0.17 RLU) to high in MCF-7 cells (8.71 RLU). In the presence of CDDO, however, PPRE was activated by >10-fold in all three cell lines studied (Fig. 2). These experiments thus showed the ability of CDDO to transactivate PPARγ.

CDDO Inhibits Growth of MCF-7, MDA-MB-435, and MDA-MB-231 Breast Cancer Cells.

MCF-7, MDA-MB-435, and MDA-MB-231 cells were exposed to different concentrations of CDDO (0.1, 0.5, 1, and 10 μm) for 72 h. The effects of CDDO on the growth of breast cancer cells were then determined by cell counts at 24, 48, and 72 h (Fig. 3 A). Untreated ER(−) MDA-MB-231 and MDA-MB-435 cells proliferated much faster than ER(+) MCF-7 cells, as shown by comparison with the growth curve of these cells in the presence of vehicle only. At 0.1 μm, CDDO only modestly retarded cell growth. At 0.5 and 1 μm, CDDO significantly inhibited cell growth 8-, 7-, and 4-fold in MDA-MB-231, MDA-MB-435, and MCF-7 cells, respectively, at 72 h; the cells became larger and remained predominantly adherent. At 10 μm CDDO, cell growth inhibition was more pronounced but cells were mostly (at 24 and 48 h) to totally (at 72 h and all subsequent time points) detached and became smaller and round. For the experiments described in the following sections, a fully cytostatic concentration of CDDO of 1 μm was used.

To determine the correlation between PPARγ expression and the sensitivity of breast cancer cells to CDDO, we tested the effects of CDDO in PPARγ-overexpressing MCF-7 cells. Vector control or EGFP-PPARγ-transfected MCF-7 cells were treated with 0.05, 0.1, and 0.5 μm CDDO for 24, 48, and 72 h. As shown in Fig. 3 B, overexpression of PPARγ enhanced the sensitivity of cells to growth arrest induced by low concentrations of CDDO (0.05 and 0.1 μm), but at 0.5 μm cells, complete inhibition of cell growth was observed in both cell lines.

CDDO Induces Cell Cycle Arrest in MCF-7, MDA-MB-435, and MDA-MB-231 Cell Lines.

Because CDDO inhibited cell growth, we investigated its effects on cell cycle distribution. The proliferation and repartition of cells in different phases of the cell cycle was analyzed at 24, 48, and 72 h on the basis of BrdUrd incorporation. The percentage of cells in S phase was defined after double staining with BrdUrd/PI and proved to be higher in MDA-MB-435 and MDA-MB-231 cells than in MCF-7 cells (60, 44, and 39%, respectively), which is in concordance with the observed enhanced cell growth. Although DMSO did not affect proliferation, 1 μm CDDO progressively reduced proliferation in all three cell lines tested. Specifically, BrdUrd incorporation and the percentage of cells in S phase decreased dramatically and reached complete G1-S and G2-M blocks at 48 h in MCF-7 and MDA-MB-231 cells and at 72 h in MDA-MB-435 cells. All results are summarized in Fig. 4. These data demonstrated that CDDO rapidly inhibits BrdUrd incorporation at the G1-S transition and dramatically reduced the proportion of cells in S phase in a time-dependent manner. In addition, cells accumulated in G2-M.

CDDO Induces Apoptosis at Concentrations >1 μm.

As CDDO has been shown to induce apoptosis in leukemia cell lines and primary leukemia samples (38), we studied the effects of CDDO on apoptosis induction in breast cancer cell lines. As determined by Annexin V staining and flow cytometry, 1 μm CDDO induced apoptosis in MDA-MB-231 cells (DMSO = 2%, CDDO = 18% at 48 h and 41% at 72 h), MDA-MB-435 cells (DMSO = 5%, CDDO = 19% at 72 h), and MCF-7 cells (DMSO = 8%, CDDO = 29% at 24 h). At lower CDDO concentrations of 0.1 and 0.5 μm, apoptosis was not induced. At 2 μm CDDO, apoptosis was induced after the same pattern seen for 1 μm.

To determine the molecular changes that occur during CDDO-induced cell death, we first studied Δψm. Exposure to 1 μm CDDO induced loss of Δψm in all three cell lines studied: MDA-MB-231 cells (DMSO = 5%, CDDO = 17% at 48 h and 48% at 72 h); MDA-MB-435 cells (DMSO = 8%, CDDO = 24% at 48 h and 58% at 72 h); and MCF-7 cells (DMSO = 8%, CDDO = 18% at 24 h, 28% at 48 h, and 34% at 72 h). These changes were followed by translocation of phosphatidylserine in all three cell lines. At 10 μm CDDO, the Δψm was lost in all three cell lines at 72 h. Fig. 5 shows a representative experiment. These data demonstrate that CDDO induces apoptosis mediated through the mitochondrial pathway in breast cancer cell lines.

Genes Targeted by CDDO.

We then studied the effects of CDDO on a larger number of genes using an Affymetrix oligo array. MCF-7 and MDA-MB-435 cells were treated with 2 μm CDDO or with vehicle alone as control for 16 h. RNA was isolated, labeled, and hybridized to the oligonucleotide microarrays containing probe sets representing ∼12,000 human genes. The following criteria were used to select the genes differentially expressed in treated and control cells: lower bound of FC > 2 and difference of means >150 for up-regulated genes and upper bound of FC < −2 and difference of mean <− 150 for down-regulated genes. For the MCF-7 cells, 280 genes showed a >2-fold increase and 188 genes showed a ≤2-fold decrease. For the MDA-MB-435 cells, 208 genes were up-regulated >2-fold, and 293 genes were down-regulated ≤2-fold. To investigate the molecular changes induced by CDDO, we first selected the genes that were up-regulated or down-regulated in both cell lines. Fifty genes were up-regulated >2-fold, and 41 genes were down-regulated ≤2-fold in both MDA-MB-435 and MCF-7 cell lines. These genes were then classified by function and are summarized in Tables 2 and 3. We specifically focused on genes involved in cell cycle regulation and apoptosis and found that CDDO down-regulated the genes encoding cyclin D1, PCNA, and cyclin F and up-regulated the genes encoding p21Waf1/CIP1 and CDC-like kinase 1. CDDO up-regulated the apoptotic gene GADD153 (TLS/cyclophosphamide-Adriamycin-vincristine-prednisone) and down-regulated the IEX-1 gene in both cell lines. Some of the cell cycle and apoptotic genes were differentially expressed in only one cell line such as the genes encoding GADD34 and GADD45, which were up-regulated, and the genes encoding Bcl-2, CDC25B, and cyclin A2, B1, and B2, which were down-regulated.

To confirm the microarray results, changes in mRNA expression of different genes were analyzed by real-time PCR. We tested the expression of cyclin D1, cyclin D2, cyclin E, p21Waf1/CIP1, p27KIP1, and Bcl-2 (Table 4). In both cell lines, cyclin D1 mRNA was down-regulated, and p21Waf1/CIP1 mRNA was up-regulated. No significant differences in cyclin E and p27KIP1 mRNA were found, and no cyclin D2 mRNA expression was detected. Bcl-2 mRNA expression was down-regulated 20-fold by real-time PCR only in MCF-7 cells, a finding also demonstrated by microarray analysis, which showed a 7-fold decrease. Fig. 6 shows the changes in cyclin D1 and p21Waf1/CIP1 mRNA expression detected by microarray and real-time PCR. The decrease in PCNA was confirmed by flow cytometry (data not shown).

Other genes besides those involved in cell cycle and apoptosis regulation were found to be modulated by CDDO. This included genes encoding C/EBP transcription factors, zinc finger proteins, proteins involved in the ubiquitin-proteasome pathway, some heat shock proteins, which were up-regulated, genes encoding members of the histone family and some proteins involved in lipid metabolism and the regulation of insulin, which were down-regulated (Tables 2 and 3). Among the genes known to be regulated by PPARγ, some were differentially expressed only in MDA-MB-435 cells such as adipsin, adipophilin, clusterin, and GLUT3, which were up-regulated, and different insulin-like growth factors, fatty acid enzyme, and tumor necrosis factor α, which were down-regulated (50, 51, 52). This cell line appears more sensitive to CDDO with regard to lipid and glucose regulation.

CDDO Reduces Cyclin D1 Expression and Induces p21Waf1/CIP1 Expression in Breast Cancer Cell Lines.

Of the genes regulated by CDDO and identified by microarray studies, some such as those encoding cyclin D1 and p21Waf1/CIP1 play a critical role in breast cancer. To further elucidate our findings, we used real-time PCR to analyze the differential expression of mRNA for cyclin D1, cyclin E, p21Waf1/CIP1, p27KIP1, and Bcl-2 at 24, 48, and 72 h in the presence of 1 μm CDDO or vehicle in MDA-MB-435, MDA-MB-231, and MCF-7 cells. Results are summarized in Table 5. Of note, cyclin D1 mRNA expression was down-regulated in all three breast cancer cell lines, and this was completely prevented by pretreatment with actinomycin D. In addition, Bcl-2 mRNA expression was reduced in MCF-7 cells at 24 and 48 h and in MDA-MB-435 cells at 72 h. In contrast, P21Waf1/CIP1 mRNA was highly induced in all three cell lines in a time-dependent manner (Fig. 7). This up-regulation was markedly (10-fold) but not completely inhibited by pretreatment with actinomycin D (1.7-, 2.9-, and 5.3-fold higher levels of P21Waf1/CIP1 at 24, 48, and 72 h, respectively). Western blot analysis demonstrated corresponding changes at the protein level for P21Waf1/CIP1 and cyclin D1 in MDA-MB-435 and MCF-7 cells (Fig. 8). However, expression levels of CDK2 and CDK4 did not change, nor did cyclin E (data not shown). Of interest, p27KIP1 was up-regulated 2-fold in the presence of CDDO, suggesting posttranscriptional regulation. Taken together, these data suggest that CDDO can efficiently target the cell cycle regulators cyclin D1 and P21Waf1/CIP1 and partially affect p27KIP1, all known to be clinically relevant in human breast cancer.

Cyclin D1 and P21Waf1/CIP1 Are Critical Mediators of CDDO-induced Growth Inhibition.

To determine whether cyclin D1 down-regulation is critical for CDDO-induced growth inhibition, we conducted experiments in T-47D breast cancer cells with constitutive cyclin D1 overexpression. T-47D cyclin D1 17-1 showed 5-fold overexpressed cyclin D1 at the protein level compared with matched controls (T-47D empty; Ref. 40; Fig. 9). Cells were exposed to different concentrations of CDDO (0.1, 0.5, and 1 μm) for 72 h, and cell growth inhibition and regulation of cyclin D1 were analyzed. Cyclin D1-overexpressing cells were significantly less sensitive to CDDO at 24 and 48 h, whereas the difference was minimal at 72 h (Fig. 9). Of importance, 0.5 μm CDDO at 72 h down-regulated cyclin D1 expression in both T-47D cyclin D1 17-1 and control cells (Fig. 9).

To analyze the role of p21Waf1/CIP1 for the sensitivity to CDDO, we carried out experiments in p21-knockout HCT116 cells (39). The p21Waf1/CIP1 parental and knockout cells were exposed to different concentrations of CDDO (0.1, 0.5, and 1 μm) for 72 h. Although p21 was undetectable in p21Waf1/CIP1 HCT116-knockout cells, it was expressed in parental cells and further induced by CDDO (Fig. 10). At 72 h, p21Waf1/CIP1-knockout HCT116 cells were moderately resistant to 0.5 μm CDDO compared with control cells, but this effect was lost at higher (1 μm) concentration (Fig. 10). Cell cycle analysis showed that after CDDO, 10% of cells remained in S phase in parental HTC116 cells, whereas 35% of the cells remained BrdUrd positive in p21Waf1/CIP1-knockout cells (Fig. 10).

CDDO Treatment Reduces Breast Cancer Growth in Immunodeficient Mice.

The effect of CDDO on breast tumors was further tested in female nude immunodeficient mice (n = 25), inoculated s.c. with 2 × 106 MDA-MB-435 cells each. Once the tumors were established 10 days after inoculation, 10 mice were treated with CDDO at a dose of 40 mg/kg i.v. twice a week for 3 weeks. The rest of the mice (n = 15) received vehicle only. The tumors were measured twice weekly with microcalipers, and the tumor volume was calculated as the length × width. The results demonstrated a statistically significant (P = 0.013) reduction in tumor growth in the treated group compared with the vehicle group (Fig. 11).

In this study, we investigated the effects of a recently characterized PPARγ ligand, CDDO, in breast cancer cell lines. PPARγ ligation is known to induce differentiation, growth arrest, and apoptosis and to inhibit angiogenesis in certain tumors. In the present study, we demonstrated that PPARγ was expressed at high levels in all breast cancer cell lines studied, independently of their ER, p53, and HER2/neu status. Of additional importance, PPARγ was transcriptionally active, and CDDO, as with other PPARγ ligands, induced PPARγ transactivation in the luciferase reporter assay. We then studied the effects of CDDO on breast cancer cell growth in vitro. CDDO at 1 μm completely abrogated tumor cell growth. This was noted in all breast cancer cell lines studied, including ER(−), p53-mutated, and HER2-expressing cells. To shed light on the mechanisms of the growth arrest produced by CDDO, we investigated its effect on cell cycle regulation and apoptosis. CDDO induced a complete G1-S block and an accumulation of cells in G2. Growth inhibition, cell cycle block, and apoptosis induction were all more pronounced in MDA-MB-231 cells overexpressing PPARγ, which showed rapid cell growth. Furthermore, overexpression of PPARγ in MCF-7 cells sensitized cells to low concentrations of CDDO. However, at high concentrations, complete growth arrest was observed in both cell lines, pointing out to PPARγ-independent and PPARγ-dependent mechanisms. To elucidate the molecular changes induced by CDDO, we performed differential cDNA array analysis in two different cell lines (MCF-7 and MDA-MB-435 cells). Of the >12,000 genes represented on the chips, 91 genes were changed in both cell lines. We then characterized the common differentially expressed genes regulating cell cycle and/or apoptosis.

cDNA array studies showed that CDDO regulated the genes encoding cyclin D1, PCNA, and p21Waf1/CIP1 and proteins involved in the ubiquitin-proteasome pathway, changes consistent with the observed cell cycle arrest. These proteins play important roles in cell cycle regulation. Specifically, cyclin D1 participates in the control of G1 progression by activating its kinase partners, CDK4 and CDK6, which leads to the phosphorylation of the retinoblastoma protein, thereby relieving pRb’s inhibitory function (53). The overexpression of cyclin D1 accelerates the passage of cells through G1, whereas the inhibition of cyclin D1 leads to G1 arrest (54, 55). Cyclin D1 was shown to be rate limiting for cell cycle progression in breast epithelial cells (56). The down-regulation of cyclin D1 observed in our experiments suggests an important effect of CDDO on cell cycle control of breast cancer. A recent study demonstrated that the inhibition of proliferation by PPARγ ligands is mediated by the PPARγ-dependent repression of cyclin D1. Of interest, we demonstrated increased resistance to CDDO at early time points for cyclin D1 overexpressing breast cancer cells, but cyclin D1 was still down-regulated at 72 h. This observation is reminiscent of results obtained with antiestrogens (40). Repression of cyclin D1 involves the competition between PPARγ and c-Fos for limited quantities of p300, a coactivator protein also known as CBP (29). Furthermore, because many cell cycle regulators are controlled by ubiquitin-proteasome degradation, the down-regulation of the cyclin D1 protein by CDDO could be mediated by this pathway in addition to transcriptional down-regulation because we found the induction of mRNAs for some of the proteins involved in this pathway (57). This hypothesis was recently confirmed in MCF-7 cells treated by PPARγ agonists ciglitazone or 15-deoxy-Δ12,14-prostaglandin J2 (58). Targeting cyclin D1 may be of critical importance considering its pivotal role in human breast cancers. Cyclin D1 protein is overexpressed in 50% of human mammary carcinomas (59, 60, 61). Importantly, transgenic mice engineered to overexpress cyclin D1 in the mammary gland develop carcinomas after a long latency period, a process that is accelerated by simultaneous overexpression of c-myc (40, 41), and cyclin D1-deficient mice are resistant to mammary carcinomas induced by c-neu and v-Ha-ras (but not to cancers induced by c-myc or Wnt-1; Ref. 32). We report here that CDDO down-regulates cyclin D1 in all three cell lines studied, even those overexpressing HER2 (a product of the proto-oncogene erb2). The down-regulation of cyclin D1 mRNA was prevented by pretreatment with actinomycin D, suggesting that cyclin D1 is also regulated at the transcriptional level.

P21Waf1/CIP1 inhibits cell cycle progression leading to G1 arrest. At the molecular level, P21Waf1/CIP1 inhibits CDK activity with a certain selectivity for G1-S-phase cyclin-CDK complexes (62). p21Waf1/CIP1 also activates cyclin D-CDK complexes by increasing the stability of the D-type cyclins (63) and by directing these complexes to the cell nucleus (64, 65). In addition to its role in G1 transition, p21Waf1/CIP1 reaccumulates in nuclei near the G2-M boundary and promotes a transient block late in G2(66). In the breast cancer cell lines studied, the up-regulation of p21Waf1/CIP1 by CDDO is consistent with the G1-S arrest and probably also with the G2-M block observed. The experiments with HCT116 P21Waf1/CIP1 −/− cells support the importance of P21Waf1/CIP1 in CDDO-mediated cell cycle arrest. The expression of CDK2 and CDK4 remained constant in the presence of CDDO. Taken together, the observed increase in P21Waf1/CIP1 and decrease in cyclin D1 suggests that CDDO is a potent inhibitor of cell cycle progression in breast cancer, with concomitant effects on cyclin D1 and p21Waf1/CIP1. This conclusion is additionally substantiated by the finding that the p21 gene contains a potential conserved consensus PPRE in the promoter region (67). It has also been observed that P21Waf1/CIP1 mediates p53-induced cell cycle arrest in cells with DNA damage after irradiation, but p21Waf1/CIP1 can be induced independently of p53(68). This was reported for a novel alkylphospholipid found to promote cell cycle arrest at either G1-S or G2-M (69). To determine the role of p53 in CDDO-mediated cell cycle arrest, we tested cells with different p53 status (wild type and mutant). Results demonstrated that p21Waf1/CIP1 was indeed up-regulated by CDDO independent of p53. Besides CDK regulation, p21Waf1/CIP1 directly binds to PCNA, which is associated with DNA replication and cell proliferation (70). In the growth inhibition of the breast cancer cells produced by CDDO, however, PCNA down-regulation could either indicate the lack of proliferation or be the result of complete inhibition linked to the overexpression of p21Waf1/CIP1(71).

Our findings additionally demonstrate that CDDO induces apoptosis in breast cancer cells by reducing Δψm, followed by the translocation of phosphatidylserine to the cell surface. In addition, we demonstrate down-regulation of antiapoptotic Bcl-2 and up-regulation of proapoptotic GADD153, also known as cyclophosphamide-Adriamycin-vincristine-prednisone, by CDDO by a factor of at least 10. Our group has already reported that CDDO can induce apoptosis in leukemia cell lines and primary AML samples, in part, through down-regulation of Bcl-2 (38). GADD153 is a member of the C/EBPα family of transcription factors and is transcriptionally activated by a variety of growth arrest and/or damaging factors (72). Several chemotherapeutic drugs induce GADD153 expression and apoptosis. The expression of GADD153, in turn, induces growth arrest and apoptosis in M1 myeloblastic leukemia cells (72), neuroblastoma (73), and hepatoma cells (74). Recently, GADD153 was reported to down-regulate Bcl-2, thereby sensitizing cells to endoplasmic reticulum stress (75). The induction of GADD153 in breast cancer cell lines by CDDO and its potential link to Bcl-2 down-regulation requires additional investigation.

Other proteins encoded by CDDO targeted genes are already known to be regulated by PPARγ. These include members of the C/EBP transcription factor family and proteins involved in lipid metabolism. Of the six C/EBP proteins, C/EBPβ and C/EBPδ play an important functional role in the mammary gland. C/EBPδ appears to be most important for growth arrest and apoptosis, whereas C/EBPβ is necessary for growth and differentiation (76). PPARγ, C/EBPβ, C/EBPδ, and later C/EBPα appear to be involved in the adipocytic differentiation program (77). In our experiments, CDDO induced the expression of C/EBPβ and C/EBPγ mRNA, an effect even more pronounced in MCF-7 cells in which adipocyte-like differentiation was observed (7).

In conclusion, our data provide the first evidence that CDDO, a PPARγ ligand, induces cell growth inhibition, cell cycle arrest, and apoptosis by targeting important genes involved in human breast carcinogenesis. Cyclin D1 emerges as a major target of CDDO because of the direct relationship between its overexpression and murine or human breast cancer (4, 60, 61) and because of the resistance of cyclin D1-deficient mice to mammary carcinomas induced by c-neu. In the same vein, strategies targeting insulin growth factor 1 receptor signaling may prevent or delay the development of resistance to trastuzumab, an anti-HER2 antibody used in the treatment of breast cancers overexpressing HER2 (78). We demonstrate here that CDDO decreased the expression of cyclin D1 and insulin receptor substrate 1 in all breast cancer cell lines studied, independent of their ER and HER2 status. We are currently investigating the potential effect of CDDO on the HER2 signaling pathway. We additionally established effects of CDDO on the expression of p21Waf1/CIP1, PCNA, Bcl-2, and GADD153, which are all consistent with the growth inhibition, cell cycle arrest, and induction of apoptosis observed in breast cancer cell lines. Furthermore, CDDO inhibited breast cancer growth in vivo in immunodeficient mice and our preliminary data demonstrate that CDDO is also able to abrogate growth of MCF-7/HER2 tumors in an immunodeficient xenograft model (79). In pharmacokinetic studies conducted at M. D. Anderson Cancer Center, after a single i.v. dose of CDDO at 30 mg/kg, mean peak concentrations of 2.0 ± 0.8 mg/ml were achieved (4.1 ± 1.6 μm; Ref. 80). In the study reported here, complete cytostatic and apoptotic effects were achieved in vitro at 1 μm CDDO, suggesting that effective concentrations can be achieved in vivo. These collective findings show the potential value of PPARγ ligation by CDDO as novel treatment strategy in human breast cancer.

Fig. 1.

PPARγ expression in human breast cancer cell lines analyzed by Western blot. Total protein extract from the indicated cell lines was analyzed using a monoclonal antibody against human PPARγ.

Fig. 1.

PPARγ expression in human breast cancer cell lines analyzed by Western blot. Total protein extract from the indicated cell lines was analyzed using a monoclonal antibody against human PPARγ.

Close modal
Fig. 2.

Activation of the PPRE by CDDO. CDDO activates the PPRE reporter in MDA-MB-231, MDA-MB-435, and MCF-7 cell lines. The cells were transfected with the PPRE x3-TK-LUC reporter (300 ng/105 cells) for 24 h followed by 24 h treatment with CDDO (2 μm) or vehicle. Normalized luciferase activity was determined and is shown as the fold activation relative to results in vehicle-treated cells.

Fig. 2.

Activation of the PPRE by CDDO. CDDO activates the PPRE reporter in MDA-MB-231, MDA-MB-435, and MCF-7 cell lines. The cells were transfected with the PPRE x3-TK-LUC reporter (300 ng/105 cells) for 24 h followed by 24 h treatment with CDDO (2 μm) or vehicle. Normalized luciferase activity was determined and is shown as the fold activation relative to results in vehicle-treated cells.

Close modal
Fig. 3.

A, inhibition of cell growth by CDDO in MDA-MB-435, MDA-MB-231, and MCF-7 breast cancer cell lines. MDA-MB-231 (a), MCF-7 (b), and MDA-MB-435 (c) cells were incubated with different concentrations (0.1, 0.5, 1, and 10 μm) of CDDO or DMSO for 24, 48, and 72 h. The effect on cell growth was determined by cell counts. One μm CDDO exerts a fully cytostatic effect. B, MCF-7 cells were transfected with pEGFP vector or pEGFP-PPARγ1. The fusion protein was detected at Mr 80,000 as shown by Western blot using anti-PPARγ antibody. The effect on cell growth was determined by cell counts. CDDO was more effective in PPARγ-overexpressing cells.

Fig. 3.

A, inhibition of cell growth by CDDO in MDA-MB-435, MDA-MB-231, and MCF-7 breast cancer cell lines. MDA-MB-231 (a), MCF-7 (b), and MDA-MB-435 (c) cells were incubated with different concentrations (0.1, 0.5, 1, and 10 μm) of CDDO or DMSO for 24, 48, and 72 h. The effect on cell growth was determined by cell counts. One μm CDDO exerts a fully cytostatic effect. B, MCF-7 cells were transfected with pEGFP vector or pEGFP-PPARγ1. The fusion protein was detected at Mr 80,000 as shown by Western blot using anti-PPARγ antibody. The effect on cell growth was determined by cell counts. CDDO was more effective in PPARγ-overexpressing cells.

Close modal
Fig. 4.

CDDO induction of cell cycle arrest in MDA-MB 435, MDA-MB-231, and MCF-7 breast cancer cell lines. The percentages of cells in each phase of the cell cycle was determined by double fluorescence BrdUrd/PI fluorescence-activated cell sorting analysis of samples of 10,000 cells each. For each time point, a negative control without BrdUrd incorporation was analyzed and defined background positivity, which is represented by a line on the images. CDDO inhibited proliferation in all three cell lines, as shown by a drastic decrease of cells in S phase and an accumulation in G2-M.

Fig. 4.

CDDO induction of cell cycle arrest in MDA-MB 435, MDA-MB-231, and MCF-7 breast cancer cell lines. The percentages of cells in each phase of the cell cycle was determined by double fluorescence BrdUrd/PI fluorescence-activated cell sorting analysis of samples of 10,000 cells each. For each time point, a negative control without BrdUrd incorporation was analyzed and defined background positivity, which is represented by a line on the images. CDDO inhibited proliferation in all three cell lines, as shown by a drastic decrease of cells in S phase and an accumulation in G2-M.

Close modal
Fig. 5.

Induction of apoptosis and a decrease in the ΔΨm in human breast cancer cell lines by CDDO. Results are shown for MDA-MB-231 cells. Cells were grown in the presence of 1 μm CDDO or vehicle for 72 h. A, apoptosis was measured by staining with FITC-labeled Annexin V, which binds to phosphatidylserine with high affinity. Cells with positivity for Annexin V and excluding PI are apoptotic (bottom right quadrant); double positive cells have undergone secondary necrosis (top right panel). B, the CMXRos assay was performed to evaluate the ΔΨm and shows CDDO-induced loss of ΔΨm.

Fig. 5.

Induction of apoptosis and a decrease in the ΔΨm in human breast cancer cell lines by CDDO. Results are shown for MDA-MB-231 cells. Cells were grown in the presence of 1 μm CDDO or vehicle for 72 h. A, apoptosis was measured by staining with FITC-labeled Annexin V, which binds to phosphatidylserine with high affinity. Cells with positivity for Annexin V and excluding PI are apoptotic (bottom right quadrant); double positive cells have undergone secondary necrosis (top right panel). B, the CMXRos assay was performed to evaluate the ΔΨm and shows CDDO-induced loss of ΔΨm.

Close modal
Fig. 6.

Microarray and real-time PCR: differential expression of a cyclin D1 and P21WAF1/CIP1 in MCF-7 cells treated with CDDO. Cells were grown in the presence of 2 μm CDDO or vehicle for 16 h and analyzed by Affymetrix microarrays and real-time PCR. The cyclin D1 and P21Waf1/CIP1 probe sets were composed of 16 probe pairs. A perfect match (p.m.) and mismatch (MM) form each probe pair, and the intensity of the expression of each probe pair was detected. The figure shows changes in intensity for both genes in the presence of CDDO or vehicle alone. The 7-fold down-regulation of cyclin D1 mRNA and the 6.5-fold up-regulation of P21Waf1/CIP1 mRNA found by microarray analysis were confirmed by real-time PCR, which showed 6- and 21-fold changes, respectively.

Fig. 6.

Microarray and real-time PCR: differential expression of a cyclin D1 and P21WAF1/CIP1 in MCF-7 cells treated with CDDO. Cells were grown in the presence of 2 μm CDDO or vehicle for 16 h and analyzed by Affymetrix microarrays and real-time PCR. The cyclin D1 and P21Waf1/CIP1 probe sets were composed of 16 probe pairs. A perfect match (p.m.) and mismatch (MM) form each probe pair, and the intensity of the expression of each probe pair was detected. The figure shows changes in intensity for both genes in the presence of CDDO or vehicle alone. The 7-fold down-regulation of cyclin D1 mRNA and the 6.5-fold up-regulation of P21Waf1/CIP1 mRNA found by microarray analysis were confirmed by real-time PCR, which showed 6- and 21-fold changes, respectively.

Close modal
Fig. 7.

Time-dependent increase in p21Waf1/CIP1 mRNA expression induced by CDDO (1 μm). Sample results in MDA-MB-231 cells. Cells were collected after 24, 48, and 72 h of treatment with CDDO (1 μm) or vehicle alone. RNA extraction and real-time PCR were performed for each time point. The curves depict the differential expression in untreated (DMSO) and CDDO-treated cells. Each sample was normalized to BMG, and results were expressed as FC. In MDA-MB-231 cells, p21Waf1/CIP1 mRNA expression was up-regulated 21-fold at 24 h, 34-fold at 48 h, and 49-fold at 72 h.

Fig. 7.

Time-dependent increase in p21Waf1/CIP1 mRNA expression induced by CDDO (1 μm). Sample results in MDA-MB-231 cells. Cells were collected after 24, 48, and 72 h of treatment with CDDO (1 μm) or vehicle alone. RNA extraction and real-time PCR were performed for each time point. The curves depict the differential expression in untreated (DMSO) and CDDO-treated cells. Each sample was normalized to BMG, and results were expressed as FC. In MDA-MB-231 cells, p21Waf1/CIP1 mRNA expression was up-regulated 21-fold at 24 h, 34-fold at 48 h, and 49-fold at 72 h.

Close modal
Fig. 8.

Expression of cyclin D1, CDK2, CDK4, P21Waf1/CIP1, and p27KIP1 in breast cancer cell lines in the presence of 1 μm CDDO, determined by Western blot analysis. MDA-MB-435 and MCF-7 cells were exposed to 1 μm CDDO or vehicle and were collected at 24, 48, and 72 h. Each sample was processed for Western blotting as described in “Materials and Methods.” Western blot analysis confirmed results shown by microarray and real-time PCR at the protein level with down-regulation of cyclin D1 and up-regulation of p21Waf1/CIP1. Of interest, the expression of p27KIP1 appeared to increase 2-fold. The expression levels of the CDK2 and CDK4 kinases were constant during the entire experiment.

Fig. 8.

Expression of cyclin D1, CDK2, CDK4, P21Waf1/CIP1, and p27KIP1 in breast cancer cell lines in the presence of 1 μm CDDO, determined by Western blot analysis. MDA-MB-435 and MCF-7 cells were exposed to 1 μm CDDO or vehicle and were collected at 24, 48, and 72 h. Each sample was processed for Western blotting as described in “Materials and Methods.” Western blot analysis confirmed results shown by microarray and real-time PCR at the protein level with down-regulation of cyclin D1 and up-regulation of p21Waf1/CIP1. Of interest, the expression of p27KIP1 appeared to increase 2-fold. The expression levels of the CDK2 and CDK4 kinases were constant during the entire experiment.

Close modal
Fig. 9.

Growth inhibition of T-47D breast cancer cells with constitutive cyclin D1 overexpression. Western blot showed 5-fold increased expression of cyclin D1 in T-47D-cyclin D1 17-1 compared with control (T-47D-empty) cells. Cells were incubated with different concentrations (0.1, 0.5, and 1 μm) of CDDO or DMSO for 24, 48, and 72 h. The bar graphs show normalized growth inhibition as determined by cell counts. Effects of CDDO on cyclin D1 expression were analyzed by Western blot (0.5 μm CDDO, 72 h).

Fig. 9.

Growth inhibition of T-47D breast cancer cells with constitutive cyclin D1 overexpression. Western blot showed 5-fold increased expression of cyclin D1 in T-47D-cyclin D1 17-1 compared with control (T-47D-empty) cells. Cells were incubated with different concentrations (0.1, 0.5, and 1 μm) of CDDO or DMSO for 24, 48, and 72 h. The bar graphs show normalized growth inhibition as determined by cell counts. Effects of CDDO on cyclin D1 expression were analyzed by Western blot (0.5 μm CDDO, 72 h).

Close modal
Fig. 10.

Effect of CDDO on growth inhibition and cell cycle distribution of parental and p21Waf1/CIP1-knockout HCT116 cells. Bar graphs demonstrate the relative growth inhibition at 72 h, as determined by cell counts. The expression of p21Waf1/CIP1 was determined by Western blot analysis; tubulin expression was used as loading control. The percentages of cells in each phase of the cell cycle were calculated by double fluorescence BrdUrd/PI fluorescence-activated cell sorting analysis. CDDO inhibited proliferation in the parental cell line, as shown by a decrease in cells in the S phase and an accumulation in G2-M but not in HCT116 p21Waf1/CIP1−/− cells.

Fig. 10.

Effect of CDDO on growth inhibition and cell cycle distribution of parental and p21Waf1/CIP1-knockout HCT116 cells. Bar graphs demonstrate the relative growth inhibition at 72 h, as determined by cell counts. The expression of p21Waf1/CIP1 was determined by Western blot analysis; tubulin expression was used as loading control. The percentages of cells in each phase of the cell cycle were calculated by double fluorescence BrdUrd/PI fluorescence-activated cell sorting analysis. CDDO inhibited proliferation in the parental cell line, as shown by a decrease in cells in the S phase and an accumulation in G2-M but not in HCT116 p21Waf1/CIP1−/− cells.

Close modal
Fig. 11.

Effect of CDDO on breast cancer in vivo. Female nude immunodeficient mice (n = 25) were inoculated s.c. with 2 × 106 MDA-MB-435 cells/mouse. Ten days after inoculation, 10 mice were treated with CDDO (40 mg/kg i.v. twice a week for 3 weeks). Fifteen mice received vehicle only. The tumor was measured twice weekly with microcalipers, and the tumor volume was calculated as the length × width (in millimeters). Results demonstrate a statistically significant reduction in tumor growth in the treated group compared with the vehicle group (P = 0.013).

Fig. 11.

Effect of CDDO on breast cancer in vivo. Female nude immunodeficient mice (n = 25) were inoculated s.c. with 2 × 106 MDA-MB-435 cells/mouse. Ten days after inoculation, 10 mice were treated with CDDO (40 mg/kg i.v. twice a week for 3 weeks). Fifteen mice received vehicle only. The tumor was measured twice weekly with microcalipers, and the tumor volume was calculated as the length × width (in millimeters). Results demonstrate a statistically significant reduction in tumor growth in the treated group compared with the vehicle group (P = 0.013).

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

Supported by grants from the NIH Grants PO1 CA55164, PO1 CA49639, CA16672, and RO1 CA89346 and the Stringer Professorship for Cancer Treatment and Research (to M. A.) and the Leukemia and Lymphoma Society Grant CF02-007 (to M. K.). H. L. was partially supported by the Philippe Foundation. R. L. S. is supported by grants from the National Health and Medical Research Council of Australia, The Cancer Council New South Wales, and the United States Army Breast Cancer Research Program Grant DAMDI 7-99-1-9184.

4

The abbreviations used are: HER2, human epidermal growth factor receptor 2; PPARγ, peroxisome proliferator-activated receptor γ; PPRE, PPARγ response element; CDDO, 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid ; BrdUrd, bromodeoxyuridine; PI, propidium iodide; Δψm, mitochondrial membrane potential; HRP, horseradish peroxidase; CMXRos, cationic lipophilic dye chlorophenyl-X-rosamine; BMG, β2-microglobulin; FC, fold change; ER, estrogen receptor; RLU, relative light unit; PCNA, proliferating cellular nuclear antigen; C/EBP, CAAT/enhancer binding protein; CDK, cyclin-dependent kinase.

5

Internet address: http://www.netaffx.com.

Table 1

Oligonucleotide and probe sequences used for quantitative real-time PCR

Oligonucleotide sequence (5′–3′)  
Cyclin D1 FP TCCATCCGGCCCGAG 
Cyclin D1 RP GAGCTTGTTCACCAGGAGCAG 
Cyclin D2 FP CTACATGCGCAGAATGGTGG 
Cyclin D2 RP AGCACCCAGGAGTTGCAGAT 
Cyclin E FP CCCATCCTTCTCCACCAAAG 
Cyclin E RP CCCTGTTTGATGCCATCCAC 
P21Waf1/CIP1 FP CGCTAATGGCGGGCTG 
P21Waf1/CIP1 RP CGGTGACAAAGTCGAAGTTCC 
P27KIP1 FP GAGGACACGCATTTGGTGG 
P27KIP1 RP GCTCCTCTAACCCCGTCT 
PPARγ FP GGCTTCATGACAAGGGAGTTTC 
PPARγ RP AACTCAAACTTGGGCTCCATAAAG 
 β2MG FP AGCTGTGCTCGCGCTACTCT 
 β2MG RP TTGACTTTCCATTCTCTGCTGG 
Probe sequence 5′(FAM)-(TAMRA)3′  
Cyclin D1 probe CTGCTGCAAATGGA 
Cyclin D2 probe TGTGAGGAACAGAAGTGCGAAGAAGAGGTC 
Cyclin E probe AGTTGCGCGCCTGCTCCACG 
P21Waf1/CIP1 probe ATCCAGGAGGCCCGTGAGCGA 
P27KIP1 probe CCCAAAGACTGATCCGTCGGACAGC 
PPARγ probe AAAGAGCCTGCGAAAGCCTTTTGGTG 
 β2MG probe TCTTTCTGGCCTGGAGGGCATCC 
Oligonucleotide sequence (5′–3′)  
Cyclin D1 FP TCCATCCGGCCCGAG 
Cyclin D1 RP GAGCTTGTTCACCAGGAGCAG 
Cyclin D2 FP CTACATGCGCAGAATGGTGG 
Cyclin D2 RP AGCACCCAGGAGTTGCAGAT 
Cyclin E FP CCCATCCTTCTCCACCAAAG 
Cyclin E RP CCCTGTTTGATGCCATCCAC 
P21Waf1/CIP1 FP CGCTAATGGCGGGCTG 
P21Waf1/CIP1 RP CGGTGACAAAGTCGAAGTTCC 
P27KIP1 FP GAGGACACGCATTTGGTGG 
P27KIP1 RP GCTCCTCTAACCCCGTCT 
PPARγ FP GGCTTCATGACAAGGGAGTTTC 
PPARγ RP AACTCAAACTTGGGCTCCATAAAG 
 β2MG FP AGCTGTGCTCGCGCTACTCT 
 β2MG RP TTGACTTTCCATTCTCTGCTGG 
Probe sequence 5′(FAM)-(TAMRA)3′  
Cyclin D1 probe CTGCTGCAAATGGA 
Cyclin D2 probe TGTGAGGAACAGAAGTGCGAAGAAGAGGTC 
Cyclin E probe AGTTGCGCGCCTGCTCCACG 
P21Waf1/CIP1 probe ATCCAGGAGGCCCGTGAGCGA 
P27KIP1 probe CCCAAAGACTGATCCGTCGGACAGC 
PPARγ probe AAAGAGCCTGCGAAAGCCTTTTGGTG 
 β2MG probe TCTTTCTGGCCTGGAGGGCATCC 

FP: forward primer; RP: reverse primer.

Table 2

Summary of genes down-regulated in both MDA-MB-435 and MCF-7 cells after exposure to CDDO (16 h, 2 μm)

GenBank accession no.FC MCF-7 cellsGene nameFC in MDA-MB-435 cells
Cell cycle    
 X59798 −7.0 Cyclin D1 −3.1 
 Z36714 −2.0 Cyclin F −3.3 
 M15796 −3.3 Proliferating cell nuclear antigen −2.3 
Transcription    
 Z97630 −5.7 H1 histone family member 0 −26.3 
 D64142 −4.8 H1 histone family member X −10.2 
 Z83738 −4.8 H2B histone family member E −2.6 
 AA255502 −2.0 H4 histone family member G −2.3 
 AL037557 −2.7 Polymerase (RNA) II (DNA directed) polypeptide I −2.3 
 X75755 −3.4 Splicing factor arginine/serine-rich 2 −2.1 
 AJ245416 −2.9 U6 snRNA-associated Sm-like protein −2.6 
 X79865 −2.9 Mitochondrial ribosomal protein L12 −2.6 
Apoptosis    
 S81914 −5.1 Immediate early response 3, IEX-1 −3.4 
 Y07846 −2.0 GAS2-related on chromosome 22 −2.3 
Oncogene    
 V00568 −5.7 v-myc avian myelocytomatosis viral oncogene −2.5 
 AB019527 −2.2 Leucine zipper down-regulated in cancer 1 −2.0 
Transporter    
 U81375 −5.6 Solute carrier family 29 member 1 −2.0 
 D38076 −2.1 RAN binding protein 1 −2.5 
Transcription factor    
 AL109701 −2.3 CREBBP/EP300 inhibitory protein 1 −2.2 
 L23959 −2.6 Transcription factor Dp-1 −2.0 
 AA845349 −2.6 Thyroid hormone receptor interactor 7 −3.9 
Cytoskeleton/cell adhesion    
 J00314 −3.0 Tubulin beta polypeptide −4.1 
 X02344 −2.1 Tubulin beta 2 −2.1 
 M94362 −2.6 Lamin B2 −2.0 
 L37747 −2.2 Lamin B1 −3.4 
 U53204 −2.4 Plectin 1 intermediate filament binding protein 500kD −5.3 
Metabolism    
 Y09008 −2.7 Uracil-DNA glycosylase −3.1 
 U31930 −2.2 dUTP pyrophosphatase −2.8 
 M36067 −2.1 Ligase I DNA ATP-dependent −2.8 
 J04031 −3.4 Methylenetetrahydrofolate dehydrogenase −2.4 
 D78586 −2.7 Carbamoyl-phosphate synthetase 2 −2.1 
 U84371 −2.3 Adenylate kinase 2 −2.0 
 AF014398 −2.8 Inositol(myo)-1(or 4)-monophosphatase 2 −4.4 
 M21154 −2.2 S-adenosylmethionine decarboxylase 1 −2.8 
 D63391 −2.1 Platelet-activating factor acetylhydrolase isoform Ib gamma −2.9 
Lipid metabolism    
 AF034544 −2.0 7-dehydrocholesterol reductase −2.5 
 L00352 −3.0 Human LDL receptor −3.0 
 AI557240 −2.6 Diazepam binding inhibitor −2.2 
Signal transduction    
 S62539 −8.2 Insulin receptor substrate 1 −7.7 
 M62403 −2.1 Insulin-like growth factor-binding protein 4 −3.1 
Others    
 D50914 −2.2 Block of proliferation 1 −2.0 
 X57351 −2.0 Interferon induced transmembrane protein 2 (1–8D) −2.1 
GenBank accession no.FC MCF-7 cellsGene nameFC in MDA-MB-435 cells
Cell cycle    
 X59798 −7.0 Cyclin D1 −3.1 
 Z36714 −2.0 Cyclin F −3.3 
 M15796 −3.3 Proliferating cell nuclear antigen −2.3 
Transcription    
 Z97630 −5.7 H1 histone family member 0 −26.3 
 D64142 −4.8 H1 histone family member X −10.2 
 Z83738 −4.8 H2B histone family member E −2.6 
 AA255502 −2.0 H4 histone family member G −2.3 
 AL037557 −2.7 Polymerase (RNA) II (DNA directed) polypeptide I −2.3 
 X75755 −3.4 Splicing factor arginine/serine-rich 2 −2.1 
 AJ245416 −2.9 U6 snRNA-associated Sm-like protein −2.6 
 X79865 −2.9 Mitochondrial ribosomal protein L12 −2.6 
Apoptosis    
 S81914 −5.1 Immediate early response 3, IEX-1 −3.4 
 Y07846 −2.0 GAS2-related on chromosome 22 −2.3 
Oncogene    
 V00568 −5.7 v-myc avian myelocytomatosis viral oncogene −2.5 
 AB019527 −2.2 Leucine zipper down-regulated in cancer 1 −2.0 
Transporter    
 U81375 −5.6 Solute carrier family 29 member 1 −2.0 
 D38076 −2.1 RAN binding protein 1 −2.5 
Transcription factor    
 AL109701 −2.3 CREBBP/EP300 inhibitory protein 1 −2.2 
 L23959 −2.6 Transcription factor Dp-1 −2.0 
 AA845349 −2.6 Thyroid hormone receptor interactor 7 −3.9 
Cytoskeleton/cell adhesion    
 J00314 −3.0 Tubulin beta polypeptide −4.1 
 X02344 −2.1 Tubulin beta 2 −2.1 
 M94362 −2.6 Lamin B2 −2.0 
 L37747 −2.2 Lamin B1 −3.4 
 U53204 −2.4 Plectin 1 intermediate filament binding protein 500kD −5.3 
Metabolism    
 Y09008 −2.7 Uracil-DNA glycosylase −3.1 
 U31930 −2.2 dUTP pyrophosphatase −2.8 
 M36067 −2.1 Ligase I DNA ATP-dependent −2.8 
 J04031 −3.4 Methylenetetrahydrofolate dehydrogenase −2.4 
 D78586 −2.7 Carbamoyl-phosphate synthetase 2 −2.1 
 U84371 −2.3 Adenylate kinase 2 −2.0 
 AF014398 −2.8 Inositol(myo)-1(or 4)-monophosphatase 2 −4.4 
 M21154 −2.2 S-adenosylmethionine decarboxylase 1 −2.8 
 D63391 −2.1 Platelet-activating factor acetylhydrolase isoform Ib gamma −2.9 
Lipid metabolism    
 AF034544 −2.0 7-dehydrocholesterol reductase −2.5 
 L00352 −3.0 Human LDL receptor −3.0 
 AI557240 −2.6 Diazepam binding inhibitor −2.2 
Signal transduction    
 S62539 −8.2 Insulin receptor substrate 1 −7.7 
 M62403 −2.1 Insulin-like growth factor-binding protein 4 −3.1 
Others    
 D50914 −2.2 Block of proliferation 1 −2.0 
 X57351 −2.0 Interferon induced transmembrane protein 2 (1–8D) −2.1 
Table 3

Summary of genes up-regulated in both MDA-MB-435 and MCF-7 cells after exposure to CDDO (16 h, 2 μm)

GenBank accession no.FC in MCF-7Gene nameFC in MDA-MB-435
Cell cycle    
 U03106 6.5 Cyclin-dependent kinase inhibitor 1A (p21 Cip1) 2.0 
 L29219 3.4 CDC-like kinase 1 3.8 
 U61836 2.3 Putative cyclin G1 partial sequence 2.2 
Transcription/translation    
 U49436 2.1 Eukaryotic translation initiation factor 5, elf5 2.8 
Apoptosis    
 AI670788 2.0 Modulator of apoptosis 1 2.4 
Transporter    
 U70322 2.8 Karyopherin (importin) beta 2 2.1 
 W28281 17.8 GABA(A) receptor-associated protein like 1 8.1 
 U83460 2.0 Solute carrier family 31 (copper transporters) member 1 2.6 
 AB002311 4.4 PDZ domain containing guanine nucleotide exchange factor(GEF) 1 4.7 
Transcription factor    
 S62138 24.0 TLS/CHOP, Gadd153 member of the C/EBP transcription factor 11.1 
 X52560 5.5 CCAAT/enhancer binding protein (C/EBP) beta 2.0 
 U20240 4.6 CCAAT/enhancer binding protein (C/EBP) gamma 2.4 
 X64318 6.1 E4bp4, a member of the basic region/leucine zipper (bZIP) TF 2.1 
 S68271 4.8 cAMP responsive element modulator=CREM 5.6 
 AF096870 6.8 Estrogen-responsive B box protein=B box zinc finger protein family 8.5 
 M92843 2.4 Zinc finger protein homologous to Zfp-36 in mouse 3.0 
 AL050162 24.0 Testis derived transcript (3 LIM domains) 3.9 
 AF012108 2.0 Nuclear receptor coactivator 3, steroid receptor 2.2 
Cytoskeleton/cell adhesion    
 L78132 6.6 Lectin galactoside-binding soluble 8 (galectin 8) 2.8 
 W28807 4.6 Microtubule-associated proteins 1A/1B light chain 3 3.1 
 U32315 4.6 Syntaxin 3A 6.6 
 U26648 4.1 Syntaxin 5A 2.7 
Metabolism    
 Z82244 137.4 Heme oxygenase (decycling) 1 25.8 
 L35546 9.4 Glutamate-cysteine ligase modifier subunit 4.8 
 M90656 4.2 Glutamate-cysteine ligase catalytic subunit 2.5 
 U43944 4.3 Malic enzyme 1 NADP(+)-dependent cytosolic 2.0 
 AL049417 3.5 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) 2.3 
 AF061016 3.2 UDP-glucose dehydrogenase 3.6 
 X91247 2.7 Thioredoxin reductase 1 3.6 
 X54326 2.6 Glutamyl-prolyl-tRNA synthetase 2.0 
 M90516 2.4 Glutamine-fructose-6-phosphate transaminase 1 4.9 
 M77693 2.1 Spermidine/spermine N1-acetyltransferase 3.9 
Signal transduction    
 Y07566 6.2 Ric (Drosophila)-like expressed in many tissues, Ras-like GTPases 5.1 
 AC005192 5.9 Interferon-related developmental regulator 1 2.0 
 X68277 2.5 Dual specificity phosphatase 1 3.5 
 J03805 2.1 Protein phosphatase 2 (formerly 2A) catalytic subunit beta isoform 2.3 
 X80692 3.3 Mitogen-activated protein kinase 6 2.2 
Proteolysis, ubiquitin-proteasome pathway    
 Z29331 3.4 Ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8) 2.4 
 AF055001  Homocsleine-inducible endoplasmic reticulum stress-inducible ubiquitin-like domain member 1 4.7 
 U46751 2.9 Sequestosome 1, ubiquitin-binding protein sequestosome 1 2.8 
 AF012086 2.9 RAN binding protein 2-like 1 2.2 
Heat shock protein    
 D63861 2.6 Peptidylprolyl isomerase D (cyclophilin D)=heat shock40 2.3 
 L15189 2.4 Heat shock 70kD protein 9B (mortalin-2) 2.3 
 X87949 2.3 Heat shock 70kD protein 5 (glucose-regulated protein 78kD) 3.0 
 M11717 2.0 Heat shock 70 kD protein 1A 19.6 
 L08069 2.2 DnaJ (Hsp40) homolog subfamily A member 1 3.3 
 D85429 2.0 DnaJ (Hsp40) homolog subfamily B member 1 6.0 
Others    
 AF002020 3.0 Niemann-Pick disease type C1 2.0 
 U78027 2.7 Bruton agammaglobulinemia tyrosine kinase 3.3 
 AF039103 2.7 HIV-1 Tat interactive protein 2 30 kDa 2.3 
GenBank accession no.FC in MCF-7Gene nameFC in MDA-MB-435
Cell cycle    
 U03106 6.5 Cyclin-dependent kinase inhibitor 1A (p21 Cip1) 2.0 
 L29219 3.4 CDC-like kinase 1 3.8 
 U61836 2.3 Putative cyclin G1 partial sequence 2.2 
Transcription/translation    
 U49436 2.1 Eukaryotic translation initiation factor 5, elf5 2.8 
Apoptosis    
 AI670788 2.0 Modulator of apoptosis 1 2.4 
Transporter    
 U70322 2.8 Karyopherin (importin) beta 2 2.1 
 W28281 17.8 GABA(A) receptor-associated protein like 1 8.1 
 U83460 2.0 Solute carrier family 31 (copper transporters) member 1 2.6 
 AB002311 4.4 PDZ domain containing guanine nucleotide exchange factor(GEF) 1 4.7 
Transcription factor    
 S62138 24.0 TLS/CHOP, Gadd153 member of the C/EBP transcription factor 11.1 
 X52560 5.5 CCAAT/enhancer binding protein (C/EBP) beta 2.0 
 U20240 4.6 CCAAT/enhancer binding protein (C/EBP) gamma 2.4 
 X64318 6.1 E4bp4, a member of the basic region/leucine zipper (bZIP) TF 2.1 
 S68271 4.8 cAMP responsive element modulator=CREM 5.6 
 AF096870 6.8 Estrogen-responsive B box protein=B box zinc finger protein family 8.5 
 M92843 2.4 Zinc finger protein homologous to Zfp-36 in mouse 3.0 
 AL050162 24.0 Testis derived transcript (3 LIM domains) 3.9 
 AF012108 2.0 Nuclear receptor coactivator 3, steroid receptor 2.2 
Cytoskeleton/cell adhesion    
 L78132 6.6 Lectin galactoside-binding soluble 8 (galectin 8) 2.8 
 W28807 4.6 Microtubule-associated proteins 1A/1B light chain 3 3.1 
 U32315 4.6 Syntaxin 3A 6.6 
 U26648 4.1 Syntaxin 5A 2.7 
Metabolism    
 Z82244 137.4 Heme oxygenase (decycling) 1 25.8 
 L35546 9.4 Glutamate-cysteine ligase modifier subunit 4.8 
 M90656 4.2 Glutamate-cysteine ligase catalytic subunit 2.5 
 U43944 4.3 Malic enzyme 1 NADP(+)-dependent cytosolic 2.0 
 AL049417 3.5 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) 2.3 
 AF061016 3.2 UDP-glucose dehydrogenase 3.6 
 X91247 2.7 Thioredoxin reductase 1 3.6 
 X54326 2.6 Glutamyl-prolyl-tRNA synthetase 2.0 
 M90516 2.4 Glutamine-fructose-6-phosphate transaminase 1 4.9 
 M77693 2.1 Spermidine/spermine N1-acetyltransferase 3.9 
Signal transduction    
 Y07566 6.2 Ric (Drosophila)-like expressed in many tissues, Ras-like GTPases 5.1 
 AC005192 5.9 Interferon-related developmental regulator 1 2.0 
 X68277 2.5 Dual specificity phosphatase 1 3.5 
 J03805 2.1 Protein phosphatase 2 (formerly 2A) catalytic subunit beta isoform 2.3 
 X80692 3.3 Mitogen-activated protein kinase 6 2.2 
Proteolysis, ubiquitin-proteasome pathway    
 Z29331 3.4 Ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8) 2.4 
 AF055001  Homocsleine-inducible endoplasmic reticulum stress-inducible ubiquitin-like domain member 1 4.7 
 U46751 2.9 Sequestosome 1, ubiquitin-binding protein sequestosome 1 2.8 
 AF012086 2.9 RAN binding protein 2-like 1 2.2 
Heat shock protein    
 D63861 2.6 Peptidylprolyl isomerase D (cyclophilin D)=heat shock40 2.3 
 L15189 2.4 Heat shock 70kD protein 9B (mortalin-2) 2.3 
 X87949 2.3 Heat shock 70kD protein 5 (glucose-regulated protein 78kD) 3.0 
 M11717 2.0 Heat shock 70 kD protein 1A 19.6 
 L08069 2.2 DnaJ (Hsp40) homolog subfamily A member 1 3.3 
 D85429 2.0 DnaJ (Hsp40) homolog subfamily B member 1 6.0 
Others    
 AF002020 3.0 Niemann-Pick disease type C1 2.0 
 U78027 2.7 Bruton agammaglobulinemia tyrosine kinase 3.3 
 AF039103 2.7 HIV-1 Tat interactive protein 2 30 kDa 2.3 
Table 4

Differential expression by real-time PCR of genes identified by cDNA arrays in MDA-MB-435 and MCF-7 cellsa

GeneMDA-MB-435 cell lineMCF-7 cell line
DMSO2 μm CDDODMSO2 μm CDDO
Cyclin D1 1/13 1/6 
Cyclin E ×1.3 1/1.9 
p21              Waf1/CIP1 ×4 ×21 
p27              KIP1 ×1 1/1.8 
Bcl-2 1/1.3 1/20 
GeneMDA-MB-435 cell lineMCF-7 cell line
DMSO2 μm CDDODMSO2 μm CDDO
Cyclin D1 1/13 1/6 
Cyclin E ×1.3 1/1.9 
p21              Waf1/CIP1 ×4 ×21 
p27              KIP1 ×1 1/1.8 
Bcl-2 1/1.3 1/20 
a

Cells were exposed to 2 μm CDDO or vehicle for 16 h. mRNA expression was quantified as described in “Materials and Methods.” The mRNA expression of each gene in the presence of DMSO was considered the reference value and is denoted by “1” in the table. The mRNA expression in the presence of CDDO is that in comparison with this reference value. Cyclin D1 mRNA was down-regulated, and p21Waf1/CIP1 was up-regulated in both cell lines; Bcl-2 was down-regulated only in MCF-7 cells.

Table 5

Differential expression of cyclin D1, cyclin E, p21Waf1/CIP1, p27KIP1, Bcl-2, and PPARγ mRNA shown by real-time PCR in MCF-7, MDA-MB-435, and MDA-MB- 231 cells at 24, 48, and 72 h in the presence of 1 μm CDDO or vehiclea

Cell lineCyclin D1Cyclin Ep21Waf1p27KIP1Bcl-2PPARγ
MCF-7       
 24 h /2.5  ×17  /2.8 ×2.26 
 48 h /5  ×40  /3.35 ×7 
 72 h   ×43 ×3.4  ×7.43 
MDA-MB-435       
 24 h   ×33   ×2.9 
 48 h /17 ×2.64 ×51   ×28 
 72 h ×2.18  ×62  /2.68 ×36 
MDA-MB-231       
 24 h   ×21   /2.56 
 48 h  ×2.43 ×34    
 72 h /7.9 ×4.40 ×49 ×2.74   
Cell lineCyclin D1Cyclin Ep21Waf1p27KIP1Bcl-2PPARγ
MCF-7       
 24 h /2.5  ×17  /2.8 ×2.26 
 48 h /5  ×40  /3.35 ×7 
 72 h   ×43 ×3.4  ×7.43 
MDA-MB-435       
 24 h   ×33   ×2.9 
 48 h /17 ×2.64 ×51   ×28 
 72 h ×2.18  ×62  /2.68 ×36 
MDA-MB-231       
 24 h   ×21   /2.56 
 48 h  ×2.43 ×34    
 72 h /7.9 ×4.40 ×49 ×2.74   
a

Cells were exposed to 1 μm CDDO or vehicle for 24, 48, and 72 h. mRNA expression was quantified as described in “Materials and Methods.” The expression of the mRNA of each gene of interest in the presence of CDDO was compared with that in the presence of DMSO. The table shows those differential mRNA expressions that exceeded 2-fold. Cyclin D1 mRNA was down-regulated, and p21Waf1/CIP1 was up-regulated in all three cell lines.

We thank Drs. Michael B. Sporn and Edward A. Sausville for CDDO produced under the CTEP/RAID program, Dr. Ronald M. Evans for providing the PPRE luciferase construct, Dr. Bert Vogelstein for the HCT116 p21 Waf1/CIP1 knock out cell line, and Dr. Krishna K. Chatterjee for the construct Wt-hPPARγ. We also thank Tena Horton and Rosemarie Lauzon for help in the preparation of the manuscript.

1
Hall M., Peters G. Genetic alterations of cyclins, cyclin-dependent kinases, and Cdk inhibitors in human cancer.
Adv. Cancer Res.
,
68
:
67
-108,  
1996
.
2
Greenberg P. A., Hortobagyi G. N., Smith T. L., Ziegler L. D., Frye D. K., Buzdar A. U. Long-term follow-up of patients with complete remission following combination chemotherapy for metastatic breast cancer.
J. Clin. Oncol.
,
14
:
2197
-2205,  
1996
.
3
Slamon D. J., Clark G. M., Wong S. G., Levin W. J., Ullrich A., McGuire W. L. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene.
Science (Wash. DC)
,
235
:
177
-182,  
1987
.
4
Wang T. C., Cardiff R. D., Zukerberg L., Lees E., Arnold A., Schmidt E. V. Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice.
Nature (Lond.)
,
369
:
669
-671,  
1994
.
5
Mangelsdorf D. J., Thummel C., Beato M., Herrlich P., Schutz G., Umesono K., Blumberg B., Kastner P., Mark M., Chambon P. The nuclear receptor superfamily: the second decade.
Cell
,
83
:
835
-839,  
1995
.
6
Kliewer S. A., Umesono K., Noonan D. J., Heyman R. A., Evans R. M. Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors.
Nature (Lond.)
,
358
:
771
-774,  
1992
.
7
Mueller E., Sarraf P., Tontonoz P., Evans R. M., Martin K. J., Zhang M., Fletcher C., Singer S., Spiegelman B. M. Terminal differentiation of human breast cancer through PPARγ.
Mol. Cell
,
1
:
465
-470,  
1998
.
8
Nagy L., Tontonoz P., Alvarez J. G. A., Chen H., Evans R. M. Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR-γ.
Cell
,
93
:
229
-240,  
1998
.
9
Forman B. M., Tontonoz P., Chen J., Brun R. P., Spiegelman B. M., Evans R. M. 15-Deoxy-δ12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPARγ.
Cell
,
83
:
803
-812,  
1995
.
10
Chawla A., Lazar M. A. Peroxisome proliferator and retinoid signaling pathways co-regulate preadipocyte phenotype and survival.
Proc. Natl. Acad. Sci. USA
,
91
:
1786
-1790,  
1994
.
11
Tontonoz P., Hu E., Spiegelman B. M. Stimulation of adipogenesis in fibroblasts by PPARγ2, a lipid-activated transcription factor.
Cell
,
79
:
1147
-1156,  
1994
.
12
Tontonoz P., Hu E., Graves R. A., Budavari A. I., Spiegelman B. M. mPPARγ2: tissue-specific regulator of an adipocyte enhancer.
Genes Dev.
,
8
:
1224
-1234,  
1994
.
13
Jiang C. Y., Ting A. T., Seed B. PPAR-γ agonists inhibit production of monocyte inflammatory cytokines.
Nature (Lond.)
,
391
:
82
-86,  
1998
.
14
Ricote M., Li A. C., Willson T. M., Kelly C. J., Glass C. K. The peroxisome proliferator-activated receptor-γ is a negative regulator of macrophage activation.
Nature (Lond.)
,
391
:
79
-82,  
1998
.
15
Asou H., Verbeek W., Williamson E., Elstner E., Kubota T., Kamada N., Koeffler H. P. Growth inhibition of myeloid leukemia cells by troglitazone, a ligand for peroxisome proliferator activated receptor γ, and retinoids.
Int. J. Oncol.
,
15
:
1027
-1031,  
1999
.
16
Guan Y. F., Zhang Y. H., Breyer R. M., Davis L., Breyer M. D. Expression of peroxisome proliferator-activated receptor γ (PPARγ) in human transitional bladder cancer and its role in inducing cell death.
Neoplasia
,
1
:
330
-339,  
1999
.
17
Keelan J. A., Sato T. A., Marvin K. W., Lander J., Gilmour R. S., Mitchell M. D. 15-Deoxy-δ(12,14)-prostaglandin J(2), a ligand for peroxisome proliferator-activated receptor-γ, induces apoptosis in JEG3 choriocarcinoma cells.
Biochem. Biophys. Res. Commun.
,
262
:
579
-585,  
1999
.
18
Kubota T., Koshizuka K., Williamson E. A., Asou H., Said J. W., Holden S., Miyoshi I., Koeffler H. P. Ligand for peroxisome proliferator-activated receptor γ (troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo.
Cancer Res.
,
58
:
3344
-3352,  
1998
.
19
Motomura W., Okumura T., Takahashi N., Obara T., Kohgo Y. Activation of peroxisome proliferator-activated receptor γ by troglitazone inhibits cell growth through the increase of p27Kip1 in human pancreatic carcinoma cells.
Cancer Res.
,
60
:
5558
-5564,  
2000
.
20
Nishida K., Furumatsu T., Takada I., Kawai A., Yoshida A., Kunisada T., Inoue H. Inhibition of human chondrosarcoma cell growth via apoptosis by peroxisome proliferator-activated receptor-γ.
Br. J. Cancer
,
86
:
1303
-1309,  
2002
.
21
Sarraf P., Mueller E., Jones D., King F. J., DeAngelo D. J., Partridge J. B., Holden S. A., Chen L. B., Singer S., Fletcher C., Spiegelman B. M. Differentiation and reversal of malignant changes in colon cancer through PPARγ.
Nat. Med.
,
4
:
1046
-1052,  
1998
.
22
Takahashi N., Okumura T., Motomura W., Fujimoto Y., Kawabata I., Kohgo Y. Activation of PPARγ inhibits cell growth and induces apoptosis in human gastric cancer cells.
FEBS Lett.
,
455
:
135
-139,  
1999
.
23
Tsubouchi Y., Sano H., Kawahito Y., Mukai S., Yamada R., Kohno M., Inoue K., Hla T., Kondo M. Inhibition of human lung cancer cell growth by the peroxisome proliferator-activated receptor-γ agonists through induction of apoptosis.
Biochem. Biophys. Res. Commun.
,
270
:
400
-405,  
2000
.
24
Elstner E., Muller C., Koshizuka K., Williamson E. A., Park D., Asou H., Shintaku P., Said J. W., Heber D., Koeffler H. P. Ligands for peroxisome proliferator-activated receptor γ and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice.
Proc. Natl. Acad. Sci. USA
,
95
:
8806
-8811,  
1998
.
25
Demetri G. D., Fletcher C. D., Mueller E., Sarraf P., Naujoks R., Campbell N., Spiegelman B. M., Singer S. Induction of solid tumor differentiation by the peroxisome proliferator-activated receptor-γ ligand troglitazone in patients with liposarcoma.
Proc. Natl. Acad. Sci. USA
,
96
:
3951
-3956,  
1999
.
26
Mueller E., Smith M., Sarraf P., Kroll T., Aiyer A., Kaufman D. S., Oh W., Demetri G., Figg W. D., Zhou X. P., Eng C., Spiegelman B. M., Kantoff P. W. Effects of ligand activation of peroxisome proliferator-activated receptor γ in human prostate cancer.
Proc. Natl. Acad. Sci. USA
,
97
:
10990
-10995,  
2000
.
27
Kilgore M. W., Tate P. L., Pai S., Sengoku E., Price T. M. MCF-7 and T47D human breast cancer cells contain a functional peroxisomal response.
Mol. Cell. Endocrinol.
,
129
:
229
-235,  
1997
.
28
Saez, E., Rosenfeld, J. M., Livolsi, A., Olson, P., Lombardo, E., Ispizua Belmonte, J. C., and Evans, R. M. PPARγ activation exacerbates breast tumor development. Keystone Symposia, Silverthorne, CO, Nuclear Receptor Superfamily, 124, 2002.
29
Wang C., Fu M., D’Amico M., Albanese C., Zhou J-N., Brownlee M., Lisanti M. P., Chatterjee V. K. K., Lazar M. A., Pestell R. G. Inhibition of cellular proliferation through IkB kinase-independent and peroxisome proliferator-activated receptor γ-dependent repression of cyclin D1.
Mol. Cell. Biol.
,
21
:
3057
-3070,  
2001
.
30
Fantl V., Stamp G., Andrews A., Rosewell I., Dickson C. Mice lacking cyclin D1 are small and show defects in eye and mammary gland development.
Genes Dev.
,
9
:
2364
-2372,  
1995
.
31
Sicinski P., Donaher J. L., Parker S. B., Li T., Fazeli A., Gardner H., Haslam S. Z., Bronson R. T., Elledge S. J., Weinberg R. A. Cyclin D1 provides a link between development and oncogenesis in the retina and breast.
Cell
,
82
:
621
-630,  
1995
.
32
Yu Q., Geng Y., Sicinski P. Specific protection against breast cancers by cyclin D1 ablation.
Nature (Lond.)
,
411
:
1017
-1021,  
2001
.
33
Lee M. H., Reynisdottir I., Massague J. Cloning of p57KIP2, a cyclin-dependent kinase inhibitor with unique domain structure and tissue distribution.
Genes Dev.
,
9
:
639
-649,  
1995
.
34
Pietras R. J., Poen J. C., Gallardo D., Wongvipat P. N., Lee H. J., Slamon D. J. Monoclonal antibody to HER-2/neureceptor modulates repair of radiation-induced DNA damage and enhances radiosensitivity of human breast cancer cells overexpressing this oncogene.
Cancer Res.
,
59
:
1347
-1355,  
1999
.
35
Ye D., Mendelsohn J., Fan Z. Augmentation of a humanized anti-HER2 mAb 4D5 induced growth inhibition by a human-mouse chimeric anti-EGF receptor mAb C225.
Oncogene
,
18
:
731
-738,  
1999
.
36
Wang Y., Porter W. W., Suh N., Honda T., Gribble G. W., Leesnitzer L. M., Plunket K. D., Mangelsdorf D. J., Blanchard S. G., Willson T. M., Sporn M. B. A synthetic triterpenoid, 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), is a ligand for the peroxisome proliferator-activated receptor γ.
Mol. Endocrinol.
,
14
:
1550
-1556,  
2000
.
37
Suh N., Wang Y., Honda T., Gribble G. W., Dmitrovsky E., Hickey W. F., Maue R. A., Place A. E., Porter D. M., Spinella M. J., Williams C. R., Wu G., Dannenberg A. J., Flanders K. C., Letterio J. J., Mangelsdorf D. J., Nathan C. F., Nguyen L., Porter W. W., Ren R. F., Roberts A. B., Roche N. S., Subbaramaiah K., Sporn M. B. A novel synthetic oleanane triterpenoid, 2-cyano-3,12-dioxoolean-1,9- dien-28-oic acid, with potent differentiating, antiproliferative, and anti-inflammatory activity.
Cancer Res.
,
59
:
336
-341,  
1999
.
38
Konopleva M., Lapillonne H., Lee R., Wang R-Y., Tsao T., McQueen T., Andreeff M. PPARγ ligand CDDO induces apoptosis in leukemias via multiple apoptosis pathways.
Blood
,
100
:
562a
2002
.
39
Bunz F., Dutriaux A., Lengauer C., Waldman T., Zhou S., Brown J. P., Sedivy J. M., Kinzler K. W., Vogelstein B. Requirement for p53 and p21 to sustain G2 arrest after DNA damage.
Science (Wash. DC)
,
282
:
1497
-1501,  
1998
.
40
Hui R., Finney G. L., Carroll J. S., Lee C. S., Musgrove E. A., Sutherland R. L. Constitutive overexpression of cyclin D1 but not cyclin E confers acute resistance to antiestrogens in T-47D breast cancer cells.
Cancer Res.
,
62
:
6916
-6923,  
2002
.
41
Musgrove E. A., Hunter L. J., Lee C. S., Swarbrick A., Hui R., Sutherland R. L. Cyclin D1 overexpression induces progestin resistance in T-47D breast cancer cells despite p27(Kip1) association with cyclin E-Cdk2.
J. Biol. Chem.
,
276
:
47675
-47683,  
2001
.
42
Dolbeare F., Gratzner H., Pallavicini M. G., Gray J. W. Flow cytometric measurement of total DNA content and incorporated bromodeoxyuridine.
Proc. Natl. Acad. Sci. USA
,
80
:
5573
-5577,  
1983
.
43
Clodi K., Kliche K-O., Zhao S., Weidner D., Schenk T., Consoli U., Jiang S., Snell V., Andreeff M. Cell-surface exposure of phosphatidylserine correlates with the stage of fludarabine-induced apoptosis in chronic lymphocytic leukemia (CLL) and expression of apoptosis-regulating genes.
Cytometry
,
40
:
19
-25,  
2000
.
44
Vermes I., Haanen C., Steffens-Nakken H., Reutelingsperger C. A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V.
J. Immunol. Methods
,
184
:
39
-51,  
1995
.
45
Poot M., Pierce R. C. Detection of apoptosis and changes in mitochondrial membrane potential with chloromethyl-X-rosamine.
Cytometry
,
36
:
359
-360,  
1999
.
46
Gurnell M., Wentworth J. M., Agostini M., Adams M., Collingwood T. N., Provenzano C., Browne P. O., Rajanayagam O., Burris T. P., Schwabe J. W., Lazar M. A., Chatterjee V. K. A dominant-negative peroxisome proliferator-activated receptor γ (PPARγ) mutant is a constitutive repressor and inhibits PPARγ-mediated adipogenesis.
J. Biol. Chem.
,
275
:
5754
-5759,  
2000
.
47
Li C., Wong W. H. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection.
Proc. Natl. Acad. Sci. USA
,
98
:
31
-36,  
2001
.
48
Li C., Hung Wong W. Model-based analysis of oligonucleotide arrays: model validation, design issues and standard error application.
Genome Biol.
,
2
:
research0032.1
-0032.11,  
2001
.
49
Nguyen, M., Norris, C., and Gold, D. Result Viewer 2.0. 2002.
50
Rosen E. D., Spiegelman B. M. PPARγ: a nuclear regulator of metabolism, differentiation, and cell growth.
J. Biol. Chem.
,
276
:
37731
-37734,  
2001
.
51
Rosen E. D., Hsu C. H., Wang X., Sakai S., Freeman M. W., Gonzalez F. J., Spiegelman B. M. C/EBPα induces adipogenesis through PPARγ: a unified pathway.
Genes Dev.
,
16
:
22
-26,  
2002
.
52
Lee C. H., Olson P., Evans R. M. Minireview: lipid metabolism, metabolic diseases, and peroxisome proliferator-activated receptors.
Endocrinology
,
144
:
2201
-2207,  
2003
.
53
Sherr C. J. Cancer cell cycles.
Science (Wash. DC)
,
274
:
1672
-1677,  
1996
.
54
Baldin V., Lukas J., Marcote M. J., Pagano M., Draetta G. Cyclin D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev.
,
7
:
812
-821,  
1993
.
55
Quelle D. E., Ashmun R. A., Shurtleff S. A., Kato J. Y., Bar-Sagi D., Roussel M. F., Sherr C. J. Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts.
Genes Dev.
,
7
:
1559
-1571,  
1993
.
56
Musgrove E. A., Lee S. C. L., Buckley M. F., Sutherland R. L. Cyclin D1 induction in breast cancer cells shortens G1 and is sufficient for cells arrested in G1 to complete the cell cycle.
Proc. Natl. Acad. Sci. USA
,
91
:
8022
-8026,  
1994
.
57
Diehl J. A., Zindy F., Sherr C. J. Inhibition of cyclin D1 phosphorylation on threonine-286 prevents its rapid degradation via the ubiquitin-proteasome pathway.
Genes Dev.
,
11
:
957
-972,  
1997
.
58
Qin C., Burghardt R., Smith R., Wormke M., Stewart J., Safe S. Peroxisome proliferator-activated receptor γ agonists induce proteasome-dependent degradation of cyclin D1 and estrogen receptor α in MCF-7 breast cancer cells.
Cancer Res.
,
63
:
958
-964,  
2003
.
59
Bartkova J., Lukas J., Muller H., Lutzhoft D., Strauss M., Bartek J. Cyclin D1 protein expression and function in human breast cancer.
Int. J. Cancer
,
57
:
353
-361,  
1994
.
60
Buckley M. F., Sweeney K. J., Hamilton J. A., Sini R. L., Manning D. L., Nicholson R. I., deFazio A., Watts C. K., Musgrove E. A., Sutherland R. L. Expression and amplification of cyclin genes in human breast cancer.
Oncogene
,
8
:
2127
-2133,  
1993
.
61
Gillett C., Fantl V., Smith R., Fisher C., Bartek J., Dickson C., Barnes D., Peters G. Amplification and overexpression of cyclin D1 in breast cancer detected by immunohistochemical staining.
Cancer Res.
,
54
:
1812
-1817,  
1994
.
62
Sherr C. J., Roberts J. M. Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev.
,
9
:
1149
-1163,  
1995
.
63
LaBaer J., Garrett M. D., Stevenson L. F., Slingerland J. M., Sandhu C., Chou H. S., Fattaey A., Harlow E. New functional activities for the p21 family of CDK inhibitors.
Genes Dev.
,
11
:
847
-862,  
1997
.
64
Alt J. R., Gladden A. B., Diehl J. A. p21 (Cip1) promotes cyclin D1 nuclear accumulation via direct inhibition of nuclear export.
J. Biol. Chem.
,
277
:
8517
-8523,  
2002
.
65
Cheng M., Olivier P., Diehl J. A., Fero M., Roussel M. F., Roberts J. M., Sherr C. J. The p21(Cip1) and p27(Kip1) CDK ’inhibitors’ are essential activators of cyclin D-dependent kinases in murine fibroblasts.
EMBO J.
,
18
:
1571
-1583,  
1999
.
66
Dulic V., Stein G. H., Far D. F., Reed S. I. Nuclear accumulation of p21Cip1 at the onset of mitosis: a role at the G2-M-phase transition.
Mol. Cell. Biol.
,
18
:
546
-557,  
1998
.
67
Morrison R. F., Farmer S. R. Role of PPARγ in regulating a cascade expression of cyclin-dependent kinase inhibitors, p18(INK4c) and p21 (Waf1/Cip1), during adipogenesis.
J. Biol. Chem.
,
274
:
17088
-17097,  
1999
.
68
el Deiry W. S., Tokino T., Velculescu V. E., Levy D. B., Parsons R., Trent J. M., Lin D., Mercer W. E., Kinzler K. W., Vogelstein B. WAF1, a potential mediator of p53 tumor suppression.
Cell
,
75
:
817
-825,  
1993
.
69
Patel V., Lahusen T., Sy T., Sausville E. A., Gutkind J. S., Senderowicz A. M. Perifosine, a novel alkylphospholipid, induces p21(WAF1) expression in squamous carcinoma cells through a p53-independent pathway, leading to loss in cyclin-dependent kinase activity and cell cycle arrest.
Cancer Res.
,
62
:
1401
-1409,  
2002
.
70
Waga S., Hannon G. J., Beach D., Stillman B. The p21 inhibitor of cyclin-dependent kinases controls DNA replication by interaction with PCNA.
Nature (Lond.)
,
369
:
574
-578,  
1994
.
71
Ando T., Kawabe T., Ohara H., Ducommun B., Itoh M., Okamoto T. Involvement of the interaction between p21 and proliferating cell nuclear antigen for the maintenance of G2-M arrest after DNA damage.
J. Biol. Chem.
,
276
:
42971
-42977,  
2001
.
72
Matsumoto M., Minami M., Takeda K., Sakao Y., Akira S. Ectopic expression of CHOP (GADD153) induces apoptosis in M1 myeloblastic leukemia cells.
FEBS Lett.
,
395
:
143
-147,  
1996
.
73
Lovat P. E., Oliverio S., Ranalli M., Corazzari M., Rodolfo C., Bernassola F., Aughton K., Maccarrone M., Hewson Q. D., Pearson A. D., Melino G., Piacentini M., Redfern C. P. GADD153 and 12-lipoxygenase mediate fenretinide-induced apoptosis of neuroblastoma.
Cancer Res.
,
62
:
5158
-5167,  
2002
.
74
Kim D. G., You K. R., Liu M. J., Choi Y. K., Won Y. S. GADD153-mediated anticancer effects of N-(4-hydroxyphenyl) retinamide on human hepatoma cells.
J. Biol. Chem.
,
277
:
38930
-38938,  
2002
.
75
McCullough K. D., Martindale J. L., Klotz L. O., Aw T. Y., Holbrook N. J. Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state.
Mol. Cell. Biol.
,
21
:
1249
-1259,  
2001
.
76
Zahnow C. A. CCAAT/enhancer binding proteins in normal mammary development and breast cancer.
Breast Cancer Res.
,
4
:
113
-121,  
2002
.
77
Meng L., Zhou J., Sasano H., Suzuki T., Zeitoun K. M., Bulun S. E. Tumor necrosis factor α and interleukin 11 secreted by malignant breast epithelial cells inhibit adipocyte differentiation by selectively down-regulating CCAAT/enhancer binding protein alpha and peroxisome proliferator-activated receptor γ: mechanism of desmoplastic reaction.
Cancer Res.
,
61
:
2250
-2255,  
2001
.
78
Lu Y., Zi X., Zhao Y., Mascarenhas D., Pollak M. Insulin-like growth factor-I receptor signaling and resistance to trastuzumab (Herceptin).
J. Natl. Cancer Inst. (Bethesda)
,
93
:
1852
-1857,  
2001
.
79
Konopleva M., Lapillonne H., Shi Y-X., McQueen T., Tsao T., Gold D. L., Madden T. Synthetic triterpenoid CDDO as a novel therapy for resistant breast cancer.
Proc. Am. Assoc. Cancer Res.
,
44
:
623
2003
.
80
Johansen M., Kempen E., Newman R. A., Nguyen J., Madden T. Preclinical pharmacokinetics of oral and intravenous CDDO, a novel triterpenoid antitumor agent.
Proc. Am. Assoc. Cancer Res.
,
43
:
591
2002
.