Genomic amplification can lead to the activation of cellular proto-oncogenes during tumorigenesis, and is observed in most, if not all, human malignancies, including adenocarcinomas of lung and esophagus. Using a two-dimensional restriction landmark genomic scanning technique, we identified five NotI/HinfI fragments with increased genomic dosage in an adenocarcinoma of the gastroesophageal junction. Four of these amplified fragments were matched within three contigs of chromosome 12 using the bioinformatics tool, Virtual Genome Scan. All three of the contigs map to the 12q13-q14 region, and the regional amplification in the tumor was verified using comparative genomic hybridization analysis. The 12q14 amplicon was characterized using sequence tagged site-amplification mapping with DNA from paired normal-tumor tissues of 75 gastroesophageal and 37 lung adenocarcinomas. The amplicon spans a region of >12 Mb between genes DGKA and BLOV1. The core-amplified domain was determined to be <0.5 Mb between marker WI-12457 and gene IFNG. However, MDM2, a well-documented oncogene of the region, is outside the core-domain. Eleven genes and expressed sequence tags within the amplicon were selected for quantitative reverse transcription-PCR, and DYRK2, a member of the dual-specificity kinase family, was overexpressed in all of the tumors showing gene amplification. Among the sequence tagged site/expressed sequence tag/gene markers tested, DYRK2 demonstrated the highest DNA copy number and the highest level of mRNA overexpression in the tumors. Moreover, DYRK2 mRNA overexpression (>2.5-fold of normal mean) was found in 18.6% of additional 86 lung adenocarcinomas in an assay using oligonucleotide microarrays. DYRK2 mRNA overexpression occurs more frequently than gene amplification in both esophageal and lung adenocarcinomas. This is the first report of amplification and overexpression of DYRK2 in any tumor type.

The incidence of esophageal adenocarcinoma has rapidly increased in many western countries including the United States, the United Kingdom, the Netherlands, Denmark, and Australia over the past 3 decades (1, 2). A poor overall 5-year survival rate of <10% portends the future clinical importance of this disease (3). Invasive adenocarcinoma is accompanied frequently with Barrett’s metaplasia, an intestinalized columnar epithelium that replaces the normal squamous epithelium at the distal esophagus as a result of chronic gastroesophageal reflux (4, 5). Smoking and obesity have been implicated as additional risk factors for the disease (6, 7).

Amplification of dominant-acting oncogenes plays a significant role in the development and/or progression of many types of human cancer, including esophageal and lung adenocarcinomas. We identified previously a novel amplicon at 8p22–23 in gastroesophageal adenocarcinomas (8). Using the STS3 -amplification mapping approach, the core-amplified domain was narrowed to include the cysteine protease gene CTSB and the transcription factor GATA-4(8, 9). Similarly, we identified and characterized an amplicon at 19q12 and revealed cyclin E as the best candidate gene selected by the 19q12 amplification in gastroesophageal adenocarcinomas (10). In addition to oncogene activation via gene amplification, inactivation of the tumor suppressor gene p53 occurs frequently in esophageal adenocarcinoma (>87%) and early in low- and high-grade Barrett’s dysplasia (11, 12). Amplification and overexpression of the MDM2 oncogene were reported in sarcomas lacking detectable p53 alterations, indicating the role of coordinately abrogating the suppression of cell growth regulated by the p53 pathway (13, 14). Whereas involvement of p53 was observed frequently in esophageal adenocarcinomas, amplification of the MDM2 gene was not detected in one study (15) and was reported infrequently (4%) in another study in this type of tumor (16). Using CGH, Moskaluk et al.(17) and van Dekken et al.(18) reported increased 12q DNA copy number in 27% and 39% of esophageal adenocarcinomas. However, these regions of gain were mapped to 12q21-q24, suggesting an additional 12q amplicon because MDM2 is mapped to the 12q13–15 region (13, 19). Tumors with amplified genes closely linked to MDM2 but without MDM2 amplification or with discontinuous amplicons including MDM2 were also reported (20, 21, 22). To clarify the amplification status within the 12q region, the current investigation was undertaken using RLGS (23, 24) combined with a recently developed bioinformatics tool, VGS (25). Use of these tools allows individual genomic fragments amplified in a tumor genome to be identified. DYRK2, a dual-specificity tyrosine-(Y)-phosphorylation regulated kinase gene, was identified as the most frequently amplified and overexpressed gene among the STS/EST/gene markers examined, and also demonstrated the highest mRNA overexpression level among the genes tested in this series of gastroesophageal and lung adenocarcinomas. Both lung and esophageal adenocarcinomas were examined in this study to determine whether the amplicon is tumor type-specific or whether it occurs in multiple tumor types. The present study represents the first complete characterization of the 12q14 amplification in both lung and esophageal adenocarcinomas, and is the first to report amplification and overexpression of DYRK2 in any human cancer.

Tissue Collection.

After obtaining written consent, 75 esophageal and gastric cardia adenocarcinomas, the corresponding normal squamous esophagus or gastric mucosa, and 123 lung adenocarcinomas were obtained from patients undergoing esophagectomy or pulmonary resection at the University of Michigan Medical Center between 1992 and 2000. Patients in this study had no preoperative radiotherapy or chemotherapy. A small portion of each tissue was embedded in OCT compound (Miles Scientific, Naperville, IL) and stored at −70°C; the remainder was stored at −70°C until use.

DNA Isolation and RLGS-combined VGS Analyses.

High molecular weight DNA was extracted as described previously (26) from tumors with >70% tumor cellularity. Two-dimensional RLGS was performed as described previously (27). In brief, DNA from normal and tumor tissues was double digested using the restriction enzymes NotI and EcoRV (New England Biolabs Inc., Beverly, MA), and NotI ends were filled with [α-32P]dCTP and [α-32P]dGTP (NEN Life Science Products, Boston, MA). First-dimensional size-fractioning was performed in a 0.9% disk-agarose gel. The resulting DNA fragments were then in-gel digested with HinfI and separated in the second dimension on a 5.25% polyacrylamide gel. Gels were then dried and autoradiographic images obtained (Molecular Dynamics, Sunnyvale, CA). Digital images were analyzed using ImageQuant v1.2 software (Molecular Dynamics). Amplified DNA fragments in tumors were quantified by densitometry using the two-dimensional images from the corresponding normal tissue DNA as standards. The VGS bioinformatics tools4 were used to match the positive fragments identified by actual two-dimensional RLGS analysis as described previously (25). The chromosome 12 VGS image was captured and used to create Fig. 1 C.

CGH.

The CGH procedure was based on the protocol described previously with modifications (28). Briefly, 200 ng of DNA samples isolated from tumor and the corresponding normal tissues was labeled by nick translation with fluorescein-isothiocyanate-dUTP (green) and Texas-Red-dUTP (red), respectively. The probes were mixed with human Cot-1 DNA (10 μg), denatured, reannealed, and hybridized to methotrexate-synchronized male metaphase chromosomes on glass slides, and incubated at 37°C for 3 days under humid conditions. The preparations were washed to remove nonspecific bound DNA and counterstained with 4′,6-diamidoino-2-phenylindol for chromosome identification. Images were captured using a Zeiss Axioskop fluorescent microscope equipped with filters for CGH and analyzed using QUIPS software (Vysis, Downers Grove, IL). Data from 20 metaphase spreads were used to generate a composite CGH profile. Threshold values were 0.8 for loss and 1.2 for gain.

STS-Amplification Mapping Using QG-PCR.

STS markers located in the region identified as having high-level amplification by CGH were selected for quantitative genomic PCR as described previously (9). PCR primers were designed to assure that the melting temperature (Tm) of each primer set was compatible with that of the internal control, herein GAPDH, which resides on the same chromosome 12 so the ratio of tumorsample/GAPDH: normalsample/GAPDH will reflect the actual DNA copy numbers increased in tumor. The quantity of the normal and tumor genomic DNA was measured by fluorometry (TKO100; Hoefer Scientific Instruments, San Francisco, CA) to ensure equity of the starting DNA. Forward primers for GAPDH and each STS/gene marker were end-labeled with [γ-32P]ATP (NEN Life Science Products) using T4 polynucleotide kinase (New England Biolabs). PCR was performed using Taq polymerase (Promega, Madison, WI), and the PCR products were resolved in 8% denaturing polyacrylamide gels. PCR product signal ratios for both the tumor (tumor STS fragment:tumor GAPDH fragment) and normal DNA samples (normal STS fragment:normal GAPDH fragment) were quantified using ImageQuant software (Molecular Dynamics). Values ≥2.0 were considered indicative of DNA amplification. All of the results were verified by repeating three times. The primers for the STS/EST/gene markers analyzed in the present study are listed in Table 1.

RNA Isolation and RT-PCR.

Total RNA was isolated using TRIzol reagent (Life Technologies, Inc., Gaithersburg, MD). Agarose gel electrophoresis and the A260:280 ratio were used to assess RNA quality. RNA samples were treated with DNase I (Promega) before reverse transcription. Two μg of total RNA were incubated with reverse transcriptase (Invitrogen Life Technologies, Inc.) and primed by both (dT)18 and random hexamers in a total of 25 μl of reaction volume. cDNA (1.0–1.5 μl) underwent RT-PCR with GAPDH coamplified as an internal control. PCR products were then resolved on 8% PAGE gels, and gel data analyses were performed using ImageQuant software as in QG-PCR.

Immunohistochemical Analysis.

Cryostat sections (5 μm) were placed on 0.1% poly-l-lysine-coated slides and fixed with 100% acetone at −20°C for 10 min. Endogenous peroxidase activity was quenched with three changes of 0.3% hydrogen peroxide for 30 min each. Horse serum, at a dilution of 1:20 in PBS-1% BSA, was used to block nonspecific binding. The MDM2 protein was detected using an anti-MDM2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:500 dilution in PBS-1% BSA. Negative controls were incubated without primary antibody. Immunoreactivity was detected using the Vectastain avidin/biotin complex kit (Vector Laboratories, Burlingame, CA) and slides counterstained with Harris-modified hematoxylin.

DYRK2 Expression Analysis in Lung Adenocarcinomas Using Oligonucleotide (Affymetrix) Microarray Data.

Total cellular RNA was isolated from 10 normal and 86 lung adenocarcinoma samples using TRIzol reagent (Life Technologies, Inc.) and RNeasy Mini kit (Qiagen, Valencia, CA). Preparation of cRNA and hybridization of the HuGeneFL Arrays were performed according to the manufacturer’s protocol (Affymetrix, Santa Clara, CA). The arrays were scanned using the GeneArray scanner (Affymetrix), and data analysis was performed using GeneChip 4.0 software as described previously (29, 30). The level of DYRK2 expression was assessed by analyzing the DYRK2 data from our Affymetrix microarray database (30).

Two-Dimensional RLGS and VGS of Gastroesophageal Adenocarcinomas.

High molecular weight DNA from 44 primary esophageal and gastric cardia adenocarcinomas was analyzed using the two-dimensional RLGS technique. Approximately 3000 individual NotI/HinfI fragments can be visualized in a two-dimensional gel allowing global comparison of two genomes from normal and tumor tissues (Fig. 1). Comparison of the DNA from a gastroesophageal adenocarcinoma (tumor E13, Fig. 1,B) with the DNA from its corresponding normal tissue (Fig. 1,A) revealed 5 DNA fragments with increased intensity in the tumor tissue (Fig. 1,B). VGS 1.01, a bioinformatics tool for comparison of sample-derived RLGS patterns with patterns predicted from the human genome sequence, was used. The amplified NotI/HinfI fragment B1 that was ∼1359 bp in the first dimensional gel and 739 bp in the second dimensional gel (1359/739), B2 (1239/530), B3 (896/178), and B4 (1786/312) were matched to their respective virtual fragments C1 through C4, all located in chromosome 12 (Figs. 1 and 4). The sequences of matched virtual NotI/HinfI fragments were aligned within three chromosome 12 contigs, NT_029419, NT_009509, and NT_009458 (Table 2). A virtual fragment of similar RLGS size for restriction fragment B5/C5 (1878/300) was not found using VGS tools (Fig. 1), indicating possible unavailability of this specific genomic sequence in the current databases. All three contigs were confirmed in the region of chromosomal band 12q13-q14 after a comprehensive analysis using NCBI GenBank databases and tools5 (Table 2; Fig. 4,B). Many of the very intensive spots visible in the two-dimensional gels represent ribosomal DNA, which is present in multiple copies (Fig. 1). Changes in the patterns of these two-dimensional fragments as well as other CpG island-containing fragments are attributable to alterations of DNA methylation and are often observed during tumor development (31, 32).

Validation of Amplified Two-dimensional Fragments Using CGH Analysis.

DNA from tumor tissue of patient E13 and normal reference DNA were labeled by nick-translation with FITC-dUTP (tumor) and Texas Red-dUTP (normal) then hybridized to normal metaphase chromosomes. High-level regional amplification was observed in tumor E13 at chromosome 12q (Fig. 2,A) with the peak at 12q14 based on a composite CGH profile of 20 metaphase spreads (Fig. 2,B). A genomic gain was also observed at chromosome 12p and 18p in the composite profile of the tumor (Fig. 2 B).

Characterization of the 12q14 Amplicon Using STS-Amplification Mapping.

To determine the core-amplified domain and boundaries of the 12q14 amplicon, >19 STS/EST/gene markers, spanning from the DGKA gene to D12S80 and covering ∼15 Mb in the region, were selected from NCBI databases5 for QG-PCR analysis. The DNA from paired tumor and corresponding normal tissues of 75 gastroesophageal and 37 lung adenocarcinoma patients was screened with each of the markers using the QG-PCR assay (Fig. 3). QG-PCR results were verified at least two times. The 12q14 amplicon is >12 Mb with the centromeric cutoff at the DGKA gene and the telomeric border around the D12S80 locus (Fig. 4). The core-amplified domain is confined to a region <0.5 Mb between WI-12457 and IFNG (Fig. 4). In tumor G12, QG-PCR analysis indicated a possible low gain at the MDM2 locus. However, much higher values of increased DNA dosage (>5-fold) were consistently observed at DYRK2 and WI-12457 in the same tumor G12 (Fig. 3; Fig. 4,A). WI-12457 is an EST fragment with high homology to TATA box binding protein-interacting protein (TIP120A) and is closely linked to DYRK2 (∼300 Kbp). The core-amplified domain of the 12q14 amplicon is a continuous and common region between both gastroesophageal and lung adenocarcinomas (Fig. 4,A). A separate regional amplification was found in the 12q13 region at the CDK2 locus in one tumor (B81, Fig. 3; Fig. 4,A), suggesting an additional amplicon in the 12q region. We also observed the centromeric boundary of the 12q14 amplicon in tumor E13 to include CDK2 (Fig. 3; Fig. 4 A).

DYRK2 Is a Potential Candidate Gene Selected by the 12q14 Regional Amplification.

Eleven genes, including those located within the core region of the 12q14 amplicon, were selected to determine RNA expression levels in the amplified tumors using quantitative RT-PCR (Fig. 5). DYRK2 was overexpressed in all of the amplified tumors and also in tumor B81, which was not amplified at the DYRK2 locus (Figs. 3 and 5). mRNA overexpression of the remaining 10 genes/ESTs tested, including MDM2, was also detected but none of them were overexpressed in all of the amplified tumors (Fig. 5; Table 3). Moreover, in the tumors, the level of DYRK2 mRNA overexpression was much greater than all of the other genes/ESTs located within the 12q14 amplicon including MDM2 (Fig. 5). Gene amplification and overexpression seemed to be confined only to DYRK2 when the other DYRK family members, DYRK1A, DYRK1B, DYRK3, and DYRK4, were examined and amplification and overexpression were not detected in this series of tumors (data not shown).

Although MDM2 is not included in the core-amplified domain in our series of adenocarcinomas (Fig. 3; Fig. 4,A), we used an immunohistochemical assay to determine MDM2 protein expression because of the well-documented involvement of this gene in the p53 pathway in tumors. Tumors E13, G12, H38, and S01, the four tumors containing the 12q14 amplicon, were examined (Fig. 6, A–D). The 0SAS sarcoma cell line, which overexpresses MDM2, was used as a positive control (Fig. 6,A). All of the negative controls showed no staining (data not shown). Lung adenocarcinoma H38 shows intense nuclear staining of MDM2 in a majority of tumor cells (Fig. 6,B) compared with no staining in H38 normal lung (Fig. 6,C). Tumor G12, which demonstrated only low gain in MDM2 copy number (Fig. 3), shows barely detectable nuclear staining in <5% of tumor nuclei (Fig. 6 D). MDM2 staining was light and detected in <10% of tumor cell nuclei of tumor E13, and no nuclear staining was observed in lung tumor S01 (data not shown). DYRK2-specific antibodies are currently unavailable.

Frequent Overexpression of DYRK2 mRNA in Lung Adenocarcinomas.

DYRK2 gene expression was analyzed using our oligonucleotide microarray database of 86 lung adenocarcinomas and 10 normal lungs (30). The gene expression data demonstrated a significant increase of DYRK2 expression in stage I lung tumors (P = 0.00088) and stage III tumors (P = 0.00073) as compared with the expression level in normal tissues. The difference of DYRK2 expression between stage I and III lung tumors was not found (P = 0.20). Array analysis of the expression patterns of the genes located within the 12q14 amplicon indicated that overexpression of DYRK2 in tumors acts independently from the rest of the genes closely linked (Fig. 6,E), suggesting that DYRK2 is less likely a passenger of a closely linked gene, which is the driving force of the 12q14 amplicon. The frequency of DYRK2 mRNA overexpression (>2.5-fold of the normal mean expression) in this series of 86 lung adenocarcinomas is 18.6% (16 of 86) and is higher than the gene amplification frequency (5.4%) in the series of the 37 lung adenocarcinomas. Amplification analysis for these 86 lung tumors was not assessed because of finite amounts of tissue material. DYRK2 mRNA overexpression was also found in one esophageal tumor, B81, which did not contain DYRK2 gene amplification (Figs. 3 and 5). These data indicate that additional mechanism(s) other than gene amplification can also elevate DYRK2 expression in esophageal and lung adenocarcinomas.

In the present study, DYRK2 demonstrated the highest level and frequency of amplification (Fig. 4,A) and RNA overexpression (Table 3) among 19 STS/EST/gene markers examined in the12q13-14 region. MDM2, on the other hand, was not included in the core-amplified domain in this series of 75 gastroesophageal and 37 lung adenocarcinomas (Fig. 3). Although the well-documented oncogene was observed to be frequently amplified at high-levels (>30-fold) in sarcomas (33.3%) and gliomas (8–10%; Refs. 14, 33), our findings are consistent with two previous publications in which amplification of MDM2 was observed in only 0–4% of esophageal adenocarcinomas (15, 16). Infrequent or absent amplification of MDM2 was also documented in many other human cancers, including esophageal squamous carcinomas (0 of 24 tumors; Ref. 34), primary Ewing tumors (0 of 37 tumors; Ref. 35), primary cervical carcinomas (0 of 35 tumors; Ref. 36), breast cancers (1 of 60 tumors; Ref. 37), and hepatoblastomas (0 of 19 tumors; Ref. 38). The present study is the first to delineate the genes selected by the 12q14 amplification with close proximity to MDM2 in esophageal and lung adenocarcinomas.

The DYRK family includes dual-specificity tyrosine-(Y)-phosphorylation regulated kinases, which are distinguished from other protein kinase families by their ability to phosphorylate both Ser/Thr and Tyr substrates (dual-specificity), and includes at least seven mammalian members, DYRK1A, DYRK1B, DYRK1C, DYRK2, DYRK3, DYRK4A, and DYRK4B(41). In addition, DYRK1A, DYRK2, DYRK3, MNB, and YakA can autophosphorylate their tyrosine residues in vitro(39, 41). YakA may be the homologue of DYRK2 or DYRK3, and all three are predominantly cytoplasmic, whereas DYRK1A shows nuclear localization (40, 41). DYRK1A is the homologue of Drosophila MNB, which has been mapped to human Down syndrome critical region 21q22.2 (42, 43). Presently, the cellular function of all of the DYRK family members remains unclear. However, DYRK1A has been implicated in normal embryo neurogenesis (44) and as a potential candidate gene responsible for the Down syndrome (45). The DYRK family may also be involved in early heart development (46) and might play a role in cell cycle regulation (47). DYRK1A has been reported to phosphorylate the transcription factor FKHR at Ser329 in vitro(48). Both DYRK1A and DYRK2 have been shown to phosphorylate STAT3 in vitro(49). DYRK1A might be directly involved in regulating the transcriptional activity of Gli1, a transcription factor that is a target of the Sonic hedgehog pathway involved in basal cell carcinoma development (50, 51, 52). Interestingly, mirk, a recently cloned minibrain related kinase of which the cellular localization is similar to DYRK2 and DYRK3, is overexpressed in primary colon carcinomas and can mediate the survival of colon carcinoma cell lines under stress induced conditions (53). A recent study has reported that DYRK2 mRNA was down-regulated in neuroblastoma cells by treating the cells with an anticancer agent, 8-Cl-cAMP, a site-selective cyclic AMP analogue exhibiting growth inhibition in a broad spectrum of human cancer lines (54). These observations, together with our findings, indicate a potential role of DYRK2 in lung and esophageal tumor development and/or progression.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

Supported by National Cancer Institute Grant CA71606 and the Weber Research Fund. Supported also by NIH Training Grant CA009672-08 (to S. A.).

3

The abbreviations used are: STS, sequence tagged site; RLGS, restriction landmark genome scanning; VGS, Virtual Genome Scan; CGH, comparative genomic hybridization; QG-PCR, quantitative genomic-PCR; EST, expressed sequence tag; NCBI, National Center for Biotechnology Information; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

4

Internet address: http://dot.ped.med.umich.edu:2000/VGS/index.html.

5

Internet address: http://www.ncbi.nlm.nih.gov.

Fig. 1.

Two-dimensional RLGS analysis of NotI/HinfI DNA fragments from the normal and tumor tissues of patient E13, and a VGS image of virtual NotI/HinfI fragments of chromosome 12. DNA fragments from a gastroesophageal adenocarcinoma of patient E13 (B) and normal tissue from the same patient (A) were resolved on two-dimensional gels. As shown, the comparison of relative intensity of each fragment (spot) between normal (A) and tumor (B) reveals five such fragments, B1 through B5 (arrows in B), that are darker in tumor as compared with corresponding spots A1 through A5 (arrows in A) in normal, suggesting increased DNA copy number in each of the five fragments in the tumor. C, matched virtual fragments C1 through C4 (black dots indicated by arrows in C) are shown on a VGS image with NotI/HinfI fragments from chromosome 12 (white dots in C). Fragment C5 was not found with any chromosomes using the VGS tool analysis, indicating the possible unavailability of sequences for this fragment in the GenBank databases.

Fig. 1.

Two-dimensional RLGS analysis of NotI/HinfI DNA fragments from the normal and tumor tissues of patient E13, and a VGS image of virtual NotI/HinfI fragments of chromosome 12. DNA fragments from a gastroesophageal adenocarcinoma of patient E13 (B) and normal tissue from the same patient (A) were resolved on two-dimensional gels. As shown, the comparison of relative intensity of each fragment (spot) between normal (A) and tumor (B) reveals five such fragments, B1 through B5 (arrows in B), that are darker in tumor as compared with corresponding spots A1 through A5 (arrows in A) in normal, suggesting increased DNA copy number in each of the five fragments in the tumor. C, matched virtual fragments C1 through C4 (black dots indicated by arrows in C) are shown on a VGS image with NotI/HinfI fragments from chromosome 12 (white dots in C). Fragment C5 was not found with any chromosomes using the VGS tool analysis, indicating the possible unavailability of sequences for this fragment in the GenBank databases.

Close modal
Fig. 2.

CGH analysis of tumor E13. The digitized fluorescent image of an arranged metaphase spread and the chromosomal ideograms from tumor E13 are shown. A, high-intensity green bands, indicative of increased regional DNA dosage, are present on the long arm of chromosome 12 near the centromere (arrow). B, the composite CGH profile from 20 metaphase spreads demonstrates that the regional genomic amplification is located at the 12q14 band in tumor E13.

Fig. 2.

CGH analysis of tumor E13. The digitized fluorescent image of an arranged metaphase spread and the chromosomal ideograms from tumor E13 are shown. A, high-intensity green bands, indicative of increased regional DNA dosage, are present on the long arm of chromosome 12 near the centromere (arrow). B, the composite CGH profile from 20 metaphase spreads demonstrates that the regional genomic amplification is located at the 12q14 band in tumor E13.

Close modal
Fig. 3.

QG-PCR applied to characterize the 12q14 amplicon in 75 gastroesophageal and 37 lung adenocarcinomas. The housekeeping gene GAPDH was used as an internal control and coamplified with selected STS/EST/gene markers located in the chromosome 12q13-14 region. The intensity ratio (Ts/c:Ns/c) between tumor (Tsample/GAPDH) and normal (Nsample/GAPDH) samples from QG-PCR were quantified as described in “Materials and Methods,” and the ratio numbers are listed under each pair of samples. Five STS/EST/gene markers are shown representing the 19 markers investigated (Table 1). As shown, tumor E13 is amplified at all markers (∼12 Mb) suggesting that a large amplicon is contained in tumor E13. The highest increased copy number was observed in the DYRK2 gene (6.4-fold) and a closely linked EST marker, WI-12457 (5.1-fold), in tumor G12. Tumor B81 contains CDK2 amplification but no other markers tested, indicating an existence of additional amplicon in the 12q13 region. MDM2 was not amplified in tumor G12, the tumor showing the highest DNA copy number of DYRK2.

Fig. 3.

QG-PCR applied to characterize the 12q14 amplicon in 75 gastroesophageal and 37 lung adenocarcinomas. The housekeeping gene GAPDH was used as an internal control and coamplified with selected STS/EST/gene markers located in the chromosome 12q13-14 region. The intensity ratio (Ts/c:Ns/c) between tumor (Tsample/GAPDH) and normal (Nsample/GAPDH) samples from QG-PCR were quantified as described in “Materials and Methods,” and the ratio numbers are listed under each pair of samples. Five STS/EST/gene markers are shown representing the 19 markers investigated (Table 1). As shown, tumor E13 is amplified at all markers (∼12 Mb) suggesting that a large amplicon is contained in tumor E13. The highest increased copy number was observed in the DYRK2 gene (6.4-fold) and a closely linked EST marker, WI-12457 (5.1-fold), in tumor G12. Tumor B81 contains CDK2 amplification but no other markers tested, indicating an existence of additional amplicon in the 12q13 region. MDM2 was not amplified in tumor G12, the tumor showing the highest DNA copy number of DYRK2.

Close modal
Fig. 4.

Diagrammatic map of the 12q13-14 amplicon in gastroesophageal and lung tumors determined using QG-PCR analysis, and a map of the matched virtual NotI/HinfI fragments aligned to the actual amplification map. A, • indicate that genomic amplification was detected in the individual tumors at the markers tested. ○ indicate that DNA amplification was not observed at the loci tested. The map order is based on QG-PCR analysis of 75 gastroesophageal and 37 lung adenocarcinoma tumors, but closely follows the December 2002 NCBI databases from various sources. As shown, the core-amplified domain (excluding tumor B81 of which the amplicon is centered on CDK2) is between the marker WI-12457 and gene IFNG, leaving MDM2 outside of the core-amplified region. Overexpression status of genes and ESTs in this region was analyzed, and DYRK2 was found to be the only gene overexpressed in all tumors amplified. B, the physical map of the matched virtual NotI/HinfI fragments as related to the actual amplicon map shown at left.

Fig. 4.

Diagrammatic map of the 12q13-14 amplicon in gastroesophageal and lung tumors determined using QG-PCR analysis, and a map of the matched virtual NotI/HinfI fragments aligned to the actual amplification map. A, • indicate that genomic amplification was detected in the individual tumors at the markers tested. ○ indicate that DNA amplification was not observed at the loci tested. The map order is based on QG-PCR analysis of 75 gastroesophageal and 37 lung adenocarcinoma tumors, but closely follows the December 2002 NCBI databases from various sources. As shown, the core-amplified domain (excluding tumor B81 of which the amplicon is centered on CDK2) is between the marker WI-12457 and gene IFNG, leaving MDM2 outside of the core-amplified region. Overexpression status of genes and ESTs in this region was analyzed, and DYRK2 was found to be the only gene overexpressed in all tumors amplified. B, the physical map of the matched virtual NotI/HinfI fragments as related to the actual amplicon map shown at left.

Close modal
Fig. 5.

Quantitative RT-PCR analysis applied to 11 genes within the 12q14 amplicon; 5 of them are shown. GAPDH was coamplified as a control in each reaction. As shown, all 5 tumors demonstrate DYRK2 mRNA overexpression, including tumor B81 that did not contain DYRK2 gene amplification (Fig. 3). MDM2 mRNA overexpression is not detected in two tumors, B81 and S01, and the latter (tumor S01) contains low-level MDM2 amplification (Fig. 3).

Fig. 5.

Quantitative RT-PCR analysis applied to 11 genes within the 12q14 amplicon; 5 of them are shown. GAPDH was coamplified as a control in each reaction. As shown, all 5 tumors demonstrate DYRK2 mRNA overexpression, including tumor B81 that did not contain DYRK2 gene amplification (Fig. 3). MDM2 mRNA overexpression is not detected in two tumors, B81 and S01, and the latter (tumor S01) contains low-level MDM2 amplification (Fig. 3).

Close modal
Fig. 6.

Immunohistochemical analysis of MDM2 protein expression in esophageal and lung tumors (A–D), and gene expression of DYRK2 in lung tumors using Affymetrix microarray analysis (E). A, the sarcoma cell line 0SAS overexpresses MDM2 and was used as a positive control for nuclear staining (arrow). B, lung tumor H38, which contains the 12q14 amplicon, shows strong nuclear staining of MDM2 in most tumor cells (arrows). C, normal lung section from patient H38 displays no MDM2 staining. D, esophageal tumor from patient G12, which contains highly increased DYRK2 copy number but no detectable MDM2 amplification, shows only slight nuclear staining of MDM2. E, gene expression patterns sorted by DYRK2 expression levels for 86 lung adenocarcinomas and 10 normal lung samples using our array database (30) demonstrate substantially elevated expression (red) of DYRK2 in at least 16 individual tumors. The expression patterns of the other genes located within the 12q14 amplicon are also included, and the comparison of the expression patterns of these genes with the patterns of DYRK2 indicates that overexpression of DYRK2 in tumors is independent from other closely linked genes within the 12q14 amplicon.

Fig. 6.

Immunohistochemical analysis of MDM2 protein expression in esophageal and lung tumors (A–D), and gene expression of DYRK2 in lung tumors using Affymetrix microarray analysis (E). A, the sarcoma cell line 0SAS overexpresses MDM2 and was used as a positive control for nuclear staining (arrow). B, lung tumor H38, which contains the 12q14 amplicon, shows strong nuclear staining of MDM2 in most tumor cells (arrows). C, normal lung section from patient H38 displays no MDM2 staining. D, esophageal tumor from patient G12, which contains highly increased DYRK2 copy number but no detectable MDM2 amplification, shows only slight nuclear staining of MDM2. E, gene expression patterns sorted by DYRK2 expression levels for 86 lung adenocarcinomas and 10 normal lung samples using our array database (30) demonstrate substantially elevated expression (red) of DYRK2 in at least 16 individual tumors. The expression patterns of the other genes located within the 12q14 amplicon are also included, and the comparison of the expression patterns of these genes with the patterns of DYRK2 indicates that overexpression of DYRK2 in tumors is independent from other closely linked genes within the 12q14 amplicon.

Close modal
Table 1

Primer sequences of gene/STS markers used for QG-PCR analysis of the 12q14 amplicon

Gene/STSForward primer (5′-3′)Reverse primer (5′-3′)
DGKAa ggactctactcccgaggct ttcagatgaggcactttcaat 
CDK2a tgccgtaccaatctctgaatgcc gactcctcccagtggttttgttttac 
ERBB3a ggtttcctccctttcctcttcttg gctttcccagtcccattcctcag 
STAT6a agctctgtccagcgagttc gcagccactgcttacactgc 
D12S329b aagcaatcagccagccct tgtcagaacctaacaacccagaaag 
HMGA2a ttcaacaagcaagcgattc tctaccatttctgcaagttagg 
MAN1c ggagtgacatcagcagaataggaa acagctttgatacaggtggttttg 
IRAK-Ma cccgtgcaagcaagctaaaccaa gacttcagccaaacaaaacaatcaaaa 
WI-12457a,b cttactgttacaggagcaccaca tctgtgctggggaacaaag 
DYRK2a cagatgacagatgccaatgggaata ttgagcaaataaaaacaggtctgagc 
SHGC-57328a,b ctcccacttcccagcaaaag tggcaacagacccagagaga 
D12S335 ctcccaacctcgcccagaga attatggtggcaaggacagacacaat 
D12S313 ctcagtcttgccttccacctc taattgattccaaactcattgatgtct 
IFNGc gacattcacaattgattttattcttaca cccccaatggtacaggtttc 
IL26(AK155)a,b aagcagtcagtaaaccaaagcca tttgaaaacacagaaaatgtgcaa 
MDM1a,b ttccccaagttttcattaccc aagtagcctggaggtaggttct 
MDM2a gagggctttgatgttcctga gctactagaagttgatggc 
BLOV1c ctcgggggcggaagcactggag acagatcaaccccgggcgagtagcac 
D12S80 caccaccacccggctaatttttctat caggctgggtgcggtgctc 
Gene/STSForward primer (5′-3′)Reverse primer (5′-3′)
DGKAa ggactctactcccgaggct ttcagatgaggcactttcaat 
CDK2a tgccgtaccaatctctgaatgcc gactcctcccagtggttttgttttac 
ERBB3a ggtttcctccctttcctcttcttg gctttcccagtcccattcctcag 
STAT6a agctctgtccagcgagttc gcagccactgcttacactgc 
D12S329b aagcaatcagccagccct tgtcagaacctaacaacccagaaag 
HMGA2a ttcaacaagcaagcgattc tctaccatttctgcaagttagg 
MAN1c ggagtgacatcagcagaataggaa acagctttgatacaggtggttttg 
IRAK-Ma cccgtgcaagcaagctaaaccaa gacttcagccaaacaaaacaatcaaaa 
WI-12457a,b cttactgttacaggagcaccaca tctgtgctggggaacaaag 
DYRK2a cagatgacagatgccaatgggaata ttgagcaaataaaaacaggtctgagc 
SHGC-57328a,b ctcccacttcccagcaaaag tggcaacagacccagagaga 
D12S335 ctcccaacctcgcccagaga attatggtggcaaggacagacacaat 
D12S313 ctcagtcttgccttccacctc taattgattccaaactcattgatgtct 
IFNGc gacattcacaattgattttattcttaca cccccaatggtacaggtttc 
IL26(AK155)a,b aagcagtcagtaaaccaaagcca tttgaaaacacagaaaatgtgcaa 
MDM1a,b ttccccaagttttcattaccc aagtagcctggaggtaggttct 
MDM2a gagggctttgatgttcctga gctactagaagttgatggc 
BLOV1c ctcgggggcggaagcactggag acagatcaaccccgggcgagtagcac 
D12S80 caccaccacccggctaatttttctat caggctgggtgcggtgctc 
a

Primers that prime PCR reactions for both genomic DNA and cDNA.

b

The sequences of these primers are retrieved from the NCBI databases from various resources.

c

These primers can only be utilized for genomic PCR amplification.

Table 2

The matched virtual NotI/HinfI fragments C1, C2, C3, and C4 (Fig. 1) using VGS tools (VGS 1.01)

FragmentOne-dimensional, two-dimensional (bp)aMatched contig IDbMatch sitecLocationd
C1 1373, 732 NT_029419 2533943–2534671 12q14.2-q14.3 
C2 1260, 517 NT_009509 295882–296400 12q13.13-13.2 
C3 887, 175 NT_009458 456700–456880 12q13.13 
C4 1805, 312 NT_009458 1026030–1026339  
FragmentOne-dimensional, two-dimensional (bp)aMatched contig IDbMatch sitecLocationd
C1 1373, 732 NT_029419 2533943–2534671 12q14.2-q14.3 
C2 1260, 517 NT_009509 295882–296400 12q13.13-13.2 
C3 887, 175 NT_009458 456700–456880 12q13.13 
C4 1805, 312 NT_009458 1026030–1026339  
a

One-dimensional number indicates the NotI/EcoRV fragment size, in base pairs, migrated in the first-dimensional gel and two-dimensional number provides the size (bp) of NotI/HinfI fragment resolved in the second-dimensional gel.

b

Contig ID is the ID name used in the NCBI databases.

c

Match site denotes where the matched virtual NotI/HinfI fragments aligned within the identified contigs.

d

Chromosome map site is derived from the NCBI databases and maps (http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/map_search).

Table 3

Candidate search results using quantitative RT-PCR for amplified genes/ESTs located within the 12q13-14 amplicona

Gene/ESTB81E13G12H38S01
CDK2 − − − 
ERBB3 − − − − − 
MAN1 − − nt 
IRAK-M − − 
WI-12457 − − − 
DYRK2 
SHGC-57328 − − 
IFNG − − − − 
MDM1 − − − − 
MDM2 − − 
Gene/ESTB81E13G12H38S01
CDK2 − − − 
ERBB3 − − − − − 
MAN1 − − nt 
IRAK-M − − 
WI-12457 − − − 
DYRK2 
SHGC-57328 − − 
IFNG − − − − 
MDM1 − − − − 
MDM2 − − 
a

The ratio of tumorsample/GAPDH:normalsample/GAPDH ≥ 2.0 is defined as gene overexpression. “+”, overexpressed; “−”, not overexpressed. “nt”, not tested.

We thank Dr. Jiayuh Lin for the generous gift of the MDM2 overexpressing cell line (0SAS). We also thank Rork Kuick and Jean-Marie Rouillard for their assistance using the VGS tool and Dr. Guoan Chen for his help with the array study.

1
Devesa S. S., Blot W. J., Fraumeni J. F. Changing patterns in the incidence of esophageal and gastric carcinoma in the United States.
Cancer (Phila.)
,
83
:
2049
-2053,  
1998
.
2
Bollschweiler E., Wolfgarten E., Gutschow C., Hölscher A. H. Demographic variations in the rising incidence of esophageal adenocarcinoma in white males.
Cancer (Phila.)
,
92
:
549
-555,  
2001
.
3
Farrow D. C., Vaughan T. L. Determinants of survival following the diagnosis of esophageal adenocarcinoma (United States).
Cancer Causes Control
,
7
:
322
-327,  
1996
.
4
Sarr M. G., Hamilton S. R., Marrone G. C., Cameron J. L. Barrett’s esophagus: its prevalence and association with adenocarcinoma in patients with symptoms of gastroesophageal reflux.
Am. J. Surg.
,
149
:
187
-193,  
1985
.
5
Jankowski J. A., Wright N. A., Meltzer S. J., Triafilopoulos G., Geboes K., Casson A. G., Kerr D., Young L. S. Molecular evolution of the metaplasia-dysplasia-adenocarcinoma sequence in the esophagus.
Am. J. Pathol.
,
152
:
965
-973,  
1999
.
6
Lagergren J., Bregstrom R., Lindgren A., Nyren O. N. Symptomatic gastroesophageal reflux as a risk factor for esophageal adenocarcinoma.
N. Engl. J. Med.
,
340
:
825
-831,  
1999
.
7
Altorki N. K., Oliveria S., Schrump D. S. Epidemiology and molecular biology of Barrett’s adenocarcinoma.
Sem. Surg. Onc.
,
13
:
270
-280,  
1997
.
8
Hughes S. J., Glover T. W., Zhu X. X., Kuick R., Thoraval D., Orringer M. B., Beer D. G., Hanash S. A novel amplicon at 8p22–23 results in overexpression of cathepsin B in esophageal adenocarcinoma.
Proc. Natl. Acad. Sci. USA
,
95
:
12410
-12415,  
1998
.
9
Lin L., Aggarwal S., Glover T. W., Orringer M. B., Hanash S., Beer D. G. A minimal critical region of the 8p22–23 amplicon in esophageal adenocarcinomas defined using sequence tagged site-amplification mapping and quantitative polymerase chain reaction includes the GATA-4 gene.
Cancer Res.
,
60
:
1341
-1347,  
2000
.
10
Lin L., Prescott M. S., Zhu Z., Singh P., Chun S. Y., Kuick R. D., Hanash S. M., Orringer M. B., Glover T. W., Beer D. G. Identification and characterization of a 19q12 amplicon in esophageal adenocarcinomas reveals cyclin E as the best candidate gene for this amplicon.
Cancer Res.
,
60
:
7021
-7027,  
2000
.
11
Younes M., Lebovitz R. M., Lechago L. V., Lechago J. p53 protein accumulation in Barrett’s metaplasia, dysplasia, and carcinoma: a follow-up study.
Gastroenterology
,
105
:
1637
-1642,  
1993
.
12
Hamelin R., Flejou J. F., Muzeau F., Potet F., Laurent-Puig P., Fekete F., Thomas G. TP53 gene mutations and p53 protein immunoreactivity in malignant and premalignant Barrett’s esophagus.
Gastroenterology
,
107
:
1012
-1018,  
1994
.
13
Oliner J. D., Kinzler K. W., Meltzer P. S., George D. L., Vogelstein B. Amplification of a gene encoding a p53-associated protein in human sarcomas.
Nature (Lond.)
,
358
:
80
-83,  
1992
.
14
Leach F. S., Tokino T., Meltzer P., Burrell M., Oliner J. D., Smith S., Hill D. E., Sidransky D., Kinzler K. W., Vogelstein B. p53 Mutation and MDM2 amplification in human soft tissue sarcomas.
Cancer Res.
,
53
:
2231
-2234,  
1993
.
15
Soslow R. A., Altorki N. K., Yang G., Xie D., Yang C. S. mdm-2 expression correlates with wild-type p53 status in esophageal adenocarcinoma.
Mod. Pathol.
,
12
:
580
-586,  
1999
.
16
Taniere P., Martel-Planche G., Maurici D., Lombard-Bohas C., Scoazec J., Montesano R., Berger F., Hainaut P. Molecular and clinical differences between adenocarcinomas of the esophagus and of the gastric cardia.
Am. J. Pathol.
,
158
:
33
-40,  
2001
.
17
Moskaluk C. A., Hu J., Perlman E. J. Comparative genomic hybridization of esophageal and gastroesophageal adenocarcinomas shows consensus areas of DNA gain and loss.
Genes Chromosomes Cancer
,
22
:
305
-311,  
1998
.
18
van Dekken H., Geelen E., Dinjens W. N. M., Wijnhoven B. P. L., Tilanus H. W., Tanke H. J., Rosenberg C. Comparative genomic hybridization of cancer of the gastroesophageal junction: deletion of 14Q31–32.1 discriminates between esophageal (Barrett’s) and gastric cardia adenocarcinomas.
Cancer Res.
,
59
:
748
-752,  
1999
.
19
Mitchell E. L., White G. R., Santibanez-Koref M. F., Varley J. M., Heighway J. Mapping of gene loci in the Q13–Q15 region of chromosome 12.
Chromosome Res.
,
3
:
261
-262,  
1995
.
20
Forus A., Florenes V. A., Maelandsmo G. M., Meltzer P. S., Fodstad O., Myklebost O. Mapping of amplification units in the q13–14 region of chromosome 12 in human sarcomas: some amplica do not include MDM2.
Cell Growth Differ.
,
4
:
1065
-1070,  
1993
.
21
Nilbert M., Rydholm A., Mitelman F., Meltzer P. S., Mandahl N. Characterization of the 12q13–15 amplicon in soft tissue tumors.
Cancer Genet. Cytogenet.
,
83
:
32
-36,  
1995
.
22
Reifenberger G., Ichimura K., Reifenberger J., Elkahloun A. G., Meltzer P. S., Collins V. P. Refined mapping of 12q13–q15 amplicons in human malignant gliomas suggests CDK4/SAS and MDM2 as independent amplification targets.
Cancer Res.
,
56
:
5141
-5145,  
1996
.
23
Hatada I., Hayashizaki Y., Hirotsune S., Komatsubara H., Mukai T. A genomic scanning method for higher organisms using restriction sites as landmarks.
Proc. Natl. Acad. Sci. USA
,
88
:
9523
-9527,  
1991
.
24
Hirotsune S., Hatada I., Komatsubara H., Nagai H., Kuma K., Kobayakawa K., Kawara T., Nakagawara A., Fujii K., Mukai T., et al New approach for detection of amplification in cancer DNA using restriction landmark genomic scanning.
Cancer Res.
,
52
:
3642
-3647,  
1992
.
25
Rouillard J. M., Erson A. E., Kuick R., Asakawa J., Wimmer K., Muleris M., Petty E. M., Hanash S. Virtual genome scan: a tool for restriction landmark-based scanning of the human genome.
Genome Res.
,
11
:
1453
-1459,  
2001
.
26
Blin N., Stafford D. W. A general method for isolation of high molecular weight DNA from eukaryotes.
Nucleic Acids Res.
,
3
:
2303
-2308,  
1976
.
27
Kuick R., Asakawa J., Neel J. V., Satoh C., Hanash S. M. High yield of restriction fragment length polymorphisms in two-dimensional separations of human genomic DNA.
Genomics
,
25
:
345
-353,  
1995
.
28
Kallioniemi A., Kallioniemi O-P., Sudar D., Rutovitz D., Gray J. W., Waldman F., Pinkel D. Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors.
Science (Wash. DC)
,
258
:
818
-821,  
1992
.
29
Giordano T. J., Shedden K. A., Schwartz D. R., Kuick R., Taylor J. M., Lee N., Misek D. E., Greenson J. K., Kardia S. L., Beer D. G., Rennert G., Cho K. R., Gruber S. B., Fearon E. R., Hanash S. Organ-specific molecular classification of primary lung, colon, and ovarian adenocarcinomas using gene expression profiles.
Am. J. Pathol.
,
159
:
1231
-1238,  
2001
.
30
Beer D. G., Kardia S. L., Huang C. C., Giordano T. J, Levin A. M., Misek D. E., Lin L., Chen G., Gharib T. G., Thomas D. G., Lizyness M. L., Kuick R., Hayasaka S., Taylor J. M., Iannettoni M. D., Orringer M. B., Hanash S. Gene-expression profiles predict survival of patients with lung adenocarcinoma.
Nat. Med.
,
8
:
816
-824,  
2002
.
31
Thoraval D., Asakawa J., Wimmer K., Kuick R., Lamb B., Richardson B., Ambros P., Glover T., Hanash S. Demethylation of repetitive DNA sequences in neuroblastoma.
Genes Chromosomes Cancer
,
17
:
234
-244,  
1996
.
32
Costello J. F., Fruhwald M. C., Smiraglia D. J., Rush L. J., Robertson G. P., Gao X., Wright F. A., Feramisco J. D., Peltomaki P., Lang J. C., Schuller D. E., Yu L., Bloomfield C. D., Caligiuri M. A., Yates A., Nishikawa R., Su Huang H., Petrelli N. J., Zhang X., O’Dorisio M. S., Held W. A., Cavenee W. K., Plass C. Aberrant CpG-island methylation has non-random and tumour-type-specific patterns.
Nat. Genet.
,
24
:
132
-138,  
2000
.
33
Reifenberger G., Liu L., Ichimura K., Schmidt E. E., Collins V. P. Amplification and overexpression of the MDM2 gene in a subset of human malignant gliomas without p53 mutations.
Cancer Res.
,
53
:
2736
-2739,  
1993
.
34
Esteve A., Lehman T., Jiang W., Weinstein I. B., Harris C. C., Ruol A., Peracchia A., Montesano R., Hollstein M. Correlation of p53 mutations with epidermal growth factor receptor overexpression and absence of mdm2 amplification in human esophageal carcinomas.
Mol. Carcinog.
,
8
:
306
-311,  
1993
.
35
Kovar H., Auinger A., Jug G., Aryee D., Zoubek A., Salzer-Kuntschik M., Gadner H. Narrow spectrum of infrequent p53 mutations and absence of MDM2 amplification in Ewing tumours.
Oncogene
,
8
:
2683
-2690,  
1993
.
36
Kessis T. D., Slebos R. J., Han S. M., Shah K., Bosch X. F., Munoz N., Hedrick L., Cho K. R. p53 gene mutations and MDM2 amplification are uncommon in primary carcinomas of the uterine cervix.
Am. J. Pathol.
,
143
:
1398
-1405,  
1993
.
37
Quesnel B., Preudhomme C., Fournier J., Fenaux P., Peyrat J. P. MDM2 gene amplification in human breast cancer.
Eur. J. Cancer
,
30A
:
982
-984,  
1994
.
38
Ohnishi H., Kawamura M., Hanada R., Kaneko Y., Tsunoda Y., Hongo T., Bessho F., Yokomori K., Hayashi Y. Infrequent mutations of the TP53 gene and no amplification of the MDM2 gene in hepatoblastomas.
Genes Chromosomes Cancer
,
15
:
187
-190,  
1996
.
39
Tejedor F., Zhu X. R., Kaltenbach E., Ackermann A., Baumann A., Canal I., Heisenberg M., Fischbach K. F., Pongs O. minibrain: a new protein kinase family involved in postembryonic neurogenesis in Drosophila.
Neuron
,
14
:
287
-301,  
1995
.
40
van Es S., Weening K. E., Devreotes P. N. The protein kinase YakA regulates g-protein-linked signaling responses during growth and development of Dictyostelium.
J. Biol. Chem.
,
276
:
30761
-30765,  
2001
.
41
Becker W., Weber Y., Wetzel K., Eirmbter K., Tejedor F. J., Joost H. G. Sequence characteristics, subcellular localization, and substrate specificity of DYRK-related kinases, a novel family of dual specificity protein kinases.
J. Biol. Chem.
,
273
:
25893
-25902,  
1998
.
42
Song W. J., Sternberg L. R., Kasten-Sportes C., Keuren M. L., Chung S. H., Slack A. C., Miller D. E., Glover T. W., Chiang P. W., Lou L., Kurnit D. M. Isolation of human and murine homologues of the Drosophila minibrain gene: human homologue maps to 21q22.2 in the Down syndrome “critical region”.
Genomics
,
38
:
331
-339,  
1996
.
43
Chen H., Antonarakis S. E. Localisation of a human homologue of the Drosophila mnb and rat Dyrk genes to chromosome 21q22.2.
Hum. Genet.
,
99
:
262
-265,  
1997
.
44
Miyata Y., Nishida E. Distantly related cousins of MAP kinase: biochemical properties and possible physiological functions.
Biochem. Biophys. Res. Commun.
,
266
:
291
-295,  
1999
.
45
Smith D. J., Stevens M. E., Sudanagunta S. P., Bronson R. T., Makhinson M., Watabe A. M., O’Dell T. J., Fung J., Weier H. U., Cheng J. F., Rubin E. M. Functional screening of 2 Mb of human chromosome 21q22.2 in transgenic mice implicates minibrain in learning defects associated with Down syndrome.
Nat. Genet.
,
16
:
28
-36,  
1997
.
46
Okui M., Ide T., Morita K., Funakoshi E., Ito F., Ogita K., Yoneda Y., Kudoh J., Shimizu N. High-level expression of the Mnb/Dyrk1A gene in brain and heart during rat early development.
Genomics
,
62
:
165
-171,  
1999
.
47
Rahmani Z., Lopes C., Rachidi M., Delabar J. M. Expression of the mnb (dyrk) protein in adult and embryonic mouse tissues.
Biochem. Biophys. Res. Commun.
,
253
:
514
-518,  
1998
.
48
Woods Y. L., Rena G., Morrice N., Barthel A., Becker W., Guo S., Unterman T. G., Cohen P. The kinase DYRK1A phosphorylates the transcription factor FKHR at Ser329 in vitro, a novel in vivo phosphorylation site.
Biochem. J.
,
355
:
597
-607,  
2001
.
49
Matsuo R., Ochiai W., Nakashima K., Taga T. A new expression cloning strategy for isolation of substrate-specific kinases by using phosphorylation site-specific antibody.
J. Immunol. Methods.
,
247
:
141
-151,  
2001
.
50
Mao J., Maye P., Kogerman P., Tejedor F. J., Toftgard R., Xie W., Wu G., Wu D. Regulation of Gli1 transcriptional activity in the nucleus by Dyrk1.
J. Biol. Chem.
,
277
:
35156
-35161,  
2002
.
51
Lee J., Platt K. A., Censullo P., Ruiz i Altaba A. Gli1 is a target of Sonic hedgehog that induces ventral neural tube development.
Development
,
124
:
2537
-2552,  
1997
.
52
Dahmane N., Lee J., Robins P., Heller P., Ruiz i Altaba. A. Activation of the transcription factor Gli1 and the Sonic hedgehog signalling pathway in skin tumours.
Nature (Lond.)
,
389
:
876
-881,  
1997
.
53
Lee K., Deng X., Friedman E. Mirk protein kinase is a mitogen-activated protein kinase substrate that mediates survival of colon cancer cells.
Cancer Res.
,
60
:
3631
-3637,  
2000
.
54
Park G. H., Choe J., Choo H. J., Park Y. G., Sohn J., Kim M. K. Genome-wide expression profiling of 8-chloroadenosine- and 8-chloro-cAMP-treated human neuroblastoma cells using radioactive human cDNA microarray.
Exp. Mol. Med.
,
34
:
184
-193,  
2002
.