This study addresses the prevalence of ATM mutations and the associationwith breast cancer in Austrian families selected for a history of breast or ovarian cancer or both [hereditary breast and ovarian cancer (HBOC)]. In 270 HBOC families previously screened for BRCA1 and BRCA2 mutations, 137 different sequence alterations of ATM were identified. Seven of these were mutations presumed to cause ataxia telangiectasia based on their effect on the ATM protein, including five that caused a protein truncation and two missense mutations in the catalytic kinase domain of the highly conserved COOH terminus of the protein. The seven mutations were found in 10 families (3.7%). In addition, one missense variant, L1420F, was observed in 13 HBOC families (4.8%) but was not observed in any of the 122 healthy volunteers with no history of breast cancer. In addition, the variant segregated with breast cancer in some of the families, suggesting that it may be pathogenic for breast cancer. Sixty-two additional variants of potential significance were observed in 65 HBOC families, but not in healthy controls. These variants included 24 sequence alterations with possible effects on splicing or protein-protein interactions. This study indicates that there is a significant prevalence of ATM mutations in breast and ovarian cancer families and adds to a growing body of evidence that ATM mutations confer increased susceptibility to breast cancer.

Breast cancer is the most common cancer among women, with one in nine women diagnosed with breast cancer in their lifetime (1). The disease has many manifestations, depending on many factors including genetic mutations in the tumor (2). The ability to classify breast cancers by the types of mutations may prove useful not only for stratification in clinical trials but also for informed treatment decisions. For example, this has been the case for the identification of the HER2-expressing breast cancer and the use of Herceptin for treatment of such patients (3).

Some forms of breast cancer are caused by germ-line mutations. Specifically, mutations in BRCA1 and BRCA2 genes have been identified as high penetrance alleles; however, these alleles explain only a small fraction of familial breast cancers (4, 5, 6). Other high penetrance alleles may exist in a third gene, ATM (7, 8, 9). The first evidence suggesting that ATM was a susceptibility locus for breast cancer was reported by Swift et al.(10) in a study of families affected with A-T3(11). A-T is a progressive neurological disease with childhood onset (11). Female relatives of A-T children had an increased risk of developing breast cancer (12). When molecular markers near the gene became available (13), it was possible to unambiguously identify the individuals in those A-T families who were heterozygous mutation carriers. The results showed that 25 of 33 women with breast cancer were carriers, compared with an expected number of 14.9, representing a relative risk of 6.6 over the noncarriers (14). The elevated risk in obligate carriers was confirmed in a subsequent study (15).

However, it has not been possible to determine the relative risk of breast cancer in ATM mutation carriers in the general population without knowing the specific mutations involved (reviewed in Refs. 16, 17, 18). The published studies have focused mainly on detecting protein-truncating mutations (8, 19, 20, 21, 22); only one showed a higher number of ATM carriers in women with breast cancer compared with controls (8).

Possibly, the association of ATM mutations with breast cancer in A-T families but not necessarily in the general population suggests that ATM mutations might be more important in familial versus sporadic cases of breast cancer. Data from 10 studies, 19 ATM mutation carriers were observed in 448 cases of breast cancer selected for a family history of breast cancer (4.8%; Refs. 23, 24, 25, 26, 27) only 9 carriers were observed in 682 cases not selected for family history [1.5% (Refs. 8, 19, 20, 21, and 28); P = 0.0105].

One recent analysis examined the penetrance of ATM mutations identified both in cases selected for a family history (clinic-based) and cases unselected for a family history of breast cancer (population based; Ref. 9). First, population-based breast cancer cases were screened for two ATM variants associated with A-T (9). Both variants [namely, 7271T>G (V2424G) and IVS10-6T>G] have been previously reported to cause A-T as homozygotes, although patients with 7271T>G had mild clinical symptoms (29, 30). Screening for IVS10-6T>G in 262 population-based cases identified no carriers. Screening for 7271T>G in 525 population-based cases identified only 1 carrier (9). In contrast, when 78 clinic-based breast cancer cases were screened for the two ATM variants, a total of three were segregating for these pathogenic alleles. The estimated penetrance to age 70 of the two alleles was 60% (95% CI, 32–90%).

Consistent with the higher prevalence of ATM mutations in familial cases compared with sporadic cases, the only 7271T>G carrier identified in the population-based group had a family history of breast cancer (9). A similar observation was made in two other studies of breast cancer patients unselected for family history where ATM mutation carriers were identified in individuals who were subsequently found to have a strong family history of breast cancer (23, 30).

In light of the strong association of ATM mutations with familial breast cancer, this study was undertaken as the first comprehensive mutation analysis of ATM in breast and ovarian cancer families. To increase sensitivity, we used a chromatographic method, DHPLC, which has been shown in blinded analyses to be superior to conventional methods (31, 32, 33, 34, 35). Detection of sequence variation by DHPLC is based on differences in retention of perfectly matched homoduplexes and heteroduplexes containing one or more mismatched bp (36, 37). DHPLC was 99% sensitive for detection of sequence variation in ATM in the regions tested, including missense mutations. All 9,168 bp of coding sequence as well as 16,184 bp of flanking intron sequence and untranslated regions of the gene were analyzed.

This study reports the prevalence of ATM mutations in 270 families with a family history of breast or ovarian cancer or both that were collected by the Austrian HBOC Consortium. All of the 270 HBOC families had undergone complete BRCA1 and BRCA2 analysis (35).4 Pedigree analysis was completed for those families where multiple individuals were available for genotyping. The data address the issues of penetrance and prevalence of ATM mutations in breast cancer susceptibility and contribute to a growing body of evidence for a role of ATM mutations in breast cancer susceptibility.

Genomic DNA Samples.

Breast and ovarian cancer families were identified from November 1994 to September of 1999 through the genetic counseling program of the Division of Senology at the University of Vienna (38). These families now constitute the HBOC families. All individuals who donated a blood sample gave written informed consent to participate in the study. Selection criteria for families included at least one of the following: (a) at least two ovarian cancers diagnosed at any age; (b) two first-degree relatives diagnosed with breast cancer before age 50 years; (c) three or more first- or second-degree relatives with breast cancer, with at least two of them diagnosed before age 60 years; (d) at least one patient diagnosed with breast cancer before age 35 years; or (e) at least one male and one female breast cancer in the same lineage at any age. A total of 270 families were analyzed for ATM mutations of 280 families that were analyzed for both BRCA1 and BRCA2 mutations. The 10 families not analyzed for ATM mutations included 10 of the families with BRCA2 mutations. In the majority of families, only a single person donated a blood sample. In 60% of families, the person donating the blood sample had been diagnosed with breast cancer, and in the remainder, it was a young first-degree relative of a breast cancer case. Several groups of healthy controls were analyzed for mutations: (a) 91 women >65 years old who had never had breast cancer and had no family history of breast cancer were collected at the General Hospital of Vienna in Austria in 1996, 1997, and 2002 (52 were completely analyzed for sequence variation in ATM, and 39 were genotyped for the variant L1420F); (b) 31 healthy individuals (25 women and 6 men) >25 years old with no personal or family history of breast cancer collected at the University of Vienna in 2002 were genotyped for two specific variants (L1420F and IVS10-6T>G); and (c) 299 population-based controls including 92 German samples (provided by Curt Scharfe) and 207 samples of mixed European ancestry from the Stanford Autosome Screening Set (provided by Luca Cavalli-Sforza) were genotyped for one specific variant (L1420F).

Statistical Analysis.

The average HR, the ratio of the age-specific incidence in carriers to that in noncarriers (population incidence rates of breast cancer for Vienna; Ref. 39), and hence the average age-specific cumulative risk function (penetrance) were estimated by a modified segregation analysis, the same method used to estimate penetrance from the Australian ATM families (9). Models were fitted under maximum likelihood theory using the statistical package MENDEL (40). The joint likelihood of each family was expressed as a function of the observed breast cancer status; age at last contact, death, or diagnosis; and genotypes of family members. To adjust for ascertainment, the likelihood for each pedigree was conditioned on the breast cancer status of the pedigree members, and the mutation status of the first woman in each family found to carry the family-specific mutation (usually the youngest affected in the family).

PCR.

Genomic DNA was isolated from blood lymphocytes as described previously (41) and used as a template for PCR. Primers for amplification of the coding and flanking intron regions of ATM are listed in Table 1. PCR was performed as described previously (42), with the modification that 25 primers were newly designed for improved performance with DHPLC. Before DHPLC analysis, the amplified PCR products were subjected to a denaturing/reannealing protocol so that the double-stranded DNA would separate and randomly reanneal to form heteroduplexes: 95°C for 3 min; 94°C, decreasing by 1°C/min to 65°C, for 1 min at each new temperature; and then 65°C for 2 min.

DHPLC.

DHPLC was performed on automated high-performance liquid chromatography instrumentation (Rainin Instruments, Woburn, MA; Transgenomic, San Jose, CA). The DNASep column (Transgenomic) contained the stationary phase of 2 μm nonporous alkylated poly(styrene-divinylbenzene) particles. The mobile phase was composed of 0.1 m triethylammonium acetate buffer (pH 7.0; Applied Biosystems, Foster City, CA) and 0.1 mm tetrasodium ethylenediamine-tetraacetic acid (Sigma, St. Louis, MO). A linear acetonitrile (J. T. Baker, Phillipsburg, NJ) gradient was used to elute samples at a 0.9 ml/min flow rate. Each sample run lasted approximately 6 min. Optimum DHPLC gradient and temperature conditions were predicted by WAVEMaker 3.3.4 software (Transgenomic, San Jose, CA) and by the DHPLC Melt program (32). Gradient adjustments were made to ensure elution between 2 and 4 min to maximize resolution of heteroduplex/homoduplex profiles. Table 1 lists the actual gradient(s) and temperature(s) for each primer pair analyzed. Previous publications provide details on DHPLC principle and procedure (36, 43).

Sequencing.

The exact nucleotide changes present in heteroduplexes detected by DHPLC analysis were identified by bidirectional dideoxy sequencing from PCR products. Before sequencing, PCR products were treated with exonuclease I and shrimp alkaline phosphatase (USB Corporation, Cleveland, OH) for 30 min at 37°C and 15 min at 80°C to remove excess deoxynucleotide triphosphates and oligonucleotide primers. Sequencing reactions were performed using sense and antisense primers and either BigDye Deoxy terminator (Applied Biosystems) or Thermo Sequenase II Dye terminator (Amersham Pharmacia Biotech, Piscataway, NJ) chemistries. Samples were purified by extraction with Sephadex G-50 (Amersham Pharmacia Biotech) and then run on ABI Prism 373, 377, or 3700 sequencer systems (Applied Biosystems). Sequences were analyzed with Sequence Navigator 1.0.1 software (Applied Biosystems) or Sequencher 4.0 (GeneCodes, Inc.).

Pathogenic Mutations Found in HBOC Families.

Individuals from 270 HBOC families that had previously been screened for BRCA1 and BRCA2 mutations were analyzed for the presence of ATM mutations. A total of 137 different ATM sequence variants were identified. These included 65 presumed neutral polymorphisms, 64 variants found only in HBOC families, 1 missense mutation associated with breast cancer in 13 HBOC families, and 7 pathogenic mutations that were defined as those that have previously been shown to cause or would be predicted to cause A-T in the homozygous state. The seven mutations were found in 10 HBOC families (3.7%). One mutation was also observed in one healthy control woman over age 65 years, of 112 controls analyzed (0.82%). ATM mutations pathogenic for A-T were 4.5 times more frequent in HBOC families compared with controls, but this was not statistically significant (P = 0.19).

The seven pathogenic ATM mutations found in HBOC families included five that caused a protein truncation and two that caused a missense mutation in the highly conserved region of the protein that includes the catalytic domain with homology to PI3K. None of the families had sufficient numbers of relatives tested for the mutation to allow calculation of a HR and estimate of penetrance. The five different protein-truncating mutations were 687 delA, 1802 G>T, 2465 T>G, 6095 G>A, and IVS10-6 T>G (Table 2). The mutation 687 delA in family M20 resulted in a frameshift, and the mutation 2465T>G in family M51 caused a premature stop. In families M56 and M88, the mutations 1802 G>T and 6095 G>A altered the highly conserved last bases of exons 13 and 43, respectively, and are predicted to result in aberrant splicing, as demonstrated previously for exons 16, 26, 43, and 46 (44, 45). Loss of exon 13 would result in a deletion of 65 amino acids, and loss of exon 43 has been demonstrated to result in a frameshift with protein truncation (45).

Two of the above families with truncating mutations, M20 and M56, had three or more affected family members, with at least two diagnosed with breast cancer before age 50 years, and M51 had both breast and ovarian cancer diagnosed in the family. Only one affected person was genotyped in each of these three families. M88 had one case of ovarian cancer at an early age (age, 42 years) who was a carrier of the mutation. The proband’s mother (age, 75 years), sister (age, 53 years), and niece (age, 29 years) were all healthy, and none of them were carriers. Therefore, the mutant allele was probably paternally inherited. The father and two of his brothers were all affected with brain, liver, or skin cancer.

The most common mutation, IVS10-6T>G, was found in three high-risk families, as well as in 1 healthy 78-year-old woman (WT71) with no family history of breast cancer of 77 healthy women tested. The presence of a healthy carrier suggests that if this allele is pathogenic for breast cancer, it is not fully penetrant. There were two families (F9 and M27) in which more than one family member was available for genotyping. Family F9 had three females genotyped. Two were carriers: one was unaffected at age 75 years; and one developed breast cancer at age 48 years. The other woman was unaffected at age 25 years. Family M27 had two family members genotyped. Both were affected with breast cancer. One was a carrier who developed bilateral breast cancer at age 24 and 27 years, and one was a noncarrier who was diagnosed with breast cancer at age 48 years. The presence of one noncarrier with breast cancer in family M27 suggests either a phenocopy or that other breast cancer susceptibility factors may segregate in this family. However, no BRCA1 or BRCA2 mutations were detected.

Two pathogenic missense mutations altered amino acids in the extreme COOH terminus of ATM (R2912G and M3011V) and were presumed to affect the kinase function of the protein. R2912G was observed in two different HBOC families, F83 and F94. Family F83 had cases of both bilateral breast and ovarian cancer. The three unaffected daughters of the woman with bilateral breast cancer were sampled. Only one daughter (age, 30 years) was a carrier for R2912G, and she also carried a BRCA1 mutation (185delAG, 39stop). None of the affected individuals in the family were available for analysis, so their carrier status for either the ATM or the BRCA1 mutation is not known. Family F94 had breast cancer in both the paternal and maternal lineages. One woman affected with breast cancer (BC 32) and her mother and sister were genotyped. Neither the mother nor sister (age, 34 years) had breast cancer. The mother did not carry R2912G, but both daughters did, so presumably the mutation was paternally derived.

M3011V was found in one family, KN5, for which only one sample was available. The carrier, who was the daughter of the affected person in the family, was 35 years old and had not developed breast cancer.

One ATM family, F83 was concordant for a BRCA1 mutation (1/270), and none of the ATM families had a BRCA2 mutation. Based on the observed carrier frequencies of ATM and BRCA1, only one family would be expected by chance to have both mutations. Therefore, the observations of this study are consistent with an independent role for these ATM mutations in breast cancer susceptibility.

Association of Breast Cancer with Missense Variant L1420F.

The most common missense variant (L1420F) was found in 13 HBOC families (4.8%; summarized in Table 3). To test the possibility that the high prevalence of L1420F in Austrian HBOC families is due to a population-specific founder effect, the variant was genotyped in healthy controls to determine the population frequency. No carriers were detected in 421 controls from Europe, including 92 from Germany and 122 from the same part of Austria in which the affected carriers were found (near Vienna). The difference in the allele frequency in 122 unrelated Austrian controls (0 of 122) compared with 270 unrelated HBOC families (13 of 270) was statistically significant (Fisher’s exact test, P = 0.0112).

A large proportion (5 of 13) of the HBOC families segregating for ATM L1420F also had BRCA1 mutations. In these families, carriers of the L1420F variant were at the same risk as the population while carriers of the BRCA1 mutation were approximately 15 times more likely to be diagnosed with breast cancer compared to the population (HR, 15; 95% CI, 1–243; cumulative risk to age 70 years, 59%; 95% CI, 5–100%). However, in seven families with L1420F only, carriers were approximately 70 times more likely to be diagnosed with breast cancer compared to the population (HR, 76; 95% CI, 5–1227; cumulative risk to age 70, 99%; 95% CI, 25–100%). In family M106, the affected family member carried an uncharacterized BRCA2 variant (7081 A-G, I2361V), as well as another ATM variant (S707P). The two ATM variants are present on different haplotypes (S707P on H2 and L1420F on H4), so it is not possible to rule out that they interact with each other or with the BRCA2 variant to cause breast cancer.

Comparison of BRCA1, BRCA2, and ATM Mutation Carriers.

All 270 families in this study were screened for mutations in BRCA1, BRCA2, and ATM. The description of the BRCA1 and BRCA2 mutations will be published separately.4 Of the 270 families, 19.6% of families had at least one family member with a BRCA1 germ-line mutation, 8.2% had at least one family member with a BRCA2 mutation, 3.7% of families had at least one family member with an ATM mutation pathogenic for A-T, and 4.8% of families had at least one family member with ATM variant L1420F. The results are summarized in Table 4. Families with ATM, ATM-L1420F, or BRCA2 mutations were approximately 1.7 times more likely to have a family history of three or more cases of breast cancer compared with families with a BRCA1 mutation (P = 0.017). Male breast cancer was only found in BRCA2 families, and families with a BRCA1 mutation had 1.7 times more ovarian cancer cases (P = 0.062). The average age of onset of female breast cancer was 42 years for BRCA1, 45 years for BRCA2, 50 years for ATM, and 48 years for ATM-L1420F carriers.

Polymorphic Variants of ATM.

In addition to the pathogenic mutations already described, 129 additional sequence variants were observed in ATM. These included 66 polymorphisms and 63 variants found only in HBOC families. The 66 polymorphisms were found only in the healthy controls or in both controls and patient samples (data not shown). All but two of the polymorphisms have been described previously.5 The two new polymorphisms, –425C>A (exon 1b) and 9475G>A (3′-untranslated region), were found in one control each and may be unique to Austria. One variant previously observed in a breast cancer patient, IVS54 + 8 G>T (23), was only found in one healthy control in this study. The 66 polymorphisms were presumed to be functionally neutral, but no tests were performed to confirm this.

One of the polymorphisms (S707P) and one of the variants found only in HBOC families (A2274A) had a sufficient number of samples to be tested for segregation with breast cancer in HBOC families. Coincidentally, the two variants had previously been reported to be associated with either breast cancer (23, 30) or lymphoma (46). Amino acid 707 of ATM is one of three deleted in an A-T patient (47), leading to the speculation that alterations of this residue might affect ATM function. S707P was found in five different HBOC families in this study and in one healthy woman aged 70 years. In family F16, three breast cancer patients were carriers of a BRCA1 mutation. However, two were noncarriers for S707P, indicating that the BRCA1 mutation was the relevant susceptibility allele in this family. In family F40, the only breast cancer patient genotyped was a carrier for S707P, but the allele was derived from a paternal lineage with no family history of breast cancer. In family M106, the breast cancer patient had an unclassified BRCA2 variant (7081 A-G, I2361V) and L1420F in addition to S707P. The segregation analysis of these families, combined with recent biochemical evidence (48), suggests that this variant is benign for breast cancer susceptibility.

The variant A2274T was located near the COOH terminus of the ATM protein in a region that has weak homology to the Rad3 protein of Schizosaccharomyces pombe. A2274T was recently tested for function and found to have no effect on radiation-induced chromosome breaks, chromosome stability, or the protein phosphorylation activity of ATM (49). However, the amino acid may have a function that is not measured in these assays. Consistent with an alternative function, protein expression was reduced in one B-cell chronic lymphocytic leukemia patient who was a carrier of A2274T (46). A2274T was found in two HBOC families, in which five breast cancer patients were genotyped. Three were carriers, and two were noncarriers. In family F45, two family members were genotyped. One woman affected with breast cancer was not a carrier of the allele, whereas her unaffected daughter (age, 32 years) was a carrier. Therefore, the allele was derived from the paternal lineage, which had no family history of breast cancer. In family F23, 4 affected and 10 unaffected women were genotyped. Three of the four women with breast cancer and three unaffected women (ages, 37, 45, and 47 years) were carriers of the allele. The presence of healthy carriers as well as affected noncarriers in these families suggests that the allele A2274T is not pathogenic for breast cancer.

Potentially Pathogenic Mutations.

Not including A2274T, there were 62 variants found only in HBOC families and not reported previously as polymorphisms.5 As annotated in Table 5, these variants included 18 potential splicing mutations, 8 missense changes in or near putative functional domains, and 1 promoter variant that altered the promoter sequence near the transcription start site of exon 1a (−66 C>G). Three of the missense variants were in both lists because they had a potential effect on splicing, for a total of 24 variants in 26 HBOC families. Two of the variants (P604S and G2023R) were observed previously in breast cancer patients.6

Efficient splicing of many ATM exons, as predicted by their small size or their poor agreement to the splicing consensus sequences (50), is likely to require splicing enhancers to promote splicing at unfavorable splice sites or splicing silencers to repress more favorable splice sites nearby (51, 52). Therefore, sequence changes in an exon or intron near these sites may be predicted to disrupt splicing. Six such sequence changes were observed in seven HBOC families (IVS1a +6 GGC>TGT, 1229 T>C, IVS17-6 T>A, 6067 G>A, IVS45-3 C>T, and 8592 C>T). Splicing may also be altered by nucleotide changes that disrupt ESEs that bind to auxiliary splicing factors called SR proteins (reviewed in Ref. 53). ESEs for four SR proteins were identified in every exon of ATM(54). Then every coding sequence variant identified in HBOC families was tested to identify those that reduced the ESE score below a calculated threshold. Eleven of 24 coding sequence changes from HBOC families eliminated specific consensus motifs (annotated in Table 5). One of these, 735 C>T, was previously observed in an A-T patient who had two other ATM mutations (55) and therefore may represent a polymorphism. In comparison, among the polymorphisms in 52 healthy controls, two of nine coding sequence changes affected SR binding motifs (P = 0.24). Coincidentally, these two were the most common coding sequence variants observed (D126E and D1853N).

Eight potential missense mutations altered amino acids in the protein-protein interaction domains of ATM, including three mentioned above that had a possible effect on splicing. Three of the missense variants (S151F, H231D, and H231R) were in the putative p53 binding domain at the NH2 terminus (56), and they were found in three families. Five variants were in the Rad3 homology (FAT) domain near the COOH terminus of the protein (57) and were found in six families. Three of the five variants in the FAT region (N2343S, I2401T, and C2488Y) produced nonconservative amino acid changes. A fourth variant (V2439A) did not alter a consensus amino acid but was located within 15 amino acids of a mutation that has been shown to have a dominant negative effect on ATM kinase activity (9).

The aim of this study was to assess the relevance of ATM mutations in breast cancer susceptibility in women with a family history of breast or ovarian cancer. We did this by determining the prevalence of ATM mutation carriers in a cohort of 270 multiple case breast cancer families that had previously been analyzed for BRCA1 and BRCA2 mutations. Mutations were detected by DHPLC analysis of PCR fragments amplified from genomic DNA that included all coding and some flanking intronic sequence. The method is 99–100% sensitive for detection of single nucleotide changes and small insertions and deletions, but it does not detect large deletions. However, large deletions are not reported to be common in ATM.

There were 137 different sequence alterations in the ATM gene detected in 270 Austrian HBOC families. Seven mutations were predicted to be pathogenic for A-T in the homozygous state and also presumed to be pathogenic for breast cancer. They were found in 10 different families (3.7%). The proportion of ATM mutation carriers found in this study of Austrian HBOC families is consistent with previous reports, if they are considered together. In the previous studies, 27 ATM mutation carriers were identified in a combined total of 1130 breast cancer patients (2.4%; Refs. 8, 19, 20, 21, and 23, 24, 25, 26, 27, 28). Most of these studies used conventional, gel-based screening methods. It is possible that the higher sensitivity of DHPLC (33) could account for the higher proportion of carriers found here. On the other hand, no ATM mutation carriers were found in a previous study using DHPLC in a cohort of 52 breast cancer patients unselected for family history (28). Therefore, it is more likely that the significant frequency of ATM mutations observed in this cohort is due to their strong family history of breast cancer.

Of the seven A-T pathogenic mutations observed in HBOC families, five caused a protein truncation, and two were missense mutations in the highly conserved COOH terminus of the protein. Three of the detected mutations, IVS10-6T>G, R2912G, and M3011V, had been reported previously in breast cancer patients (8, 9, 23). The first one, IVS10-6T>G, has been shown to have dominant negative activity and to reduce splicing efficiency of exon 11 in vitro(9, 30). However, a low level of incorrectly spliced message has been observed even with the wild-type allele (45). There were three families carrying IVS10-6T>G in this study, as well as one elderly woman who had no family history of breast cancer, suggesting that the mutation is not highly penetrant. The observation of one carrier among the controls is consistent with the estimate of 1–2% carriers in the general population (12, 42). Intriguingly, IVS10-6T>G was the most frequent one identified in population-based cases of breast cancer (8). Perhaps other ATM alleles associated with sporadic breast cancer will also turn out to be low penetrance alleles.

The arginine residue at position 2912 is within a region homologous to the PI3K catalytic domain (58). The PI3K domain is highly conserved in proteins from organisms as diverse as mammals and yeast (13), and the entire region in ATM shows a striking homogeneity both within human populations and between primate orthologues (42). The Arg-2912 residue in question is conserved between Tel1 and the TOR proteins in Saccharomyces cerevisiae, and mammalian DNA-PK. In two other proteins, Rad3 from yeast and Mei41 from Drosophila, there is a conservative change to histidine at that position (13). Therefore, it is likely that the nonconservative amino acid change to glycine could impair the function of the kinase domain. Because ATM is known to phosphorylate several substrates involved in cell cycle control and DNA damage repair, including p53 (56), hRad17 (59), and BRCA1 (60), the observed R2912G mutation could have detrimental effects on genomic stability.

The methionine residue at position 3011 is identical to that of the Arabidopsis thaliana homologue, AtATM, and is within a region of strong homology (61). The homologous region is adjacent to the FATC domain that was identified in several members of a subfamily of PI3K-related kinases (57). The striking similarity between the ATM and AtATM homologues suggests that an amino acid change to valine at position 3011 is likely to disrupt a conserved function.

The existence of breast cancer susceptibility in A-T families predicts that mutations pathogenic for A-T will also be pathogenic for breast cancer. Identification of A-T-causing mutations in HBOC families in this study is consistent with this hypothesis. However, this study and others suggest that missense mutations, which were not detected by protein truncation assays, may be disease related and may play a greater role in breast cancer susceptibility than they do in causing A-T (16, 29). Indeed, several studies have reported a higher frequency of missense mutations in breast cancer compared with control samples (20, 21, 23, 30, 62, 63).

In this study, the missense variant L1420F segregated with breast cancer in HBOC families with no BRCA1 or BRCA2 mutation and was assumed to be an independent susceptibility allele. It did not cause A-T in homozygotes (30). However, it was observed in 13 HBOC families (4.8%), but in no controls (0 of 122). Its high frequency, combined with its location near c-abl interaction domain (64) suggested that it might be functionally relevant.

Despite this, L1420F was reported in 17 of 500, 2 of 81, and 3 of 123 random controls from Germany, the United States, and Sweden, respectively (23, 24, 30), for an average allele frequency of 3.1% in those populations. However, the random ascertainment of controls in these studies would be expected to include women affected with breast cancer, as well as carriers of predisposing alleles. In this study, only individuals with no family history of breast cancer were used as controls, allowing estimation of the allele frequency in women without a genetic predisposition to breast cancer. This may explain the discrepancy between the studies.

In contrast, two missense variants, S707P and A2274T, which were previously reported to be associated with breast cancer (23, 30) or lymphoma (46), did not segregate with breast cancer in HBOC families. Therefore, they are likely to be polymorphisms.

There were 62 potentially functional variants observed in 65 HBOC families (Table 5). Five variants were observed in the FAT domain of ATM adjacent to the kinase domain (57) and found in six HBOC families (2.2%). Two different variants in this region (L2307F and L2330V) were previously reported in another breast cancer cohort (23). The existence of evolutionary constraint in the FAT domain, especially in the higher primates (42), underscores the importance of this region for the function of human ATM. At least two missense variants (V2424G and Y2470D) in this region have been reported to have a dominant negative effect on protein function or protein stability, suggesting that the region may be important for protein-protein interactions (9, 65). A third missense variant in the region (S2592C) was shown by transfection studies to be nonfunctional for kinase activity (49). In addition, a nearby deletion of three amino acids (SRI2546del) resulted in cancer susceptibility in mice (66, 67). However, one variant in the FAT region (C2464R) had normal protein activity (49), suggesting that not all such changes are deleterious.

Eighteen variants observed in 19 HBOC families (7.0%) had potential splicing defects. Six variants affected splice sites with weak homology to the consensus, either by creating a new splice donor or acceptor site or by modifying an existing one. Twelve additional variants were predicted to eliminate an ESE. Splicing mutations have been reported to be common in ATM(44, 45), possibly reflecting the complexity of exon splicing in this large gene. Functional studies will be necessary to determine the relevance of the missense and splicing variants found in Austrian HBOC families for breast cancer pathogenesis.

In summary, the data presented here are consistent with the hypothesis that A-T-causing mutations and possibly one missense variant (L1420F) cause an elevated risk for breast cancer in women and that the alleles are sufficiently penetrant to generate multiple-case families. Of the 270 HBOC families, BRCA1 mutations were associated with 19.6%, BRCA2 mutations were associated with 8.2%, and ATM mutations (including L1420F) were associated with 8.5%. Additional ATM variants of potential significance raise the possibility that the contribution of ATM mutations to familial breast cancer could be even higher. Thus, ATM may be at least as important as BRCA2 in explaining familial breast cancer. Taken together with other published studies, our data provide further evidence for the existence of mutations in the human ATM gene that confer breast cancer susceptibility. Future work is now imperative to get a more precise estimate of the prevalence of ATM mutations that are pathogenic for breast cancer, possibly by using expression analysis to identify heterozygous carriers (68).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

Supported by Austrian National Bank Grant 9981 (to T. M. U. W.) and NIH Grants GM28428 and HG00205 (to P. J. O. and R. W. D.) and R01-CA77302 (to G. C.).

3

The abbreviations used are: A-T, ataxia-telangiectasia; HBOC, hereditary breast and ovarian cancer; CI, confidence interval; HR, hazard ratio; DHPLC, denaturing high-performance liquid chromatography; PI3K, phosphatidylinositol 3-kinase; ESE, exon splicing enhancer motif.

4

R. Kroiss, P. Shen, D. Muhr, V. Chou, D. P. Wall, D. Richards, E. Kubista, L. Jin, T. M. U. Wagner, and P. J. Oefner. Clinical and population genetic multiplications of BRCA1 sequence variation in 268 Austrian breast and ovarian cancer families and 111 controls of worldwide populations, manuscript in preparation.

5

http://vmresearch.org/atm/atmpoly.htm.

6

http://vmresearch.org/atm/atmcarr.htm.

Table 1

Primers and DHPLC conditions for human ATM mutation analysis

ATM exonForward primerReverse primerLength (bp)DHPLC Temp (°C)Gradient (% buffer B)
1a AATGTTTTGGGGCAGTGTTT AGGAAAGATGGAGTGAGGAGAG 412 63 56-59-64 
1b 1 GACTCCTCCCTCTCCTCACTC CCATCTGGAAGGCTTCTACC 556 60 50-56.5-63.7 
1b & 2 TGCAAACTCAGCCTGAGACT CATGCCATTCTTTTCTAGTGC 532 59 57-60-65 
TTTGAACCTTGAGTGGAACCT ACAGAAGATGCTCATTCACTGA 511 56 50-56-61.5 
4 & 5 TACACATTTTTTCACACCTCTTTC AGGCATAATGATATATAGGAAGCA 496 54 50-56-61.5 
ATTGGTCTTGTAGGAGTTAGGC AAAAACTCACGCGACAGTAATC 392 56 50-56-61.5 
TTGCCAATTTCTTCTCTACAAAAG TTAAGGGTCAGTTCGATAACCATA 454 55 50-57-62.5 
CTTTTTCTGTATGGGATTATGGA TTCTGTTATGATGGATCAATGTTT 390 49, 54 56-59-64, 55-58-63 
CAGCATACCACTTCATAACTG TCATATCCTCCTAAAGAACAC 412 51, 55.5 56-59-64, 54-57-62 
10 CTAGCAGTGTAAACAGAGTA ATAGGCTTTTTGTGAGAACA 325 54 56-59-64 
11 GATCGTGCTGTTCCACTCC GATGAAAGGATTCCACTGAAAG 350 54, 55.5 55-58-63, 53-56-61 
12 TGTGATGGAATAGTTTTCAA AGTAACAAACTATGAAAATGA 511 53, 57.5 57-60-65, 55-58-63 
13 CCAGGCACTGTCCTGATAGATAAA AGTGGAGAGAGCCTGATAAAACAA 335 57.5 52-55-60 
14 GATGAAAGCAATTTTAATCTAGGA TCAGTTTTTCTCATTGGCACTT 482 53 57-60-65 
15 CATATAAGGCAAAGCATTAG AGTTTACCAAAGTTGAATCATA 350 52, 56.5 54-57-62, 51-54-59 
16 GTTGTTTTTAGAGCTATCCAGGA CTGCATCATGTACCCCAGAAC 502 51, 55 50-56.5-62, 50-53-59.3 
17 CGTGGAACTTCTAAAAACATTTC CAAAACAGTAACACCAACCAGT 517 54, 57 50-59-64.5, 50-56.5-62 
18 ATTGTTTTTATTTCTTTGTTGCTT GGCCTTAATTTCCACATTTGTA 275 54 55-58-63 
19 TTAGGTAAATTTTGACTACAGCA GAACAATCCTAAAAGGCTATACT 415 57 52-55-60 
20 CTTTTTTTTGTGAAGAGGAGGA TTTCAATTCTTCAAAGACACCA 400 56 54-57-62 
21 TAAAGTAAATGATTTGTGGATA GAAGGACATGGTTTAAAATAG 305 54 53-56-61 
22 TTTTTTTTTTTACCACAGCAAT GAAAGCCAAGCCTTAAACAA 368 56 55-58-63 
23 & 24 TAGCACAGAAAGACATATTGGAAG TGTAAGACATTCTACTGCCATCTG 491 55 57-60-65 
25 AGCTGCTGGTCTGAACCTCTTTA TTGCTATGATTTGACCCATTGTG 488 55 55-58-63 
26 TGGAGTTCAGTTGGGATTTTA TTCACAGTGACCTAAGGAAGC 303 50, 55 53-56-61, 49-52-57 
27 TGTTGTTTCTAGGTCCTACTCT GTATGTGTGTTGCTGGTGAG 356 53 55-58-63 
28 TGCTGATGGTATTAAAACAGTTT GGTTGGCTATGCTAGATAATGAT 485 51, 55 50-57.7-64, 50-54.7-60.2 
29 GAGCTGTCTTGACGTTCACAG TTAAAAAGAGTGATGTCTATAA 290 52, 56 50-53-60.2, 50-50.1-57.3 
30 TTTTCATTTTGGAAGTTCACTG AGTGTCACAAGATTCTGTTCTCA 416 54 54-57-62 
31 CTGAAAATTAAATAAATTGGCAAT AAAACAGGAAGAACAGGATAGAAA 475 50, 53 57-60-65, 55-58-63 
32 GAATTAGAGATGCTGAACAAAAG TCAAAAGTACCAAGTGCTCTGT 464 56 53-56-61 
33 TATTGGCATTTTTTTTAACCTCA ATTCCATTTTTTACTGCTAGAGC 481 52 57-60-65 
34 AACATTGTAGGGTTTGCAGTGGA CTGGCAGAGGATGAATAAAACAG 512 56 50-56-63.2 
35 GCAATTATAAACAAAAAGTGT TATATGTGATCCGCAGTTGAC 216 53, 57 50-53-58, 48-51-56 
36 CAGCATTATAGTTTTGAAAT GTGTGAAGTATCATTCTCCA 326 55 52-55-60 
37 CAGTGGAGGTTAACATTCATCA GGCTTAAATTACTTATAGGAAAGG 346 55 50-53-59.3 
38 AACCTAATTTTTCTGCTGCCTAA GAGTGGGGGTGATATTATGTGA 501 55 56-59-64 
39 GCAGTATGTTGAGTTTATGGCA GCAACTGTTGGCAACTTTTAT 481 54, 56 50-56.5-62, 50-52-57.5 
40 CCTATTAAATTCCTTCAGAACCA CTGATTTAACCAAACTGCTATCC 415 52, 57 56-59-64, 54-57-62 
41 TGTGGTTTTTGGGAATTTGTA ATCTTTTAAATGGGGAACAGG 387 54 55-58-63 
42 TTTGTTTGCCACCTTCATTAG AAATTCAGTTTAAAAATCACATGG 301 54 50-53-58.5 
43 & 44 AAATTTGCTAAATTTATAGACCGA AGTGATGGCTTTACCAAATCTGG 392 54, 57 55-58-63, 51-54-59 
45 TTTGCTGTTTTTTTCTCTGGT CAGTTGTTGTTTAGAATGAGGAGA 284 56 53-56-61 
46 ATTTTGTCCTTTGGTGAAGCTA CAAGTTTTCAGAAAAGAAGCCA 258 53 52-55-60 
47 GCAAAGCCTATGATGAGAACTC CAGAAAAGCTGCACTTTAGGAT 267 54, 59 51-54-59, 48-51-56 
48 TCTTGTCACTACAAAAGTTCCTTT TCTTTTTCCCTCAGGCTTTC 444 53, 57 56-59-64, 54-57-62 
49 AAAGTATTTATTCCCATATGTCAT GTAAAACACTAATCCAGCCAATA 238 55, 58 51-54-59, 49-52-57 
50 CAAAAGCAGATGAGGAAAAAC TCTTGATGAAAAGATGAAGCAT 324 57 52-55-60 
51 GTGTATTACCTTAATTTGAGTG CCAAAAGACCAAGATAATCT 451 55 50-56.5-63.7 
52 TCCTTAGAAGTTTGCTTTTTTC CTGGACCAAGTGCTAGGAATA 450 57 54-59-64 
53 CTAGAGTACCCATTAGAAAGACCT GTGTATGCCTGCATGTGTGA 504 50, 55 57-60-65, 55-58-63 
54 CCCTCTAAGAAATGGAAATACA GCCTTGAACCGATTTTAGAT 511 56 55-58-63 
55 TGACTGTTTTGTTTGTATCTGAGG GAGTAACACAGCAAGAAAGTAACG 334 55 50-56-63.2 
56 TCTGCTGACTATTCCTGCTTG CTTGGGCAAAGGAAATATAATAC 320 54 54-57-62 
57 ACCCGGCCTAAAGTTGTAGT AATGGAGAAAAGCCTGGTTC 459 56 55-58-63 
58 TTTGCTATTCTCAGATGACTCT ATGTTTTTGGTGAACTAACAGAAG 232 56 48-51-56 
59 GCTGAATGATCATCAAATGCTCT ATAATATCTGACAGCTGTCAGCT 295 53, 58 53-56-61, 51-54-59 
60 TTTATTGCCCCTATATCTGTCAT AAAAAGTGCTGAATCAAACAAA 345 51, 55 50-57.5-63, 50-55.5-61 
61 TGCACATCATTTAAGTAGGCTAA GGTAGGCAAACAACATTCCA 298 53 53-56-61 
62 GTGGTTTCTTGCCTTTGTAAAGTT AATCCTCCCACTTCAGCCTCTT 323 58 52-55-60 
63 TAGGCTCAGCATACTACACAT GACGAGATACACAGTCTACCT 223 55 50-53-58 
64 & 65 GGCTTATTTGTATGATACTGGTTC CTAAAGGCTGAATGAAAGGGTA 555 54, 58 58-61-66, 56-59-64 
UTR-1 TACCCTTTCATTCAGCCTTTAG TTTTTTTTTTGAGATGGAGTTTC 515 55, 61 50-58.5-64, 50-55.5-61 
UTR-2 GGATTTTTCCTAGTAAGATCACTCAG GGGAATATGACATAAACAGACACTC 549 53 61-64-69 
UTR-3 AGGCTTTATCTATGGGAATCTT AGAGGTGAATATGTGAGCTGAT 412 59 50-55-60.5 
UTR-4 ATCAGCTCACATATTCACCTCT TCCTTACGGTCAAAAATGAG 360 61 53-56-61 
UTR-5 TGCTGGGATTACAGGTGTGA GCTGGGATGAACATTTTCCTA 325 60 46-49-54 
UTR-6 CTCATTTTTGACCGTAAGGA AAGTTCTGGAGATTGGTTTTAG 453 56 56-59-64 
UTR-7 CCTCCCCTAAAACCAATCT AGTTATTTCTCCTAGGCTTGTG 459 54 56-59-64 
UTR-8 ATGGCTTTGAAAAGTTTATCA TAGGGTGGGAAAGCTATTATC 399 56 56-59-64 
UTR-9 ATGAAAACCAAATAGTGAAGC TGGCACACAGAACACACAA 508 55 55-58-63 
ATM exonForward primerReverse primerLength (bp)DHPLC Temp (°C)Gradient (% buffer B)
1a AATGTTTTGGGGCAGTGTTT AGGAAAGATGGAGTGAGGAGAG 412 63 56-59-64 
1b 1 GACTCCTCCCTCTCCTCACTC CCATCTGGAAGGCTTCTACC 556 60 50-56.5-63.7 
1b & 2 TGCAAACTCAGCCTGAGACT CATGCCATTCTTTTCTAGTGC 532 59 57-60-65 
TTTGAACCTTGAGTGGAACCT ACAGAAGATGCTCATTCACTGA 511 56 50-56-61.5 
4 & 5 TACACATTTTTTCACACCTCTTTC AGGCATAATGATATATAGGAAGCA 496 54 50-56-61.5 
ATTGGTCTTGTAGGAGTTAGGC AAAAACTCACGCGACAGTAATC 392 56 50-56-61.5 
TTGCCAATTTCTTCTCTACAAAAG TTAAGGGTCAGTTCGATAACCATA 454 55 50-57-62.5 
CTTTTTCTGTATGGGATTATGGA TTCTGTTATGATGGATCAATGTTT 390 49, 54 56-59-64, 55-58-63 
CAGCATACCACTTCATAACTG TCATATCCTCCTAAAGAACAC 412 51, 55.5 56-59-64, 54-57-62 
10 CTAGCAGTGTAAACAGAGTA ATAGGCTTTTTGTGAGAACA 325 54 56-59-64 
11 GATCGTGCTGTTCCACTCC GATGAAAGGATTCCACTGAAAG 350 54, 55.5 55-58-63, 53-56-61 
12 TGTGATGGAATAGTTTTCAA AGTAACAAACTATGAAAATGA 511 53, 57.5 57-60-65, 55-58-63 
13 CCAGGCACTGTCCTGATAGATAAA AGTGGAGAGAGCCTGATAAAACAA 335 57.5 52-55-60 
14 GATGAAAGCAATTTTAATCTAGGA TCAGTTTTTCTCATTGGCACTT 482 53 57-60-65 
15 CATATAAGGCAAAGCATTAG AGTTTACCAAAGTTGAATCATA 350 52, 56.5 54-57-62, 51-54-59 
16 GTTGTTTTTAGAGCTATCCAGGA CTGCATCATGTACCCCAGAAC 502 51, 55 50-56.5-62, 50-53-59.3 
17 CGTGGAACTTCTAAAAACATTTC CAAAACAGTAACACCAACCAGT 517 54, 57 50-59-64.5, 50-56.5-62 
18 ATTGTTTTTATTTCTTTGTTGCTT GGCCTTAATTTCCACATTTGTA 275 54 55-58-63 
19 TTAGGTAAATTTTGACTACAGCA GAACAATCCTAAAAGGCTATACT 415 57 52-55-60 
20 CTTTTTTTTGTGAAGAGGAGGA TTTCAATTCTTCAAAGACACCA 400 56 54-57-62 
21 TAAAGTAAATGATTTGTGGATA GAAGGACATGGTTTAAAATAG 305 54 53-56-61 
22 TTTTTTTTTTTACCACAGCAAT GAAAGCCAAGCCTTAAACAA 368 56 55-58-63 
23 & 24 TAGCACAGAAAGACATATTGGAAG TGTAAGACATTCTACTGCCATCTG 491 55 57-60-65 
25 AGCTGCTGGTCTGAACCTCTTTA TTGCTATGATTTGACCCATTGTG 488 55 55-58-63 
26 TGGAGTTCAGTTGGGATTTTA TTCACAGTGACCTAAGGAAGC 303 50, 55 53-56-61, 49-52-57 
27 TGTTGTTTCTAGGTCCTACTCT GTATGTGTGTTGCTGGTGAG 356 53 55-58-63 
28 TGCTGATGGTATTAAAACAGTTT GGTTGGCTATGCTAGATAATGAT 485 51, 55 50-57.7-64, 50-54.7-60.2 
29 GAGCTGTCTTGACGTTCACAG TTAAAAAGAGTGATGTCTATAA 290 52, 56 50-53-60.2, 50-50.1-57.3 
30 TTTTCATTTTGGAAGTTCACTG AGTGTCACAAGATTCTGTTCTCA 416 54 54-57-62 
31 CTGAAAATTAAATAAATTGGCAAT AAAACAGGAAGAACAGGATAGAAA 475 50, 53 57-60-65, 55-58-63 
32 GAATTAGAGATGCTGAACAAAAG TCAAAAGTACCAAGTGCTCTGT 464 56 53-56-61 
33 TATTGGCATTTTTTTTAACCTCA ATTCCATTTTTTACTGCTAGAGC 481 52 57-60-65 
34 AACATTGTAGGGTTTGCAGTGGA CTGGCAGAGGATGAATAAAACAG 512 56 50-56-63.2 
35 GCAATTATAAACAAAAAGTGT TATATGTGATCCGCAGTTGAC 216 53, 57 50-53-58, 48-51-56 
36 CAGCATTATAGTTTTGAAAT GTGTGAAGTATCATTCTCCA 326 55 52-55-60 
37 CAGTGGAGGTTAACATTCATCA GGCTTAAATTACTTATAGGAAAGG 346 55 50-53-59.3 
38 AACCTAATTTTTCTGCTGCCTAA GAGTGGGGGTGATATTATGTGA 501 55 56-59-64 
39 GCAGTATGTTGAGTTTATGGCA GCAACTGTTGGCAACTTTTAT 481 54, 56 50-56.5-62, 50-52-57.5 
40 CCTATTAAATTCCTTCAGAACCA CTGATTTAACCAAACTGCTATCC 415 52, 57 56-59-64, 54-57-62 
41 TGTGGTTTTTGGGAATTTGTA ATCTTTTAAATGGGGAACAGG 387 54 55-58-63 
42 TTTGTTTGCCACCTTCATTAG AAATTCAGTTTAAAAATCACATGG 301 54 50-53-58.5 
43 & 44 AAATTTGCTAAATTTATAGACCGA AGTGATGGCTTTACCAAATCTGG 392 54, 57 55-58-63, 51-54-59 
45 TTTGCTGTTTTTTTCTCTGGT CAGTTGTTGTTTAGAATGAGGAGA 284 56 53-56-61 
46 ATTTTGTCCTTTGGTGAAGCTA CAAGTTTTCAGAAAAGAAGCCA 258 53 52-55-60 
47 GCAAAGCCTATGATGAGAACTC CAGAAAAGCTGCACTTTAGGAT 267 54, 59 51-54-59, 48-51-56 
48 TCTTGTCACTACAAAAGTTCCTTT TCTTTTTCCCTCAGGCTTTC 444 53, 57 56-59-64, 54-57-62 
49 AAAGTATTTATTCCCATATGTCAT GTAAAACACTAATCCAGCCAATA 238 55, 58 51-54-59, 49-52-57 
50 CAAAAGCAGATGAGGAAAAAC TCTTGATGAAAAGATGAAGCAT 324 57 52-55-60 
51 GTGTATTACCTTAATTTGAGTG CCAAAAGACCAAGATAATCT 451 55 50-56.5-63.7 
52 TCCTTAGAAGTTTGCTTTTTTC CTGGACCAAGTGCTAGGAATA 450 57 54-59-64 
53 CTAGAGTACCCATTAGAAAGACCT GTGTATGCCTGCATGTGTGA 504 50, 55 57-60-65, 55-58-63 
54 CCCTCTAAGAAATGGAAATACA GCCTTGAACCGATTTTAGAT 511 56 55-58-63 
55 TGACTGTTTTGTTTGTATCTGAGG GAGTAACACAGCAAGAAAGTAACG 334 55 50-56-63.2 
56 TCTGCTGACTATTCCTGCTTG CTTGGGCAAAGGAAATATAATAC 320 54 54-57-62 
57 ACCCGGCCTAAAGTTGTAGT AATGGAGAAAAGCCTGGTTC 459 56 55-58-63 
58 TTTGCTATTCTCAGATGACTCT ATGTTTTTGGTGAACTAACAGAAG 232 56 48-51-56 
59 GCTGAATGATCATCAAATGCTCT ATAATATCTGACAGCTGTCAGCT 295 53, 58 53-56-61, 51-54-59 
60 TTTATTGCCCCTATATCTGTCAT AAAAAGTGCTGAATCAAACAAA 345 51, 55 50-57.5-63, 50-55.5-61 
61 TGCACATCATTTAAGTAGGCTAA GGTAGGCAAACAACATTCCA 298 53 53-56-61 
62 GTGGTTTCTTGCCTTTGTAAAGTT AATCCTCCCACTTCAGCCTCTT 323 58 52-55-60 
63 TAGGCTCAGCATACTACACAT GACGAGATACACAGTCTACCT 223 55 50-53-58 
64 & 65 GGCTTATTTGTATGATACTGGTTC CTAAAGGCTGAATGAAAGGGTA 555 54, 58 58-61-66, 56-59-64 
UTR-1 TACCCTTTCATTCAGCCTTTAG TTTTTTTTTTGAGATGGAGTTTC 515 55, 61 50-58.5-64, 50-55.5-61 
UTR-2 GGATTTTTCCTAGTAAGATCACTCAG GGGAATATGACATAAACAGACACTC 549 53 61-64-69 
UTR-3 AGGCTTTATCTATGGGAATCTT AGAGGTGAATATGTGAGCTGAT 412 59 50-55-60.5 
UTR-4 ATCAGCTCACATATTCACCTCT TCCTTACGGTCAAAAATGAG 360 61 53-56-61 
UTR-5 TGCTGGGATTACAGGTGTGA GCTGGGATGAACATTTTCCTA 325 60 46-49-54 
UTR-6 CTCATTTTTGACCGTAAGGA AAGTTCTGGAGATTGGTTTTAG 453 56 56-59-64 
UTR-7 CCTCCCCTAAAACCAATCT AGTTATTTCTCCTAGGCTTGTG 459 54 56-59-64 
UTR-8 ATGGCTTTGAAAAGTTTATCA TAGGGTGGGAAAGCTATTATC 399 56 56-59-64 
UTR-9 ATGAAAACCAAATAGTGAAGC TGGCACACAGAACACACAA 508 55 55-58-63 
Table 2

Pathogenic ATM mutations observed in HBOC families

Genomic positionSequence changeAmino acid changeFamily no.BRCA1/2 status
32497 687 delA L229fs M20 No BRCA1/2 
39713 1802 G>T Exon 13 deleted M88 No BRCA1/2 
46755 2465 T>G L822stop M56 No BRCA1/2 
103581 6095 G>A Exon 43 deleted M51 No BRCA1/2 
36612a IVS10-6 T>G Exon 11 deleted A5 No BRCA1/2 
   F9 No BRCA1/2 
   M27 No BRCA1/2 
141677 8734 A>G R2912G (nc) F94 No BRCA1/2 
   F83 BRCA1 carrier 
153223 9031 A>G M3011V (c) KN5 No BRCA1/2 
Genomic positionSequence changeAmino acid changeFamily no.BRCA1/2 status
32497 687 delA L229fs M20 No BRCA1/2 
39713 1802 G>T Exon 13 deleted M88 No BRCA1/2 
46755 2465 T>G L822stop M56 No BRCA1/2 
103581 6095 G>A Exon 43 deleted M51 No BRCA1/2 
36612a IVS10-6 T>G Exon 11 deleted A5 No BRCA1/2 
   F9 No BRCA1/2 
   M27 No BRCA1/2 
141677 8734 A>G R2912G (nc) F94 No BRCA1/2 
   F83 BRCA1 carrier 
153223 9031 A>G M3011V (c) KN5 No BRCA1/2 
a

This mutation was also observed in one healthy woman, age 78, with no personal or family history of breast cancer.

Table 3

Genotypes of women in HBOC families with at least one carrier of ATM variant L1420F

Family designationBreast cancer status and ageATM mutation statusBRCA1 mutation status
F32 BCa 42 Carrier Carrier (C61G) 
 Healthy 49 Noncarrier Noncarrier 
 Healthy 49 Carrier Noncarrier 
 Healthy 41b Carrier Carrier (C61G) 
 Healthy 27 Noncarrier Noncarrier 
 Healthy 51 Noncarrier Noncarrier 
F38 Healthy 25 Carrier Noncarrier 
F43 Healthy 58 Noncarrier Noncarrier 
 BC 56 Carrier Noncarrier 
F64 BC 72 Carrier Carrier (R1347G) 
 OC 30 Noncarrier Carrier (R1347G) 
 Healthy 35 Noncarrier Carrier (R1347G) 
F90 BC 33, OC 42 Carrier Carrier (W321X) 
 OC 45 Carrier Carrier (W321X) 
 Healthy 35 Carrier Noncarrier 
 Healthy 26 Noncarrier Carrier (W321X) 
 Healthy 27 Noncarrier Noncarrier 
F96 BC 46 Carrier Noncarrier 
 Healthy 45b Carrier Noncarrier 
M1 Healthy 33 Carrier Noncarrier 
M6 Healthy 39 Noncarrier Carrier (C61G) 
 Healthy 38 Noncarrier Carrier (C61G) 
 Healthy 57 Noncarrier Carrier (C61G) 
 Healthy 19 Carrier Noncarrier 
 Healthy 38 Noncarrier Noncarrier 
M50 Healthy 32 Carrier Noncarrier 
M78 Healthy 37 Carrier Noncarrier 
 Healthy 32 Carrier Noncarrier 
M106c BC 26 Carrier Noncarrier 
M118 Healthy 31 Carrier Noncarrier 
 BC 51 Carrier Noncarrier 
V4 BC 38 Unknown Carrier (577X) 
 Healthy 38 Noncarrier Noncarrier 
 Healthy 43 Carrier Carrier (577X) 
Family designationBreast cancer status and ageATM mutation statusBRCA1 mutation status
F32 BCa 42 Carrier Carrier (C61G) 
 Healthy 49 Noncarrier Noncarrier 
 Healthy 49 Carrier Noncarrier 
 Healthy 41b Carrier Carrier (C61G) 
 Healthy 27 Noncarrier Noncarrier 
 Healthy 51 Noncarrier Noncarrier 
F38 Healthy 25 Carrier Noncarrier 
F43 Healthy 58 Noncarrier Noncarrier 
 BC 56 Carrier Noncarrier 
F64 BC 72 Carrier Carrier (R1347G) 
 OC 30 Noncarrier Carrier (R1347G) 
 Healthy 35 Noncarrier Carrier (R1347G) 
F90 BC 33, OC 42 Carrier Carrier (W321X) 
 OC 45 Carrier Carrier (W321X) 
 Healthy 35 Carrier Noncarrier 
 Healthy 26 Noncarrier Carrier (W321X) 
 Healthy 27 Noncarrier Noncarrier 
F96 BC 46 Carrier Noncarrier 
 Healthy 45b Carrier Noncarrier 
M1 Healthy 33 Carrier Noncarrier 
M6 Healthy 39 Noncarrier Carrier (C61G) 
 Healthy 38 Noncarrier Carrier (C61G) 
 Healthy 57 Noncarrier Carrier (C61G) 
 Healthy 19 Carrier Noncarrier 
 Healthy 38 Noncarrier Noncarrier 
M50 Healthy 32 Carrier Noncarrier 
M78 Healthy 37 Carrier Noncarrier 
 Healthy 32 Carrier Noncarrier 
M106c BC 26 Carrier Noncarrier 
M118 Healthy 31 Carrier Noncarrier 
 BC 51 Carrier Noncarrier 
V4 BC 38 Unknown Carrier (577X) 
 Healthy 38 Noncarrier Noncarrier 
 Healthy 43 Carrier Carrier (577X) 
a

BC, breast cancer; OC, ovarian cancer.

b

This individual had an oophorectomy.

c

Uncharacterized variants of BRCA2 (I2361V) and ATM (S707P) were also segregating in this family.

Table 4

Comparison of family histories in families carrying ATM, BRCA1, and BRCA2 mutations

A total of 270 families were analyzed for ATM mutations of 280 families that were analyzed for both BRCA1 and BRCA2 mutations. The 10 families not analyzed for ATM mutations included 10 of the families with BRCA2 mutations.

N families/totalMean age BC onset (yrs)aFamilies with one or two BCFamilies with three or more BCFamilies with any OCFamilies with male BC
ATM 10/270 50 
ATM-L1420F 13/270 48 
BRCA1 55/280 42 11 19 25 
BRCA2 23/280 45 14 
N families/totalMean age BC onset (yrs)aFamilies with one or two BCFamilies with three or more BCFamilies with any OCFamilies with male BC
ATM 10/270 50 
ATM-L1420F 13/270 48 
BRCA1 55/280 42 11 19 25 
BRCA2 23/280 45 14 
a

BC, breast cancer; OC, ovarian cancer.

Table 5

ATM variants found only in HBOC families

Genomic positionDNA sequence changeAmino acid changeaNo. of familiesPossible function altered by variant
Variants with possible effect on splicing     
 10893 IVS1a+6 GGC>TGT  Modifies splice donor 
 32501 691 C>G H231D (nc) p53 binding, ESE (SRp55) 
 32545 735 C>T V245V ESE (SRp40) 
 36781 1229 T>C V410A (nc) ESE (type unknown) 
 46661 IVS17-6 T>A  Modifies splice acceptor 
 54994 2610 C>T N870N ESE (SF2/ASF) 
 58951 2941 C>T R981C (nc) ESE (SRp55) 
 75445 IVS29+54 A>T  Creates splice donor 
 77208 IVS30-71 A>G  Creates splice acceptor 
 80330 4473 C>T F1491F ESE (SF2/ASF, SRp40) 
 98060 IVS41+72 A>G  Creates splice donor 
 103699 6114 C>T H2038H ESE (SF2/ASF) 
 107621 IVS45-3 C>T  Modifies splice acceptor 
 115362b 7028 A>G N2343S (c) FAT domain, ESE (SRp40) 
 118034 7463 G>T C2488Y (nc) FAT domain, ESE (SC35) 
 119114 7521 C>T D2507D ESE (SF2/ASF) 
 119368 IVS53+146 A>G  Creates splice donor 
 134950 8592 C>T Y2864Y ESE (possibly SRp55) 
     
Possible effect on protein-protein interactions     
 23487 452 C>T S151F (nc) p53 binding 
 32501 691 C>G H231D (nc) p53 binding, ESE (SRp55) 
 32502 692 A>G H231R (nc) p53 binding 
 113744 6829 C>G Q2277E (c) FAT domain 
 115362b 7028 A>G N2343S (c) FAT domain, ESE (SRp40) 
 116798 7202 T>C I2401T (nc) FAT domain 
 117887 7316 T>C V2439A (nc) FAT domain 
 118034 7463 G>T C2488Y (nc) FAT domain, ESE (SC35) 
     
Other variants found only in HBOC families     
 10656 PRO(−66) C>G  Promoter 
 11036 IVS1a-36 C>T   
 11132 UTR(−734) C>T   
 11157 UTR(−709) A>G   
 11207 UTR(−659) A>G   
 11515 UTR(−351) C>T   
 15564 162 T>C Y54Y  
 23626 IVS7+95 G>C   
 32494 684 T>C G228G  
 38583 1436 A>G D479G (nc)  
 40506 1810 C>T P604S (nc) Found in breast cancer 
 44043 IVS16+22 A>C   
 44055 IVS16+34 A>C   
 44166 IVS16+145 A>G   
 46455 IVS17-212 G>A   
 59162 IVS22+75 T>A   
 59195 IVS22+108 A>T   
 60308 IVS23+20 T>C   
 67047 IVS24-124 G>T   
 67417 IVS25+129 A>C   
 68660 IVS25-15 T>A   
 80866 IVS32-122 G>T   
 92641 IVS39+116 T>C   
 95684 IVS40+27 G>A   
 95696 IVS40+39 G>C   
 97960 5890 A>G K1964E (c)  
 103553c 6067 G>A G2023R (nc) Found in breast cancer 
 107570 IVS45-54 T>C   
 108932 IVS46-39 C>T   
 115233 IVS49-77 T>C   
 120323 IVS54-104 C>T   
 121745 IVS56+112 T>C   
 133352 IVS59-55 del6   
 142766 IVS63+37 delTT   
 154582 10390 delTCC   
 155515 11323 G>A   
 155561 11369 C>G   
 155969 11777 T>C   
 156453 12261 G>A   
Genomic positionDNA sequence changeAmino acid changeaNo. of familiesPossible function altered by variant
Variants with possible effect on splicing     
 10893 IVS1a+6 GGC>TGT  Modifies splice donor 
 32501 691 C>G H231D (nc) p53 binding, ESE (SRp55) 
 32545 735 C>T V245V ESE (SRp40) 
 36781 1229 T>C V410A (nc) ESE (type unknown) 
 46661 IVS17-6 T>A  Modifies splice acceptor 
 54994 2610 C>T N870N ESE (SF2/ASF) 
 58951 2941 C>T R981C (nc) ESE (SRp55) 
 75445 IVS29+54 A>T  Creates splice donor 
 77208 IVS30-71 A>G  Creates splice acceptor 
 80330 4473 C>T F1491F ESE (SF2/ASF, SRp40) 
 98060 IVS41+72 A>G  Creates splice donor 
 103699 6114 C>T H2038H ESE (SF2/ASF) 
 107621 IVS45-3 C>T  Modifies splice acceptor 
 115362b 7028 A>G N2343S (c) FAT domain, ESE (SRp40) 
 118034 7463 G>T C2488Y (nc) FAT domain, ESE (SC35) 
 119114 7521 C>T D2507D ESE (SF2/ASF) 
 119368 IVS53+146 A>G  Creates splice donor 
 134950 8592 C>T Y2864Y ESE (possibly SRp55) 
     
Possible effect on protein-protein interactions     
 23487 452 C>T S151F (nc) p53 binding 
 32501 691 C>G H231D (nc) p53 binding, ESE (SRp55) 
 32502 692 A>G H231R (nc) p53 binding 
 113744 6829 C>G Q2277E (c) FAT domain 
 115362b 7028 A>G N2343S (c) FAT domain, ESE (SRp40) 
 116798 7202 T>C I2401T (nc) FAT domain 
 117887 7316 T>C V2439A (nc) FAT domain 
 118034 7463 G>T C2488Y (nc) FAT domain, ESE (SC35) 
     
Other variants found only in HBOC families     
 10656 PRO(−66) C>G  Promoter 
 11036 IVS1a-36 C>T   
 11132 UTR(−734) C>T   
 11157 UTR(−709) A>G   
 11207 UTR(−659) A>G   
 11515 UTR(−351) C>T   
 15564 162 T>C Y54Y  
 23626 IVS7+95 G>C   
 32494 684 T>C G228G  
 38583 1436 A>G D479G (nc)  
 40506 1810 C>T P604S (nc) Found in breast cancer 
 44043 IVS16+22 A>C   
 44055 IVS16+34 A>C   
 44166 IVS16+145 A>G   
 46455 IVS17-212 G>A   
 59162 IVS22+75 T>A   
 59195 IVS22+108 A>T   
 60308 IVS23+20 T>C   
 67047 IVS24-124 G>T   
 67417 IVS25+129 A>C   
 68660 IVS25-15 T>A   
 80866 IVS32-122 G>T   
 92641 IVS39+116 T>C   
 95684 IVS40+27 G>A   
 95696 IVS40+39 G>C   
 97960 5890 A>G K1964E (c)  
 103553c 6067 G>A G2023R (nc) Found in breast cancer 
 107570 IVS45-54 T>C   
 108932 IVS46-39 C>T   
 115233 IVS49-77 T>C   
 120323 IVS54-104 C>T   
 121745 IVS56+112 T>C   
 133352 IVS59-55 del6   
 142766 IVS63+37 delTT   
 154582 10390 delTCC   
 155515 11323 G>A   
 155561 11369 C>G   
 155969 11777 T>C   
 156453 12261 G>A   
a

nc, nonconservative; c, conservative amino acid change.

b

The individual with this variant also carried a BRCA2 mutation (8047 ins4, 2616 stop).

c

The individual with this variant also carried a BRCA1 mutation (mutation not known).

We are grateful to Roger Milne (University of Melbourne) for assistance with the penetrance analysis. In addition, we thank Richard Gatti and Timothy Rebbeck for reading early versions of this manuscript and for helpful comments and insight.

1
Phillips K. A., Glendon G., Knight J. A. Putting the risk of breast cancer in perspective.
N. Engl. J. Med.
,
340
:
141
-144,  
1999
.
2
Møller P., Borg A., Heimdal K., Apold J., Vallon-Christersson J., Hovig E., Maehle L. The BRCA1 syndrome and other inherited breast or breast-ovarian cancers in a Norwegian prospective series. The Norwegian Inherited Breast Cancer Group. The Norwegian Inherited Ovarian Cancer Group.
Eur. J. Cancer
,
37
:
1027
-1032,  
2001
.
3
Stebbing J., Copson E., O’Reilly S. Herceptin (trastuzamab) in advanced breast cancer.
Cancer Treat. Rev.
,
26
:
287
-290,  
2000
.
4
Szabo C. I., King M. C. Inherited breast and ovarian cancer.
Hum. Mol. Genet.
,
4
:
1811
-1817,  
1995
.
5
Welcsh P. L., King M. C. BRCA1 and BRCA2 and the genetics of breast and ovarian cancer.
Hum. Mol. Genet.
,
10
:
705
-713,  
2001
.
6
Greene M. H. Genetics of breast cancer.
Mayo Clin. Proc.
,
72
:
54
-65,  
1997
.
7
Larson G. P., Zhang G., Ding S., Foldenauer K., Udar N., Gatti R. A., Neuberg D., Lunetta K. L., Ruckdeschel J. C., Longmate J., Flanagan S., Krontiris T. G. An allelic variant at the ATM locus is implicated in breast cancer susceptibility.
Genetic Testing
,
1
:
165
-170,  
1997
.
8
Broeks A., Urbanus J. H., Floore A. N., Dahler E. C., Klijn J. G., Rutgers E. J., Devilee P., Russell N. S., van Leeuwen F. E., van’t Veer L. J. ATM-heterozygous germline mutations contribute to breast cancer-susceptibility.
Am. J. Hum. Genet.
,
66
:
494
-500,  
2000
.
9
Chenevix-Trench G., Spurdle A. B., Gatei M., Kelly H., Marsh A., Chen X., Donn K., Cummings M., Nyholt D., Jenkins M. A., Scott C., Pupo G. M., Dork T., Bendix R., Kirk J., Tucker K., McCredie M. R., Hopper J. L., Sambrook J., Mann G. J., Khanna K. K. Dominant negative ATM mutations in breast cancer families.
J. Natl. Cancer Inst. (Bethesda)
,
94
:
205
-215,  
2002
.
10
Swift M., Sholman L., Perry M., Chase C. Malignant neoplasms in the families of patients with ataxia-telangiectasia.
Cancer Res.
,
36
:
209
-215,  
1976
.
11
Gatti R. A. Ataxia-telangiectasia Scriver C. Beaudet A. Sly W. Valle D. eds. .
The Metabolic and Molecular Bases of Inherited Disease
,
705
-732, McGraw-Hill New York  
2001
.
12
Swift M., Reitnauer P. J., Morrell D., Chase C. L. Breast and other cancers in families with ataxia-telangiectasia.
N. Engl. J. Med.
,
316
:
1289
-1294,  
1987
.
13
Savitsky K., Sfez S., Tagle D. A., Ziv Y., Sartiel A., Collins F. S., Shiloh Y., Rotman G. The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species.
Hum. Mol. Genet.
,
4
:
2025
-2032,  
1995
.
14
Athma P., Rappaport R., Swift M. Molecular genotyping shows that ataxia-telangiectasia heterozygotes are predisposed to breast cancer.
Cancer Genet. Cytogenet.
,
92
:
130
-134,  
1996
.
15
Olsen J., Hahnemann J., Borresen-Dale A-L., Brondum-Nielsen K., Hammarstrom L., Kleinerman R., Kaariainen H., Lonnqvist T., Sankila R., Seersholm N., Tretli S., Yuen J., Boice J., Tucker M. Cancer in patients with ataxia-telangiectasia and their relatives in the Nordic countries.
J. Natl. Cancer Inst. (Bethesda)
,
93
:
121
-127,  
2001
.
16
Gatti R. A., Tward A., Concannon P. Cancer risk in ATM heterozygotes: a model of phenotypic and mechanistic differences between missense and truncating mutations.
Mol. Genet. Metab.
,
68
:
419
-423,  
1999
.
17
Khanna K. K. Cancer risk and the ATM gene: a continuing debate.
J. Natl. Cancer Inst. (Bethesda)
,
92
:
795
-802,  
2000
.
18
Angèle S., Hall J. The ATM gene and breast cancer: is it really a risk factor?.
Mutat. Res.
,
462
:
167
-178,  
2000
.
19
Bebb D. G., Yu Z., Chen J., Telatar M., Gelmon K., Phillips N., Gatti R. A., Glickman B. W. Absence of mutations in the ATM gene in forty-seven cases of sporadic breast cancer.
Br. J. Cancer
,
80
:
1979
-1981,  
1999
.
20
Izatt L., Greenman J., Hodgson S., Ellis D., Watts S., Scott G., Jacobs C., Liebmann R., Zvelebil M. J., Mathew C., Solomon E. Identification of germline missense mutations and rare allelic variants in the ATM gene in early-onset breast cancer.
Genes Chromosomes Cancer
,
26
:
286
-294,  
1999
.
21
FitzGerald M., Bean J., Hegde S., Unsal H., MacDonald D., Harkin D., Finkelstein D., Isselbacher K., Haber D. Heterozygous ATM mutations do not contribute to early onset of breast cancer.
Nat. Genet.
,
15
:
307
-310,  
1997
.
22
Vorechovsky I., Rasio D., Luo L., Monaco C., Hammarström L., Webster A. D., Zaloudik J., Barbanti-Brodani G., James M., Russo G., et al The ATM gene and susceptibility to breast cancer: analysis of 38 breast tumors reveals no evidence for mutation.
Cancer Res.
,
56
:
2726
-2732,  
1996
.
23
Teraoka S. N., Malone K. E., Doody D. R., Suter N. M., Ostrander E. A., Daling J. R., Concannon P. Increased frequency of ATM mutations in breast carcinoma patients with early onset disease and positive family history.
Cancer (Phila.)
,
92
:
479
-487,  
2001
.
24
Vorechovsky I., Luo L., Lindblom A., Negrini M., Webster A. D., Croce C. M., Hammarström L. ATM mutations in cancer families.
Cancer Res.
,
56
:
4130
-4133,  
1996
.
25
Drumea K. C., Levine E., Bernstein J., Shank B., Green S., Kaplan E., Mandell L., Cropley J., Obropta J., Braccia I., Krupnik A., Rosenstein B. S. ATM heterozygosity and breast cancer: screening of 37 breast cancer patients for ATM mutations using a non-isotopic RNase cleavage-based assay.
Breast Cancer Res. Treat.
,
61
:
79
-85,  
2000
.
26
Chen J., Birkholtz G. G., Lindblom P., Rubio C., Lindblom A. The role of ataxia-telangiectasia heterozygotes in familial breast cancer.
Cancer Res.
,
58
:
1376
-1379,  
1998
.
27
Bay J., Grancho M., Pernin D., Presneau N., Rio P., Tchirkov A., Uhrhammer N., Verrelle P., Gatti R., Bignon Y. No evidence for constitutional ATM mutation in breast/gastric cancer families.
Int. J. Oncol.
,
12
:
1385
-1390,  
1998
.
28
Atencio D. P., Iannuzzi C. M., Green S., Stock R. G., Bernstein J. L., Rosenstein B. S. Screening breast cancer patients for ATM mutations and polymorphisms by using denaturing high-performance liquid chromatography.
Environ. Mol. Mutagen.
,
38
:
200
-208,  
2001
.
29
Stankovic T., Kidd A. M., Sutcliffe A., McGuire G. M., Robinson P., Weber P., Bedenham T., Bradwell A. R., Easton D. F., Lennox G. G., Haites N., Byrd P. J., Taylor A. M. ATM mutations and phenotypes in ataxia-telangiectasia families in the British Isles: expression of mutant ATM and the risk of leukemia, lymphoma, and breast cancer.
Am. J. Hum. Genet.
,
62
:
334
-345,  
1998
.
30
Dörk T., Bendix R., Bremer M., Rades D., Klopper K., Nicke M., Skawran B., Hector A., Yamini P., Steinmann D., Weise S., Stuhrmann M., Karstens J. H. Spectrum of ATM gene mutations in a hospital-based series of unselected breast cancer patients.
Cancer Res.
,
61
:
7608
-7615,  
2001
.
31
Choy Y., Dabora S., Hall F., Ramesh V., Niida Y., Franz D., Kasprzyk-Obara J., Reeve M., Kwiatkowski D. Superiority of denaturing high-performance liquid chromatography over single-stranded conformation and conformation-sensitive gel electrophoresis for mutation detection in TSC2.
Ann. Hum. Genet.
,
63
:
383
-391,  
1999
.
32
Jones A. C., Austin J., Hansen N., Hoogendoorn B., Oefner P. J., Cheadle J. P., O’Donovan M. C. Optimal temperature selection for mutation detection by denaturing HPLC and comparison to single-stranded conformation polymorphism and heteroduplex analysis.
Clin. Chem.
,
45
:
1133
-1140,  
1999
.
33
Eng C., Brody L. C., Wagner T. M., Devilee P., Vijg J., Szabo C., Tavtigian S. V., Nathanson K. L., Ostrander E., Frank T. S. Interpreting epidemiological research: blinded comparison of methods used to estimate the prevalence of inherited mutations in BRCA1.
J. Med. Genet.
,
38
:
824
-833,  
2001
.
34
O’Donovan M. C., Oefner P. J., Roberts S. C., Austin J., Hoogendoorn B., Guy C., Speight G., Upadhyaya M., Sommer S. S., McGuffin P. Blind analysis of denaturing high-performance liquid chromatography as a tool for mutation detection.
Genomics
,
52
:
44
-49,  
1998
.
35
Wagner T., Stoppa-Lyonnet D., Fleischmann E., Muhr D., Pagés S., Sandberg T., Caux V., Moeslinger R., Langbauer G., Borg A., Oefner P. Denaturing high-performance liquid chromatography detects reliably BRCA1 and BRCA2 mutations.
Genomics
,
62
:
369
-376,  
1999
.
36
Oefner P., Underhill P. DNA mutation detection using denaturing high-performance liquid chromatography Dracopoli N. Haines J. Korf B. Moir D. Morton C. Seidman C. Seidman J. Smith D. eds. .
Current Protocols in Human Genetics
,
7.10.11
-17.10.12, Wiley & Sons New York  
1998
.
37
Oefner P., Underhill P. Comparative DNA sequencing by denaturing high-performance liquid chromatography (DHPLC).
Am. J. Hum. Genet.
,
57(Suppl.)
:
A266
1995
.
38
Wagner T. M., Hirtenlehner K., Shen P., Moeslinger R., Muhr D., Fleischmann E., Concin H., Doeller W., Haid A., Lang A. H., Mayer P., Petru E., Ropp E., Langbauer G., Kubista E., Scheiner O., Underhill P., Mountain J., Stierer M., Zielinski C., Oefner P. Global sequence diversity of BRCA2: analysis of 71 breast cancer families and 95 control individuals of worldwide populations.
Hum. Mol. Genet.
,
8
:
413
-423,  
1999
.
39
Parkin, D., Whelan, S., Ferlay, J., Raymond, L., Young, J. (eds.). Cancer Incidence in Five Continents, Vol. 7. IARC Scientific Publication No. 143. Lyon, France: IARC, 1997.
40
Lange K., Boehnke M., Weeks D. .
Programs for Pedigree Analysis.
, University of California Los Angeles Los Angeles, CA  
1987
.
41
Godwin A. K., Vanderveer L., Schultz D. C., Lynch H. T., Altomare D. A., Buetow K. H., Daly M., Getts L. A., Masny A., Rosenblum N., et al A common region of deletion on chromosome 17q in both sporadic and familial epithelial ovarian tumors distal to BRCA1.
Am. J. Hum. Genet.
,
55
:
666
-677,  
1994
.
42
Thorstenson Y. R., Shen P., Tusher V. G., Wayne T. L., Davis R. W., Chu G., Oefner P. J. Global analysis of ATM polymorphism reveals significant functional constraint.
Am. J. Hum. Genet.
,
69
:
396
-412,  
2001
.
43
Xiao W., Oefner P. J. Denaturing high-performance liquid chromatography: a review.
Hum. Mutat.
,
17
:
439
-474,  
2001
.
44
Fukao T., Tashita H., Teramoto T., Inoue R., Kaneko H., Komiyama K., Bar-Shira A., Gilad S., Shiloh Y., Nishimura M., Kondo N. Novel exonic mutation (5319 G to A) resulting in two aberrantly spliced transcripts of the ATM gene in a Japanese patient with ataxia-telangiectasia.
Hum. Mutat.
,
Suppl. 1
:
S223
-S225,  
1998
.
45
Teraoka S. N., Telatar M., Becker-Catania S., Liang T., Onengüt S., Tolun A., Chessa L., Sanal O., Bernatowska E., Gatti R. A., Concannon P. Splicing defects in the ataxia-telangiectasia gene, ATM: underlying mutations and consequences.
Am. J. Hum. Genet.
,
64
:
1617
-1631,  
1999
.
46
Stankovic T., Weber P., Stewart G., Bedenham T., Murray J., Byrd P. J., Moss P. A., Taylor A. M. Inactivation of ataxia telangiectasia mutated gene in B-cell chronic lymphocytic leukaemia.
Lancet
,
353
:
26
-29,  
1999
.
47
Vorechovsky I., Luo L., Prudente S., Chessa L., Russo G., Kanariou M., James M., Negrini M., Webster A. D., Hammarström L. Exon-scanning mutation analysis of the ATM gene in patients with ataxia-telangiectasia.
Eur. J. Hum. Genet.
,
4
:
352
-355,  
1996
.
48
Spurdle A. B., Hopper J. L., Chen X., McCredie M. R., Giles G. G., Newman B., Chenevix-Trench G., Khanna K. K. No evidence for association of ataxia-telangiectasia mutated gene T2119C and C3161G amino acid substitution variants with risk of breast cancer.
Breast Cancer Res.
,
4
:
R15
2002
.
49
Scott S. P., Bendix R., Chen P., Clark R., Dork T., Lavin M. F. Missense mutations but not allelic variants alter the function of ATM by dominant interference in patients with breast cancer.
Proc. Natl. Acad. Sci. USA
,
99
:
925
-930,  
2002
.
50
Reese, M. and Eeckman, F. Splice prediction by neural network. http://www.fruitfly.org/seq_tools/splice.html, 1998.
51
Liu H. X., Cartegni L., Zhang M. Q., Krainer A. R. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.
Nat. Genet.
,
27
:
55
-58,  
2001
.
52
Blencowe B. J. Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases.
Trends Biochem. Sci.
,
25
:
106
-110,  
2000
.
53
Cartegni L., Chew S. L., Krainer A. R. Listening to silence and understanding nonsense: exonic mutations that affect splicing.
Nat. Rev. Genet.
,
3
:
285
-298,  
2002
.
54
Cartegni, L., Chew, S., Zhang, M., and Krainer, A. ESEfinder web interface (1.1). http://exon.cshl.edu/ESE/, 2002.
55
Hacia J., Sun B., Hunt N., Edgemon K., Mosbrook D., Robbins C., Fodor S. P., Tagle D. A., Collins F. S. Strategies for mutational analysis of the large multiexon ATM gene using high-density oligonucleotide arrays.
Genome Res.
,
8
:
1245
-1258,  
1998
.
56
Khanna K. K., Keating K. E., Kozlov S., Scott S., Gatei M., Hobson K., Taya Y., Gabrielli B., Chan D., Lees-Miller S. P., Lavin M. F. ATM associates with and phosphorylates p53: mapping the region of interaction.
Nat. Genet.
,
20
:
398
-400,  
1998
.
57
Bosotti R., Isacchi A., Sonnhammer E. L. FAT: a novel domain in PIK-related kinases.
Trends Biochem. Sci.
,
25
:
225
-227,  
2000
.
58
Savitsky K., Bar-Shira A., Gilad S., Rotman G., Ziv Y., Vanagaite L., Tagle D. A., Smith S., Uziel T., Sfez S., et al A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science (Wash. DC)
,
268
:
1749
-1753,  
1995
.
59
Bao S., Tibbetts R. S., Brumbaugh K. M., Fang Y., Richardson D. A., Ali A., Chen S. M., Abraham R. T., Wang X. F. ATR/ATM-mediated phosphorylation of human Rad17 is required for genotoxic stress responses.
Nature (Lond.)
,
411
:
969
-974,  
2001
.
60
Gatei M., Zhou B. B., Hobson K., Scott S., Young D., Khanna K. K. Ataxia telangiectasia mutated (ATM) kinase and ATM and Rad3 related kinase mediate phosphorylation of Brca1 at distinct and overlapping sites. In vivo assessment using phospho-specific antibodies.
J. Biol. Chem.
,
276
:
17276
-17280,  
2001
.
61
Garcia V., Salanoubat M., Choisne N., Tissier A. An ATM homologue from Arabidopsis thaliana: complete genomic organisation and expression analysis.
Nucleic Acids Res.
,
28
:
1692
-1699,  
2000
.
62
Rodriguez C., Valles H., Causse A., Johannsdottir V., Eliaou J. F., Theillet C. Involvement of ATM missense variants and mutations in a series of unselected breast cancer cases.
Genes Chromosomes Cancer
,
33
:
141
-149,  
2002
.
63
Sommer S. S., Buzin C. H., Jung M., Zheng J., Liu Q., Jeong S. J., Moulds J., Nguyen V. Q., Feng J., Bennett W. P., Dritschilo A. Elevated frequency of ATM gene missense mutations in breast cancer relative to ethnically matched controls.
Cancer Genet. Cytogenet.
,
134
:
25
-32,  
2002
.
64
Shafman T., Khanna K. K., Kedar P., Spring K., Kozlov S., Yen T., Hobson K., Gatei M., Zhang N., Watters D., Egerton M., Shiloh Y., Kharbanda S., Kufe D., Lavin M. F. Interaction between ATM protein and c-Abl in response to DNA damage.
Nature (Lond.)
,
387
:
520
-523,  
1997
.
65
Sandoval N., Platzer M., Rosenthal A., Dörk T., Bendix R., Skawran B., Stuhrmann M., Wegner R. D., Sperling K., Banin S., Shiloh Y., Baumer A., Bernthaler U., Sennefelder H., Brohm M., Weber B. H., Schindler D. Characterization of ATM gene mutations in 66 ataxia telangiectasia families.
Hum. Mol. Genet.
,
8
:
69
-79,  
1999
.
66
Spring K., Cross S., Li C., Watters D., Ben-Senior L., Waring P., Ahangari F., Lu S. L., Chen P., Misko I., Paterson C., Kay G., Smorodinsky N. I., Shiloh Y., Lavin M. F. Atm knock-in mice harboring an in-frame deletion corresponding to the human ATM 7636del9 common mutation exhibit a variant phenotype.
Cancer Res.
,
61
:
4561
-4568,  
2001
.
67
Spring K., Ahangari F., Scott S. P., Waring P., Purdie D. M., Chen P. C., Hourigan K., Ramsay J., McKinnon P. J., Swift M., Lavin M. F. Mice heterozygous for mutation in Atm, the gene involved in ataxia-telangiectasia, have heightened susceptibility to cancer.
Nat. Genet.
,
32
:
185
-190,  
2002
.
68
Watts J. A., Morley M., Burdick J. T., Fiori J. L., Ewens W. J., Spielman R. S., Cheung V. G. Gene expression phenotype in heterozygous carriers of ataxia telangiectasia.
Am. J. Hum. Genet.
,
71
:
791
-800,  
2002
.