Breast cancer mortality is seldom attributable to the primary tumor, but rather to the presence of systemic (metastatic) disease. Axillary lymph node dissection can identify the presence of metastatic breast cancer cells and serves as a marker for systemic disease. Previous work in our laboratory determined that rates of loss of heterozygosity (LOH) of a 1.6-Mb region of chromosome 14q 31.2 is much higher in axillary lymph node-negative primary breast tumors than in axillary lymph node-positive primary breast tumors (P. O’Connell et al., J. Natl. Cancer Inst., 91: 1391–1397, 1999.). This unusual observation suggests that, whereas the LOH of this region promotes primary breast cancer formation, some gene(s) mapping to this 1.6-Mb region is rate-limiting for breast cancer metastasis. Thus, if primary breast cancers delete this region, their ability to metastasize decreases. To identify this gene(s), we have physically mapped this area of chromosome 14q, confirmed the position of two known genes and 13 other expressed sequence tags into this 1.6-Mb region. One of these, the metastasis-associated 1 (MTA1) gene, previously identified as a metastasis-promoting gene (Y. Toh et al., J. Biol. Chem., 269: 22958–22963, 1994.), mapped to the center of our 1.6-Mb target region. Thus, MTA1 represents a strong candidate for this breast cancer metastasis-promoting gene.

One of the strongest prognostic factors for cancer-free survival after treatment of the primary tumor is the presence or absence of local metastatic spread. For women with axillary lymph node-negative breast cancer, 90% survive more than 5 years after diagnosis. This is compared with a 70% 5-year survival for women with axillary lymph node-positive disease, and only a 20% 5-year survival for women with distant metastases (1). The development of the metastatic phenotype of a tumor cell involves a complicated series of events that include detachment of tumor cells from the primary tumor, invasion into and survival in the circulatory and lymphatic systems, extravasation, and induction of angiogenesis and growth at the metastatic site. The development of a genetic test that could predict the metastatic potential of a primary breast tumor would increase the effectiveness of breast cancer treatment.

Previous work in our laboratory involved LOH3 analysis to compare DNA samples from paired normal and breast tumor tissues to examine whether specific genetic changes in primary breast cancer can serve as markers of metastatic potential (2). As expected, increasing rates of LOH were correlated with progressively higher stages of breast cancer (3, 4). Unlike all other 14 markers tested, LOH at marker D14S62 was much lower in metastases than in primary breast tumors. D14S62 LOH proved to be associated with node-negative primary cancers and thus with slower spread to distant sites. Higher resolution LOH studies narrowed this phenomenon to a 1.6-Mb region near marker D14S62 (2). Here we have assembled a physical map and identified a minimum tiling path of three YAC clones that span this region. One of the ESTs that mapped into this region in our study was MTA1, a gene previously shown to be highly expressed in both metastatic breast cancer cell lines and metastatic gastrointestinal carcinomas (5, 6).

YAC DNA Preparation and Mapping.

CEPH YACs were selected for mapping of MTA1 by screening with D14S62 region markers or on the basis of available mapping information.4 Total YAC DNA from each clone was purified as described previously (4). Each YAC clone was confirmed by PCR analysis using oligonucleotide primers for MTA1 and selected ESTs mapping into the region on the basis of the radiation hybrid mapping of chromosome 14 (Gene Map 1999 and the GDB). The primers used were a MTA1-expressed sequence tag (RH78599) designed by the Sanger Center and based on known human genomic chromosome 14 sequence.5 The primer sequences were 5′GGTTCGGATTTGGCTTGTTA3′, which is contained within a unique sequence of the MTA1 cDNA; and 5′CGTGGTTCTGGACAAGGG3′, which is contained in the adjacent genomic sequence of MTA1. PCR was performed in a Gene Amp PCR system 9600 (Perkin-Elmer Corp., Norwalk, CT) using ∼20 ng of YAC DNA in a volume of 50 μl in 30 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. A 20-μl volume of each product was electrophoresed in a 1% agarose gel, and PCR products were visualized by ethidium bromide staining.

BAC DNA Preparation and Mapping Analysis.

BAC 76E12 was obtained from Research Genetics (Birmingham, AL). Total BAC DNA was purified according to the protocol supplied by the manufacturer. MTA1 was mapped to BAC 76E12 by PCR analysis using the same oligonucleotide primers for MTA1 as above. PCR was performed in a Gene Amp PCR system 9600 (Perkin-Elmer Corp.) using ∼30 ng of BAC DNA in a volume of 50 μl in 30 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. A 10-μl volume of each product was electrophoresed in a 1% agarose gel, and PCR products were visualized by ethidium bromide staining.

As part of our preliminary mapping studies of the region, we determined all of the ESTs that mapped into the target region according to the radiation hybrid-based NCBI Gene Map. A total of 12 ESTs, but no known genes, map to this 1.6-Mb metastasis-related region. However, we performed additional mapping analysis on the YACs used in the preliminary mapping analysis and confirmed two known genes and 13 ESTs that actually map to these YACs, rather to than their location indicated by the radiation hybrid-based NCBI Gene Map. Because of these findings, we included the region from marker D14S1066 to the telomere of chromosome 14 because of uncertainties inherent in radiation hybrid mapping to insure that we had complete coverage of the telomeric end of chromosome 14q. Approximately 392 ESTs map into this region, with 63 of these being previously identified genes. Table 1 summarizes the known genes in the region from D14S1066 to the telomere (including MTA1) considered to be possible metastasis candidate genes.

MTA1 had been mapped previously using radiation hybrids onto the NCBI Gene Map some distance away from our region of interest near the telomere of chromosome 14q. We had, however, discovered several ESTs thought to map elsewhere on chromosome 14 that were actually mapped to our target region. Because MTA1 represented a promising candidate gene even though the gene map showed it to be outside our target region, we then tested PCR primers for the MTA1 gene onto our physical map of the region detected by our LOH studies. We determined MTA1 mapped onto YACs 859d4 and 765h7 (Fig. 1). These mapping studies were subsequently confirmed when we mapped the gene onto BAC 76E12, which has a completed draft sequence that confirms its mapping onto YAC 859d4. The MTA1 gene was therefore determined to map onto chromosome 14q in the vicinity of markers D14S62 and D14S51, or ∼21 cM proximal to its previously reported location (see Fig. 1). Fig. 2, A and B, summarizes the gel-mapping data for MTA1. MTA1 was mapped onto the overlapping YAC clones 859d4 and 756h7. Fig. 2 B indicates that MTA1 also maps to BAC 76E12, and its location to this sequenced BAC clone is confirmed by a BLAST search with MTA1 cDNA sequences.

MTA1 was previously identified as a metastasis-promoting gene overexpressed in both rat and human metastatic cell lines (5). The human MTA1 gene was cloned and sequenced by Nawa et al.(7) in 2000. In 1994, the rat gene was cloned and sequenced by the same group (5). The expression of MTA1 in the human breast cancer cell line MDA-MB-231, a metastatic cell line, was determined to be approximately four times higher than its expression levels in the breast cancer cell line MDA-MB-468, which is nonmetastatic (5). The rat cell lines MTC.4, a benign line that remains phenotypically stable with prolonged passage, and the highly metastatic line MTLn3 were also tested for expression of mta1 (the rat homologue). The expression level of mta1 was found to be 4-fold higher in the MTLn3 line than in the MTC.4 line by Northern blotting (8). Different forms of cancer have also been shown to overexpress MTA1. Esophageal, colorectal, gastric, and pancreatic carcinomas have all been reported previously to express higher levels of MTA1 mRNA than paired normal tissues, and this overexpression correlated with the invasiveness or lymph node metastasis of each of the carcinomas (6, 9, 10).

Recently, MTA1 has also been shown to be associated with histone deacetylase activity. Xue et al.(11) found that MTA1 was identical to one subunit of the nucleosome remodeling and histone deacetylation complex. This complex contains both ATP-dependent chromatin-remodeling and histone deacetylase activities (12). Interestingly, two homologues of MTA1 have also been discovered. Zhang et al.(13, 14) reported that a protein similar to MTA1 was also a component of the nucleosome remodeling and histone deacetylation complex. This gene, since designated MTA1-L1, has been cloned and shows significant homology to MTA1(15). MTA1-L1 maps to chromosome 11 on the NCBI Gene Map. An even more distantly related MTA1 homologue, now referred to as MTA2, maps to chromosome 2 on the NCBI Gene Map. The MTA1 (and MTA1-L1) proteins are both nuclear proteins containing motifs associated with transcriptional corepressors, gene methylation, and signal transduction (11). All of these observations fit well our model in which LOH of the MTA1 region impedes metastasis. However, because LOH events involve the loss of large segments or entire chromosomes, loss of additional MTA1-region genes (see Table 1) could influence the metastasis phenotype.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

      
1

Supported by CA58183 and CA30195 from the National Cancer Institute, NIH, Department of Human Services.

            
3

The abbreviations used are: LOH, loss of heterozygosity; MTA1, metastasis-associated 1; EST, expressed sequence tags; NCBI, National Center for Biotechnology Information; GDB, Genome Database; YAC, yeast artificial chromosome; BAC, bacterial artificial chromosome.

      
4

For example, Internet address: http://www-genome.wi.mit.edu; http://www.gdb.org.

      
5

Internet address: http://www.sanger.ac.uk.

Fig. 1.

YAC and BAC mapping of MTA1. A 1.6-Mb section of the region of interest was mapped, spanning from marker D14S265 to marker D14S51. The position of MTA1 is shown relative to other markers on chromosome 14q. MTA1 was determined to map onto both YAC 756h7 and YAC 859d4 and also to BAC 76E12.

Fig. 1.

YAC and BAC mapping of MTA1. A 1.6-Mb section of the region of interest was mapped, spanning from marker D14S265 to marker D14S51. The position of MTA1 is shown relative to other markers on chromosome 14q. MTA1 was determined to map onto both YAC 756h7 and YAC 859d4 and also to BAC 76E12.

Close modal
Fig. 2.

Gel-mapping data on MTA1. A, PCR amplification of MTA1 primers on YAC clones spanning the metastasis gene target region (band shown in Lanes 1, 9, and 12). Positive control was provided with 25 ng of human genomic DNA shown in Lane 1. B, PCR amplification of MTA1 primers on BAC clone 76E12. Two positives are shown in Lanes 5 and 6 that represent two different preparations of the same BAC. Twenty-five ng of human genomic DNA was once again used as a positive control (Lane 3). Product size in both experiments was ∼124 bp.

Fig. 2.

Gel-mapping data on MTA1. A, PCR amplification of MTA1 primers on YAC clones spanning the metastasis gene target region (band shown in Lanes 1, 9, and 12). Positive control was provided with 25 ng of human genomic DNA shown in Lane 1. B, PCR amplification of MTA1 primers on BAC clone 76E12. Two positives are shown in Lanes 5 and 6 that represent two different preparations of the same BAC. Twenty-five ng of human genomic DNA was once again used as a positive control (Lane 3). Product size in both experiments was ∼124 bp.

Close modal
Table 1

Possible candidate genes in the 14q region of interest

Nineteen known genes were determined to map into the area of interest on chromosome 14. Both the gene name and the GDB no. are given for identification.a
Gene nameGDB no.
CALM, calmodulin 1 9611304 
PRSC1, protease, cysteine, 1 700617 
CGHA, chromogranin A 119777 
PI, protease inhibitor 1 120289 
AACT, α-1-antichymotrypsin 118955 
PCI, protein C inhibitor 134739 
TCL1A, T-cell leukemia/lymphoma 1A 250785 
CCNK, cyclin K 9957298 
YY1, YY1 transcription factor 216988 
CKB, creatine kinase, brain 120590 
AKT1, V-akt murine thymoma viral oncogene 118989 
EIF5, eukaryotic translation initiation factor 5 126411 
IGHG3, immunoglobulin-γ 3 119339 
MTA1, metastasis-associated 1 9955068 
MARK3, MAP/microtubule affinity-regulating kinase 9315109 
EMAPL, echinoderm microtubule-associated protein 6328385 
KNS2, kinesin 2 304673 
TRAF3, TNF receptor-associated factor 3 9836800 
EEF10, eukaryotic translation elongation factor 10 216099 
Nineteen known genes were determined to map into the area of interest on chromosome 14. Both the gene name and the GDB no. are given for identification.a
Gene nameGDB no.
CALM, calmodulin 1 9611304 
PRSC1, protease, cysteine, 1 700617 
CGHA, chromogranin A 119777 
PI, protease inhibitor 1 120289 
AACT, α-1-antichymotrypsin 118955 
PCI, protein C inhibitor 134739 
TCL1A, T-cell leukemia/lymphoma 1A 250785 
CCNK, cyclin K 9957298 
YY1, YY1 transcription factor 216988 
CKB, creatine kinase, brain 120590 
AKT1, V-akt murine thymoma viral oncogene 118989 
EIF5, eukaryotic translation initiation factor 5 126411 
IGHG3, immunoglobulin-γ 3 119339 
MTA1, metastasis-associated 1 9955068 
MARK3, MAP/microtubule affinity-regulating kinase 9315109 
EMAPL, echinoderm microtubule-associated protein 6328385 
KNS2, kinesin 2 304673 
TRAF3, TNF receptor-associated factor 3 9836800 
EEF10, eukaryotic translation elongation factor 10 216099 
a

More information on each gene can be found at http://www.gdb.org/.

1
National Cancer Institute. SEER Cancer Statistics Review, 1973–1991. NIH Publ. No. 94-2789 NIH Bethesda, MD  
1994
.
2
O’Connell P., Hilsenbeck S., Mohsin S., Fuqua S., Clark G., Osborne C., Allred D. C. Loss of heterozygosity at D14S62 and metastatic potential of breast cancer.
J. Natl. Cancer Inst.
,
91
:
1391
-1397,  
1999
.
3
O’Connell P., Pekkel V., Fuqua S., Osborne C. K., Allred D. C. Molecular genetic studies of early breast cancer evolution.
Breast Cancer Res. Treat.
,
32
:
5
-12,  
1994
.
4
O’Connell P., Pekkel V., Fuqua S. A., Osborne C. K., Clark G. M., Allred D. C. Analysis of loss of heterozygosity in 399 premalignant breast lesions at 15 genetic loci.
J. Natl. Cancer Inst.
,
90
:
697
-703,  
1998
.
5
Toh Y., Pencil S. D., Nicolson G. L. A novel candidate metastasis-associated gene, mta1, differentially expressed in highly metastatic mammary adenocarcinoma cell lines. cDNA cloning, expression, and protein analyses.
J. Biol. Chem.
,
269
:
22958
-22963,  
1994
.
6
Toh Y., Oki E., Oda S., Tokunaga E., Ohno S., Maehara Y., Nicolson G. L., Sugimachi K. Overexpression of the MTA1 gene in gastrointestinal carcinomas: correlation with invasion and metastasis.
Int. J. Cancer
,
74
:
459
-463,  
1997
.
7
Nawa A., Nishimori K., Lin P., Maki Y., Moue K., Sawada H., Toh Y., Fumitaka K., Nicolson G. Tumor metastasis-associated human MTA1 gene: its deduced protein sequence, localization, and association with breast cancer cell proliferation using antisense phosphorothioate oligonucleotides.
J. Cell. Biochem.
,
79
:
202
-212,  
2000
.
8
Toh Y., Pencil S. D., Nicolson G. L. Analysis of the complete sequence of the novel metastasis-associated candidate gene, mta1, differentially expressed in mammary adenocarcinoma and breast cancer cell lines.
Gene
,
159
:
97
-104,  
1995
.
9
Iguchi H., Imura G., Toh Y., Ogata Y. Expression of MTA1, a metastasis-associated gene with histone deacetylase activity in pancreatic cancer.
Int. J. Oncol.
,
16
:
1211
-1214,  
2000
.
10
Toh Y., Kuwano H., Mori M., Nicolson G. L., Sugimachi K. Overexpression of metastasis-associated MTA1 mRNA in invasive oesophageal carcinomas.
Br. J. Cancer
,
79
:
1723
-1726,  
1999
.
11
Xue Y., Wong J., Moreno G. T., Young M. K., Cote J., Wang W. NURD, a novel complex with both ATP-dependent chromatin-remodeling and histone deacetylase activities.
Mol. Cell
,
2
:
851
-861,  
1998
.
12
Toh Y., Kuninaka S., Endo K., Oshiro T., Ikeda Y., Nakashima H., Baba H., Kohnoe S., Okamura T., Nicolson G. L., Sugimachi K. Molecular analysis of a candidate metastasis-associated gene, MTA1: possible interaction with histone deacetylase 1.
J. Exp. Clin. Cancer Res.
,
19
:
105
-111,  
2000
.
13
Zhang Y., LeRoy G., Seelig H. P., Lane W. S., Reinberg D. The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities.
Cell
,
95
:
279
-289,  
1998
.
14
Zhang Y., Ng H. H., Erdjument-Bromage H., Tempst P., Bird A., Reinberg D. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation.
Genes Dev.
,
13
:
1924
-1935,  
1999
.
15
Futamura M., Nishimori H., Shiratsuchi T., Saji S., Nakamura Y., Tokino T. Molecular cloning, mapping, and characterization of a novel human gene, MTA1–L1, showing homology to a metastasis-associated gene, MTA1.
J. Hum. Genet.
,
44
:
52
-56,  
1999
.