There are limited reports on methylation analysis of the premalignant lesions of gastric carcinoma thus far. This is despite the fact that gastric carcinoma is one of the tumors with a high frequency of CpG island hypermethylation. To determine the frequency and timing of hypermethylation during multistep gastric carcinogenesis, non-neoplastic gastric mucosa (n = 118), adenomas (n = 61), and carcinomas (n = 64) were analyzed for their p16, human Mut L homologue 1 (hMLH1), death-associated protein (DAP)-kinase, thromobospondin-1 (THBS1), and tissue inhibitor of metalloproteinase 3 (TIMP-3) methylation status using methylation-specific PCR. Three different classes of methylation behaviors were found in the five tested genes. DAP-kinase was methylated at a similar frequency in all four stages, whereas hMLH1 and p16 were methylated in cancer samples (20.3% and 42.2%, respectively) more frequently than in intestinal metaplasia (6.3% and 2.1%, respectively) or adenomas (9.8% and 11.5%, respectively). However, hMLH1 and p16 were not methylated in chronic gastritis. THBS-1 and TIMP-3 were methylated in all stages but showed a marked increase in hypermethylation frequency from chronic gastritis (10.1% and 14.5%, respectively) to intestinal metaplasia (34.7% and 36.7%, respectively; P < 0.05) and from adenomas (28.3% and 26.7%, respectively) to carcinomas (48.4% and 57.4%, respectively; P < 0.05). The hMLH1, THBS1, and TIMP-3 hypermethylation frequencies were similar in both intestinal metaplasia and adenomas, but the p16 hypermethylation frequency tended to be higher in adenomas (11.5%) than in intestinal metaplasia (2.1%; P = 0.073). The average number of methylated genes was 0.6, 1.1, 1.1, and 2.0 per five genes per sample in chronic gastritis, intestinal metaplasia, adenomas, and carcinomas, respectively. This shows a marked increase in methylated genes from non-metaplastic mucosa to intestinal metaplasia (P = 0.001) as well as from premalignant lesions to carcinomas (P = 0.002). These results suggest that CpG island hypermethylation occur early in multistep gastric carcinogenesis and tend to accumulate along the multistep carcinogenesis.

Gastric carcinogenesis is a multistep process composed of genetic and epigenetic alterations involving protooncogenes, tumor suppressor genes, cell-cycle regulator genes, tissue-invasion-related genes, or mismatch repair genes (1). Methylation of gene regulatory elements, a well-known epigenetic change, acts as an important alternative to genetic alteration for gene inactivation. Methylation of CpG islands located within a promoter element is generally associated with delayed replication, condensed chromatin, and inhibition of transcription initiation (2, 3, 4). In gastric carcinomas, p16, hMLH1,3 and TIMP-3 have been demonstrated to be inactivated by promoter hypermethylation (5, 6, 7). These genes could be inactivated by a combination of genetic or epigenetic alterations of two alleles. However, rather than genetic alterations, epigenetic change may be the predominant mechanism associated with the loss of hMLH1 and p16 function in sporadic gastric carcinomas (8, 9).

DAP-kinase is a seine/threonine kinase involved in IFN-γ-induced apoptosis. The inactivation of DAP-kinase by hypermethylation in the promoter CpG region has been demonstrated in cell lines of breast, urinary bladder, and renal cell carcinomas (10), in primary lung cancer (11), and in B-cell malignancies (12). Hypermethylation of the DAP-kinase promoter has been reported to be associated with a better prognosis in early-stage non-small cell lung cancer (13). THBS1 is a known angiogenesis inhibitor whose altered expression is associated with neovascularization in human cancers (14). Hypermethylation of the THBS1 promoter and an associated decrease of THBS1 expression was observed in several carcinoma cell lines and primary brain tumors (15). Although a methylation study of DAP-kinase and THBS1 has not been reported in gastric cancers, hypermethylation of both genes was reported in pancreatic cancers (16) and hypermethylation of THBS1 was reported in colon cancers (17). Thus, hypermethylation of both genes is expected to be involved in gastric carcinogenesis.

On the basis of the similarities in both the morphological and genetic aspects between colorectal and gastric cancer, it has been postulated that gastric carcinomas may arise from gastric adenomas, similarly to the colorectal adenoma-carcinoma sequence. Gastric adenoma is an (endoscopically) distinct and (histologically) circumscribed benign neoplasm composed of tubular or villous structures lined by dysplastic epithelium (18). The incidence of malignant transformations of gastric adenomas has been reported to be ∼10% on long-term follow-up studies (19, 20). Although there is some controversy, the precancerous nature of intestinal metaplasia is suggested by the observation that gastric carcinoma often occurs in the background of intestinal metaplasia, and that the risk of gastric carcinoma is proportional to the extent of metaplasia (21). Furthermore, the genetic alterations frequently observed in gastric carcinoma also have been recorded in intestinal metaplasia (22, 23).

Although epigenetic change has been recognized as an important mechanism underlying gastric carcinoma progression, there has been limited data regarding the epigenetic abnormalities in both gastric adenoma and intestinal metaplasia. To determine the chronology of hypermethylation during multistep gastric carcinogenesis, promoter hypermethylation of p16, hMLH1, DAP-kinase, THBS1, and TIMP-3 in intestinal metaplasia, gastric adenomas, and gastric carcinomas was analyzed.

Sixty-four archival samples of surgically resected gastric carcinomas, 61 archival samples of endoscopically resected gastric adenomas, and 118 archival samples of endoscopically obtained non-neoplastic gastric mucosae (49 intestinal metaplasia and 69 non-metaplastic mucosae) were studied. Among these samples, the gastric carcinoma samples were characterized previously for p16 and hMLH1 promoter hypermethylation and both p16 and hMLH1 protein expression. Through our previous studies (5, 24), it was confirmed that both p16 and hMLH1 promoter hypermethylation strongly correlated with the absence of both p16 and hMLH1 proteins, respectively.

After identifying carcinoma, adenoma, or intestinal metaplasia on H&E-stained slides, portions of carcinoma, adenoma, or metaplastic mucosa were scraped from 20-μm-thick paraffin sections. The materials collected were dewaxed by washing in xylene and then by rinsing in ethanol. The dried tissues or fresh frozen samples were digested with proteinase K and subjected to the traditional method of DNA extraction using phenol/chloroform/isoamyl alcohol and ethanol precipitation.

Both normal and tumorous DNAs were subjected to sodium bisulfite modification as described previously (25). MSP was performed to examine methylation at promoter regions of p16, hMLH1, DAP-kinase, THBS1, and TIMP-3. The primer sequences of each gene, for both methylated and unmethylated reactions, are described in Table 1. To amplify the bisulfite-modified promoter sequence of p16 and hMLH1, a PCR mixture containing 1× PCR buffer [10 mm Tris (pH 8.3), 50 mm KCl, and 1.5 mm MgCl2), deoxynucleotide triphosphates (each at 0.2 mm), primers (10 pmol each), and bisulfite-modified DNA (30–50 ng) in a final volume of 25 μl was used. For the amplification of DAP-kinase, THBS1, and TIMP-3, a PCR mixture containing 1× PCR buffer [16.6 mm (NH4)2SO4, 67 mm Tris (pH 8.8), 6.7 mm MgCl2, and 10 mm β-mercaptoethanol], deoxynucleotide triphosphates (each at 1 mm), primers (10 pmol each), and bisulfite-modified DNA (30–50 ng) in a final volume of 25 μl was used. The reactions were hot-started at 97°C for 5 min before the addition of 0.75 units of Taq polymerase (Takara Shuzo Co., Kyoto, Japan). The amplifications were carried out in a Thermal cycler (Perkin-Elmer, Foster City, CA) for 35 cycles (1 min at 95°C, variable temperatures according to the primer, and 1 min at 72°C) and a final 10-min extension. The PCR products were electrophoresed on a 2.5% agarose gel and visualized under UV illumination using an ethidium bromide stain.

The PCR products were purified using the JETSORB gel extraction kit (Genomed, Bad Oeynhausen, Germany) and cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA). Plasmid DNA was extracted from individual clones by alkaline lysis plasmid minipreparation. The inserted PCR fragments of four individual clones obtained from each sample were sequenced with both M13 reverse and M13 (−20) forward primer using the ABI Prism Dye Terminator Cycle Sequencing Kit (Perkin-Elmer) and an ABI Prism 377 DNA Sequencer (Perkin-Elmer).

Table 2 summarizes the promoter hypermethylation frequency of each gene in non-neoplastic and neoplastic gastric samples, and Fig. 1 shows a representative example of MSP analysis. The timing of hypermethylation during multistep gastric carcinogenesis from gastritis to carcinoma samples varied according to the gene. On the basis of the timing, these five genes were able to be classified into three groups. p16 and hMLH1 were not methylated in chronic gastritis samples and showed a 2-fold or greater increase in the hypermethylation frequency from premalignant lesions to gastric carcinomas. DAP-kinase was hypermethylated at a similar frequency in chronic gastritis, intestinal metaplasia, gastric adenoma, and gastric carcinoma samples. THBS1 and TIMP-3 were hypermethylated both in non-neoplastic and neoplastic samples, with a marked increase in the methylation frequency from chronic gastritis (10.1% and 14.5%, respectively) to intestinal metaplasia (34.7% and 36.7%, respectively; P < 0.05) and from intestinal metaplasia or adenomas (28.3% and 26.7%, respectively) to carcinomas (48.4% and 57.4%, respectively; P < 0.05). In terms of the hypermethylation frequency of the five genes tested, there was no statistically significant difference observed between intestinal metaplasia and gastric adenomas.

Bisulfite genomic sequencing of the representative PCR products of each gene showed that all cytosines at non-CpG sites were converted to thymine. This excluded the possibility that successful amplification could be attributable to incomplete bisulfite conversion. All PCR products of each gene showed extensive methylation of CpG sites that are located inside the amplified genomic fragments. The results of both the MSP and bisulfite sequencing analyses were consistent, indicating that it is appropriate to draw inferences from the results of a methylation-specific PCR assay regarding the methylation status of the gene promoters.

With the results of bisulfite genomic sequencing, we determined the methylation profiles of CpG sites in the MSP products of each gene promoter and compared the methylation density between each step lesion. There was no difference between each step lesion in either the number of methylated CpG sites or the methylation frequency of each CpG site. In the five genes, the vast majority of CpG sites exhibited methylation at a frequency of ≥75% (Fig. 2).

The number of methylated promoters was determined in each sample and defined as the methylation index. The average methylation index for each stage is shown in Table 3. Gastric carcinoma averaged 2.0 per five methylation events per tumor, which is much higher than those of chronic gastritis, intestinal metaplasia, or adenoma (0.5, 1.1, 1.1, respectively; P < 0.05). The average methylation index was similar in both intestinal metaplasia and adenoma but higher than in chronic gastritis (P < 0.05). Samples with a methylation index of ≥4 were seen in gastric carcinoma samples (13 of 64, 20.3%) and not in premalignant lesions.

We examined other normal tissues, including pediatric gastric mucosa, colon mucosa, breast tissue, and bile duct mucosa for the methylation of the three genes (DAP-kinase, THBS-1, and TIMP-3) that were hypermethylated in a subset of chronic gastritis to see whether this alteration is a tissue-specific or age-related change. Pediatric gastric mucosa samples were obtained from the pediatric patients with dyspepsia and was histologically diagnosed as chronic gastritis without intestinal metaplasia. Table 4 summarizes the results. DAP-kinase was not hypermethylated in pediatric gastric mucosa, colon mucosa, and breast tissue except for bile duct mucosa (1/11, 9.1%). THBS1 was hypermethylated in pediatric gastric mucosa samples (4 of 40, 10%), normal colon mucosa samples (3 of 34, 8.8%), and bile duct mucosa samples (3 of 11, 27.3%) but not in breast tissue. TIMP-3 was hypermethylated in pediatric gastric mucosa only (6 of 48, 15%). The methylation frequencies of THBS1 and TIMP-3 were not different between chronic gastritis of adults (n = 69; mean age, 48 years) and children (n = 48, mean age, 11 years). DAP-kinase, which was hypermethylated in 25% of adult chronic gastritis samples, was not hypermethylated in pediatric gastric mucosa samples.

In contrast to genetic alterations, epigenetic change has not been extensively studied because it has been considered to play a minor role in carcinogenesis. However, recent data has altered this view and led our attention to the epigenetic change that occurs in gastric carcinogenesis.

Our previous studies (5, 24) revealed that promoter hypermethylation of p16 and hMLH1 was strongly correlated with the lack of protein expression, indicating promoter hypermethylation as the main inactivation mechanism of these genes in gastric carcinoma. These strong associations have been reported by many other researchers (6, 8, 26). A study using gastric cancer cell lines also demonstrated methylation-associated gene inactivation of TIMP-3(7). Although hypermethylation of DAP-kinase or THBS1 CpG islands was not studied previously in gastric carcinomas, gene inactivation by hypermethylation of the CpG islands have been reported in other tissues or cell lines (10, 11, 15). The present study has shown that TIMP-3, DAP-Kinase, and THBS1 were methylated not only in neoplastic lesions and but also in non-neoplastic conditions of the stomach.

The timing of hypermethylation during tumor development may vary among different genes and tumor types. On the basis of the observation that hypermethylation with the expressional loss of hMLH1 was present in invasive gastric carcinoma but not in adjacent dysplastic tissues, an earlier study suggested that this was a late event in gastric carcinogenesis (6). However, the present study has shown that hMLH1 hypermethylation occurs in both intestinal metaplasia and gastric adenoma, although its frequency is low. When we performed immunohistochemical staining of hMLH1 protein on gastric adenomas with hMLH1 hypermethylation, one of six adenomas clearly demonstrated an absence of hMLH1 protein expression. This case showed allelic alterations of BAT-26 (data not shown). MSP is so sensitive that even one methylated allele in 100,000 unmethylated alleles can be detected (25). Therefore, it is quite probable that hMLH1 promoter hypermethylation is a subclonal event in gastric adenoma and may not be detected by immunohistochemical staining in the five gastric adenomas.

Our results have demonstrated a 4-fold increase in the p16 hypermethylation frequency from gastric adenoma (11.5%) to gastric carcinoma (42.2%), suggesting that p16 hypermethylation plays a role in the malignant transformation. p16 hypermethylation in non-neoplastic gastric mucosae have been described in some studies (27, 28), although these studies did not provide the p16 hypermethylation frequency in non-neoplastic mucosa and the detailed histological features of the nonneoplastic gastric mucosae. The present study demonstrated p16 hypermethylation in intestinal metaplasia, but the frequency was very low (1 of 48 samples, 2.1%).

In the present study, intestinal metaplasia showed a higher methylation index than that of chronic gastritis. Other studies have reported that genetic alterations have been found in intestinal metaplasia, including p53 or K-ras mutations and allelic losses of several loci (22, 23, 29). These findings suggest that a portion of intestinal metaplasia may have epigenetic change or genetic alterations and act as premalignant lesions. Hypermethylation of three genes was observed in 10.2% of intestinal metaplasia samples in the present study, and these cases might have a higher risk of developing gastric carcinomas. A prospective longitudinal study is required to confirm this possibility.

In contrast with the alleged phenotypic sequential change from intestinal metaplasia to gastric adenoma, our results have shown similar methylation indices in both the intestinal metaplasia and gastric adenoma. This raises the possibility that intestinal metaplasia may be not a prestage for gastric adenoma in the CpG island methylation pathway. However, considering the limited number of assessed genes, methylation analysis of more candidate genes with CpG islands is necessary to clarify this issue. On the basis of the significant difference in the methylation index between gastric carcinoma and premalignant lesions, it can be speculated that accumulation of inactivated genes by aberrant methylation is important for malignant transformation from premalignant lesions.

The data in the present study showed less frequent methylation in early-step lesions and a statistically significant trend toward increasing methylation along the multistep carcinogenesis. This raises a possibility that more advanced malignancies may have acquired additional epigenetic changes during tumor progression. However, when we analyzed the correlation between the methylation index and Tumor-Node-Metastasis stage of gastric carcinomas, there was no statistical significance (data not shown). Furthermore, 16 (25%) of 64 gastric carcinomas had no methylation of the five tested genes. These findings argue against the acquisition of hypermethylation during tumor progression of gastric carcinomas. A previous study (28) reported that gastric carcinomas with hypermethylation of multiple loci had a relatively earlier stage than gastric carcinomas with no or less frequent hypermethylation.

The analysis of other normal tissue samples for the methylation status of DAP-kinase, THBS1, and TIMP-3 demonstrated hypermethylation of DAP-kinase or THBS1 in a small percentage of normal bile duct mucosa and colon mucosa but not in normal breast tissue. TIMP-3 was not methylated in these normal tissues. The results showed a tissue-type-specific difference of gene hypermethylation. This was reported in E-cadherin, which was frequently hypermethylated in normal gastric mucosa but rarely in normal esophageal mucosa (30). When the hypermethylation frequency of the three genes was compared between adult and pediatric chronic gastritis samples, DAP-kinase was not hypermethylated in pediatric samples, but there was no difference in the hypermethylation frequency of THBS1 or TIMP-3. This suggests that in gastric mucosa, DAP-kinase hypermethylation may be an age-related change.

In conclusion, we have studied promoter hypermethylation of several genes and determined the frequency and chronology of hypermethylation during multistep carcinogenesis from chronic gastritis to gastric carcinoma. We found that aberrant CpG island hypermethylation occurred in early stages and tended to increase along the multistep gastric carcinogenesis, although the timing and frequency of hypermethylation varied according to the gene.

Fig. 1.

MSP analysis of p16, hMLH1, DAP-kinase, THBS1 and TIMP-3. DNA extracted from non-neoplastic mucosae (chronic gastritis, cases 1 and 4; intestinal metaplasia, cases 2, 3, 5, and 9), adenomas (cases 19, 20, 23, 38, 45, and 46), and carcinomas (cases 48, 49, 50, 51, 52, and 53) were amplified with primers specific to the unmethylated (U) or the methylated (M) CpG islands of each gene after modification with sodium bisulfite. L, molecular weight markers.

Fig. 1.

MSP analysis of p16, hMLH1, DAP-kinase, THBS1 and TIMP-3. DNA extracted from non-neoplastic mucosae (chronic gastritis, cases 1 and 4; intestinal metaplasia, cases 2, 3, 5, and 9), adenomas (cases 19, 20, 23, 38, 45, and 46), and carcinomas (cases 48, 49, 50, 51, 52, and 53) were amplified with primers specific to the unmethylated (U) or the methylated (M) CpG islands of each gene after modification with sodium bisulfite. L, molecular weight markers.

Close modal
Fig. 2.

Sequencing analysis of four cloned MSP products of each gene (p16, hMLH1, DAP-kinase, THBS1, and TIMP-3). When four sequenced clones were all methylated at a CpG site, it was scored as 100%. •,,,, and represent methylation frequencies of 100%, 75%, 50%, and 25%, respectively. Except for primer complementary sequences, p16-MSP products have 11 CpG sites (−52, −48, −45, −39, −17, −13, −10, +8, +11, +14 and +35 from translation initiation site); hMLH1, 13 CpG sites (−623, −615, −608, −605, −603, −599, −597, −587, −579, −576, −551, −544, and −522 from transcription start site); DAP-kinase, 5 CpG sites (−290, −288, −277, −269, and −264 from translation initiation site); THBS1, 5 CpG sites (−18, −16, −7, +5, and +10 from transcription start site); and TIMP-3, 3 CpG sites (−47, −34, −9, −47 to −9 from transcription start site). N, non-neoplastic mucosa, A, adenoma; C, carcinoma.

Fig. 2.

Sequencing analysis of four cloned MSP products of each gene (p16, hMLH1, DAP-kinase, THBS1, and TIMP-3). When four sequenced clones were all methylated at a CpG site, it was scored as 100%. •,,,, and represent methylation frequencies of 100%, 75%, 50%, and 25%, respectively. Except for primer complementary sequences, p16-MSP products have 11 CpG sites (−52, −48, −45, −39, −17, −13, −10, +8, +11, +14 and +35 from translation initiation site); hMLH1, 13 CpG sites (−623, −615, −608, −605, −603, −599, −597, −587, −579, −576, −551, −544, and −522 from transcription start site); DAP-kinase, 5 CpG sites (−290, −288, −277, −269, and −264 from translation initiation site); THBS1, 5 CpG sites (−18, −16, −7, +5, and +10 from transcription start site); and TIMP-3, 3 CpG sites (−47, −34, −9, −47 to −9 from transcription start site). N, non-neoplastic mucosa, A, adenoma; C, carcinoma.

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by the Korea Science and Engineering Foundation (Grant No. 1999-2-208-004-5).

3

The abbreviations used are: hMLH1, human Mut L homologue 1; TIMP-3, tissue inhibitor of metalloproteinase 3; DAP-kinase, death-associated protein kinase; THBS1, thromobospondin-1; MSP, methylation-specific PCR.

Table 1

Primer sequences and PCR conditions for MSP analysis

Primer namePrimer sequence (5′–3′)Product size (bp)Annealing temperature (°C)
p16 mf TTATTAGAGGGTGGGGCGGATCGC 150 65 
mR GACCCCGAACCGCGACCGTAA   
uF TTATTAGAGGGTGGGGTGGATTGT 151 60 
uR CAACCCCAAACCACAACCATAA   
hMLH1 mF TATATCGTTCGTAGTATTCGTGT 153 60 
mR TCCGACCCGAATAAACCCAA   
uF TTTTGATGTAGATGTTTTATTAGGGTTGT 124 60 
uR ACCACCTCATCATAACTACCCACA   
DAP-kinase mF GGATAGTCGGATCGAGTTAACGTC 98 60 
mR CCCTCCCAAACGCCGA   
uF GGAGGATAGTTGGATTGAGTTAATGTT 106 60 
uR CAAATCCCTCCCAAACACCAA   
THBS1 mF TGCGAGCGTTTTTTTAAATGC 74 62 
mR TAAACTCGCAAACCAACTCG   
uF GTTTGGTTGTTGTTTATTGGTTG 115 62 
uR CCTAAACTCACAAACCAACTCA   
TIMP-3 mF CGTTTCGTTATTTTTTGTTTTCGGTTTTC 116 59 
mR CCGAAAACCCCGCCTCG   
uF TTTTGTTTTGTTATTTTTTGTTTTTGGTTTT 122 59 
uR CCCCCAAAAACCCCACCTCA   
Primer namePrimer sequence (5′–3′)Product size (bp)Annealing temperature (°C)
p16 mf TTATTAGAGGGTGGGGCGGATCGC 150 65 
mR GACCCCGAACCGCGACCGTAA   
uF TTATTAGAGGGTGGGGTGGATTGT 151 60 
uR CAACCCCAAACCACAACCATAA   
hMLH1 mF TATATCGTTCGTAGTATTCGTGT 153 60 
mR TCCGACCCGAATAAACCCAA   
uF TTTTGATGTAGATGTTTTATTAGGGTTGT 124 60 
uR ACCACCTCATCATAACTACCCACA   
DAP-kinase mF GGATAGTCGGATCGAGTTAACGTC 98 60 
mR CCCTCCCAAACGCCGA   
uF GGAGGATAGTTGGATTGAGTTAATGTT 106 60 
uR CAAATCCCTCCCAAACACCAA   
THBS1 mF TGCGAGCGTTTTTTTAAATGC 74 62 
mR TAAACTCGCAAACCAACTCG   
uF GTTTGGTTGTTGTTTATTGGTTG 115 62 
uR CCTAAACTCACAAACCAACTCA   
TIMP-3 mF CGTTTCGTTATTTTTTGTTTTCGGTTTTC 116 59 
mR CCGAAAACCCCGCCTCG   
uF TTTTGTTTTGTTATTTTTTGTTTTTGGTTTT 122 59 
uR CCCCCAAAAACCCCACCTCA   
Table 2

The frequency of promoter hypermethylation of p16, hMLH1, DAP-kinase, THBS1, and TIMP-3 in chronic gastritis, intestinal metaplasia, adenomas, and carcinomas

Chronic gastritis (n = 69)Intestinal metaplasia (n = 49)Gastric adenoma (n = 61)Gastric carcinoma (n = 64)P
p16 2.1%a 11.5%a,b 42.2%b <0.001 
hMLH1 0c 6.3%c,d 9.8% 20.3%d 0.001 
DAP-kinase 25 % 36.7% 33.9% 34.4%g NSe 
THBS1 10.1%f 34.7%f,g 28.3h 48.4%g,h <0.001 
TIMP-3 14.5%i 36.7%i,j 26.7%k 57.4%j,k <0.001 
Chronic gastritis (n = 69)Intestinal metaplasia (n = 49)Gastric adenoma (n = 61)Gastric carcinoma (n = 64)P
p16 2.1%a 11.5%a,b 42.2%b <0.001 
hMLH1 0c 6.3%c,d 9.8% 20.3%d 0.001 
DAP-kinase 25 % 36.7% 33.9% 34.4%g NSe 
THBS1 10.1%f 34.7%f,g 28.3h 48.4%g,h <0.001 
TIMP-3 14.5%i 36.7%i,j 26.7%k 57.4%j,k <0.001 
a

Intestinal metaplasia versus gastric adenoma; P > 0.05 (two-tailed Fisher’s exact test).

b

Gastric adenoma versus carcinoma, P < 0.001 (two-tailed Fisher’s exact test).

c

Gastric gastritis versus intestinal metaplasia, > 0.05, (two-tailed Fisher’s exact test).

d

Intestinal metaplasia versus carcinoma, P = 0.054, (two-tailed Fisher’s exact test).

e

NS, not significant.

f

hronic gastritis versus intestinal metaplasia, P = 0.002, (two-tailed Fisher’s exact test).

g

Intestinal metaplasia versus carcinoma, P > 0.05, (two-tailed Fisher’s exact test).

h

Gastric adenoma versus carcinoma, P = 0.027, (two-tailed Fisher’s exact test).

i

Chronic gastritis versus intestinal metaplasia, P = 0.008, (two-tailed Fisher’s exact test).

j

Intestinal metaplasia versus carcinoma, P = 0.036, (two-tailed Fisher’s exact test).

k

Gastric adenoma versus carcinoma, P = 0.001, (two-tailed Fisher’s exact test)

Table 3

The methylation index and number of methylated genes in chronic gastritis, intestinal metaplasia, adenomas, and carcinomas

Chronic gastritis (n = 69)Intestinal metaplasia(n = 49)Gastric adenoma (n = 61)Gastric carcinoma (n = 64)
Average no. of methylated genes 0.5a 1.1a 1.1b 2.0b 
No. of methylated genesc     
47 (68.2%) 20 (40.8%) 23 (37.7%) 16 (25%) 
13 (18.8%) 8 (16.3%) 18 (29.5%) 10 (15.6%) 
7 (10.1%) 16 (32.7%) 12 (19.7%) 10 (15.6%) 
2 (2.9%) 5 (10.2%) 8 (13.1%) 15 (23.4%) 
11 (17.2%) 
2 (3.2%) 
Chronic gastritis (n = 69)Intestinal metaplasia(n = 49)Gastric adenoma (n = 61)Gastric carcinoma (n = 64)
Average no. of methylated genes 0.5a 1.1a 1.1b 2.0b 
No. of methylated genesc     
47 (68.2%) 20 (40.8%) 23 (37.7%) 16 (25%) 
13 (18.8%) 8 (16.3%) 18 (29.5%) 10 (15.6%) 
7 (10.1%) 16 (32.7%) 12 (19.7%) 10 (15.6%) 
2 (2.9%) 5 (10.2%) 8 (13.1%) 15 (23.4%) 
11 (17.2%) 
2 (3.2%) 
a

Chronic gastritis versus intestinal metaplasia; P = 0.001; Student t test.

b

Gastric adenoma versus gastric carcinoma; P < 0.001; Student t test.

c

P < 0.001; χ2 test.

Table 4

Hypermethylation of DAP-kinase, THBS1, and TIMP-3 in gastric mucosa, colon mucosa, breast tissue, and bile duct mucosa

DAP-kinaseTHBS1TIMP-3
Chronic gastritis, adult samples (n = 69)a 25%c 10.1% 14.5% 
Chronic gastritis, child samples (n = 48)b 0c 10% 15% 
Colon mucosa (n = 34)  8.8% 
Breast tissue (n = 13) 
Bile duct mucosa (n = 11) 9.1% 27.3% 
DAP-kinaseTHBS1TIMP-3
Chronic gastritis, adult samples (n = 69)a 25%c 10.1% 14.5% 
Chronic gastritis, child samples (n = 48)b 0c 10% 15% 
Colon mucosa (n = 34)  8.8% 
Breast tissue (n = 13) 
Bile duct mucosa (n = 11) 9.1% 27.3% 
a

Mean age, 48 years.

b

Mean age, 11 years.

c

P < 0.001, χ2 test.

1
Tahara E. Molecular mechanism of stomach carcinogenesis.
J. Cancer Res. Clin. Oncol.
,
119
:
265
-272,  
1993
.
2
Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation; a fundamental aspect of neoplasia.
Adv. Cancer Res.
,
72
:
141
-196,  
1998
.
3
Delgado S., Gomez M., Bird A., Antequera F. Initiation of DNA replication at CpG islands in mammalian chromosomes.
EMBO J.
,
17
:
2426
-2435,  
1998
.
4
Jones P. A., Laird P. W. Cancer epigenetic comes of age.
Nat. Genet.
,
21
:
163
-167,  
1999
.
5
Shim Y. H., Kang G. H., Ro J. Y. Correlation of p16 hypermethylation with the p16 protein loss in sporadic gastric carcinomas.
Lab. Invest.
,
80
:
689
-695,  
2000
.
6
Leung S. Y., Yuen S. T., Chung L. P., Chu K. M., Chan A. S. Y., Ho J. C. I. hMLH1 promoter methylation and lack of hMLH1 expression in sporadic gastric carcinomas with high-frequency microsatellite instability.
Cancer Res.
,
59
:
159
-164,  
1999
.
7
Kang S. H., Choi H. H., Kim S. G., Jong H. S., Kim N. K., Kim S. J., Bang Y. J. Transcriptional inactivation of the tissue inhibitor of metalloproteinase-3 gene by DNA hypermethylation of the 5′-CpG island in human gastric cancer cell lines.
Int. J. Cancer
,
86
:
632
-635,  
2000
.
8
Bevilacqua R. A. U., Simpson A. J. G. Methylation of the hMLH1 promoter but no hMLH1 mutations in sporadic gastric carcinomas with high-level microsatellite instability.
Int. J. Cancer
,
87
:
200
-203,  
2000
.
9
Lee Y. Y., Kang S. H., Seo J. Y., Jung C. W., Lee K. U., Choe K. J., Kim B. K., Kim N. K., Koeffler H. P., Bang Y. J. Alterations of p16INK4A and p15INK4B genes in gastric carcinomas.
Cancer (Phila.)
,
80
:
1889
-1896,  
1997
.
10
Kissil J. L., Feinstein E., Cohen O., Jones P. A., Tsai Y. C., Knowles M. A., Eydmann M. E., Kimchi A. DAP-kinase loss of expression in various carcinoma and B-cell lymphoma cell lines: possible implications for role as tumor suppressor gene.
Oncogene
,
15
:
403
-407,  
1997
.
11
Esteller M., Sanchez-Cespedes M., Rosell R, Sidransky D., Baylin S. B., Herman J. G. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients.
Cancer Res.
,
59
:
67
-70,  
1999
.
12
Katzenellenbogen R. A., Baylin S. B., Herman J. G. Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies.
Blood.
,
93
:
4347
-4353,  
1999
.
13
Tang X., Khuri F. R., Lee J. J., Kemp B. L., Liu D., Hong W. K., Mao L. Hypermethylation of the death-associated protein (DAP) kinase promoter and aggressiveness in stage I non-small cell lung cancer.
J. Natl. Cancer Inst.
,
92
:
1511
-1516,  
2000
.
14
Roberts D. D. Regulation of tumor growth and metastasis by thrombospondin-1.
FASEB J.
,
10
:
1183
-1191,  
1996
.
15
Li Q., Ahuja N., Burger P. C., Issa J. P. Methylation and silencing of the thrombospondin-1 promoter in human cancer.
Oncogene
,
18
:
3284
-3289,  
1999
.
16
Ueki T., Toyotam M. Sohnm T., Yeo C. J., Issa J. P., Hruban R. H., Goggins M. Hypermethylation of multiple genes in pancreatic adenocarcinoma.
Cancer Res.
,
60
:
1835
-1839,  
2000
.
17
Ahuja N., Li Q., Mohan A. L., Baylin S. B., Issa J. P. Aging, and DNA methylation in colorectal mucosa and cancer.
Cancer Res.
,
58
:
5489
-5494,  
1998
.
18
Watanabe H., Jass J. R., Sobin L. H. .
WHO histological typing of esophageal and gastric tumors
, Ed. 2
19
-20, Springer-Verlag New York, Inc. New York  
1990
.
19
Kolodziejczyk P., Yao T., Oya M., Nakamura S., Utsunomiya T., Ishikawa T., Tsuneyoshi M. Long-term follow-up study of patients with gastric adenomas with malignant transformation: an immunohistochemical and histochemical analysis.
Cancer (Phila.)
,
74
:
2896
-2907,  
1994
.
20
Orlowska J., Jarosz D., Pachlewski J., Butruk E. Malignant transformation of benign epithelial gastric polyps.
Am. J. Gastroenterol.
,
90
:
2152
-2159,  
1995
.
21
Stemmermann G. N. Intestinal metaplasia of the stomach.
A status report. Cancer (Phila.)
,
74
:
556
-564,  
1994
.
22
Gonmyo Y., Osaki M., Kaibara N., Ito H. Numerical aberration and point mutation of p53 gene in human gastric intestinal metaplasia and well-differentiated adenocarcinoma: analysis by fluorescence in situ hybridization (FISH) and PCR-SSCP.
Int. J. Cancer
,
66
:
594
-599,  
1996
.
23
Gong C., Mera R., Bravo J. C., Ruiz B., Diaz-Escamilla R., Fontham E. T., Correa P., Hunt J. D. KRAS mutations predict progression of preneoplastic gastric lesions.
Cancer Epidemiol. Biomark. Prev.
,
8
:
167
-171,  
1999
.
24
Kang G. H., Shim Y. H., Ro J. Y. Correlation of methylation of the hMLH1 promoter with lack of expression of hMLH1 in sporadic gastric carcinomas with replication error.
Lab. Invest.
,
79
:
903
-909,  
1999
.
25
Hermans J. G., Graff J. R., Myöhänen S., Nelkin B. D., Baylin S. B. Methylation-specific PCR. A novel PCR assay for methylation status of CpG islands.
Proc. Natl. Acad. Sci. USA
,
93
:
9821
-9826,  
1996
.
26
Song S. H., Jong H. S., Choi H. H., Kang S. H., Ryu M. H., Kim N. K., Kim W. H., Bang Y. J. Methylation of specific CpG sites in the promoter region could significantly down-regulate p16(INK4a) expression in gastric adenocarcinoma.
Int. J. Cancer
,
87
:
236
-240,  
2000
.
27
Suzuki H., Itoh F., Toyota M., Kikuchi T., Kakiuchi H., Hinoda Y., Imai K. Distinct methylation pattern and microsatellite instability in sporadic gastric cancer.
Int. J. Cancer
,
83
:
309
-313,  
1999
.
28
Toyota M., Ahuja N., Suzuki H., Itoh F., Ohe-Toyota M., Imai K., Baylin S. B., Issa J. P. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype.
Cancer Res.
,
59
:
5438
-5442,  
1999
.
29
Kobayashi K., Okamoto T., Takayama S., Akiyama M., Ohno T., Yamada H. Genetic instability in intestinal metaplasia is a frequent event leading to well-differentiated early adenocarcinoma of the stomach.
Eur. J. Cancer
,
36
:
1113
-1119,  
2000
.
30
Eads C. A., Lord R. V., Kurumboor S. K., Wickramainghe K., Skinner M. L., Long T. I., Peters J. H., DeMeester T. R., Danenberg K. D., Danenberg P. V., Laird P. W., Skinner K. A. Fields of aberrant CpG island hypermethylation in Barrett’s Esophagus and associated adenocarcinoma.
Cancer Res.
,
60
:
5021
-5026,  
2000
.