Clinical and molecular findings suggest that the four major histological subtypes of ovarian carcinoma (serous, clear cell, mucinous, and endometrioid) likely represent distinct disease entities. Prior studies have shown that ovarian endometrioid adenocarcinomas (OEAs) often carry mutations in the CTNNB1 gene, which encodes β-catenin, a critical component of the Wnt signaling pathway. However, the nature of other defects in the Wnt signaling pathway in ovarian carcinomas remains largely unknown. Thus, in 45 primary OEAs and two OEA-derived cell lines, we sought to comprehensively address the prevalence of and mechanisms underlying β-catenin and Wnt pathway deregulation. CTNNB1 missense mutations were detected in 14 primary tumors. All mutations affected the NH2-terminal regulatory domain of β-catenin, presumably rendering the mutant proteins resistant to degradation. Immunohistochemical studies revealed nuclear accumulation of β-catenin in all but two tumors with CTNNB1 mutations. Two primary tumors lacking CTNNBI mutations showed strong nuclear immunoreactivity for β-catenin. In one of the two tumors, biallelic inactivation of the APC gene was found. In the remaining 29 primary OEAs, unequivocal nuclear β-catenin immunoreactivity was not observed, though a nonsense mutation in AXIN1 was observed in one tumor and a truncating frameshift mutation in AXIN2 was seen in another case. Both OEA-derived cell lines studied (TOV-112D and MDAH-2774) had elevated constitutive T-cell factor/lymphoid enhancer factor transcriptional activity. TOV-112D cells were shown to harbor mutant β-catenin, whereas a missense AXIN1 sequence alteration was identified in MDAH-2774 cells. Collectively, our findings demonstrate frequent defects of the Wnt signaling pathway in a particular subtype of ovarian carcinomas, i.e., OEAs. Although mutations in the CTNNB1 gene are the most common mechanism of β-catenin deregulation in OEAs, β-catenin deregulation may also result from mutations in the APC, AXIN1, and AXIN2 genes.

Ovarian cancer causes more deaths of women in the United States than any other gynecological malignancy (1). Most malignant ovarian tumors are epithelial (carcinomas) and are thought to arise from the ovarian surface epithelium or the secondary Müllerian system, which includes endometriosis (2). Although the existing classification scheme for ovarian carcinomas is based entirely on morphological criteria, clinical and molecular genetic analyses suggest that the major histological subtypes (e.g., serous, clear cell, mucinous, and endometrioid) likely represent distinct disease entities (3, 4, 5). Moreover, ovarian carcinoma precursor lesions may well be subtype specific (6). Hence, a clearer understanding of ovarian cancer pathogenesis might be more readily attained from focused molecular genetic studies of important cell signaling pathways in distinct ovarian carcinoma subsets, rather than through studies of a more heterogeneous collection of carcinomas.

OEAs3 share molecular genetic features with uterine endometrioid adenocarcinomas, including frequent mutations of the PTEN tumor suppressor gene (7), microsatellite instability (8, 9), and mutations of the CTNNB1 gene (10, 11, 12, 13, 14). CTNNB1 encodes β-catenin, a vertebrate homologue of Drosophila armadillo and a critical component of the highly conserved Wnt signaling pathway (15). The Wnt pathway has a critical role in regulating cell fate specification, proliferation, and differentiation in various tissues (15). β-Catenin levels are regulated by a protein complex containing the APC protein, GSK3β, and AXIN (16, 17). This protein complex promotes degradation of free cytosolic β-catenin via GSK3β-mediated phosphorylation of NH2-terminal β-catenin sequences and subsequent ubiquitination and proteasome degradation of β-catenin. When the Wnt pathway is activated, GSK3β activity and β-catenin ubiquitination and degradation are inhibited, and β-catenin enters the nucleus where it complexes with TCF/LEF transcription regulator proteins (17). The TCF/LEF proteins cooperate with nuclear β-catenin to activate transcription of target genes, including perhaps c-MYC(18), cyclin D1(19, 20), and MMP-7(21), although many of the TCF/LEF target genes remain unknown. Oncogenic mechanisms leading to β-catenin stabilization include inactivation of the APC tumor suppressor protein and mutational activation of β-catenin itself via localized mutations of its NH2-terminal GSK3β regulatory motif (22, 23, 24). More recently, inactivating mutations in AXIN (AXIN1) in hepatocellular carcinomas and colon cancer cell lines (25, 26), and inactivating mutations in its homologue, AXIN2 (AXIL/Conductin), have been detected in microsatellite unstable colorectal cancers (27). Rare mutations of CTNNG1, which encodes γ-catenin, have also been identified in human cancer (28). γ-Catenin is another vertebrate homologue of Drosophila armadillo that, similar to β-catenin, functions in cell adhesion and Wnt signaling (29, 30). Although some prior studies have provided evidence that a sizable percentage of OEAs harbor β-catenin mutations (10, 11, 12, 13, 14), studies of APC in OEAs have been extremely limited thus far, and no APC mutations have been reported (31). Whether CTNNG1, AXIN1, or AXIN2 mutations play a role in the pathogenesis of these tumors remains unknown.

In an effort to better understand the molecular pathogenesis of OEAs, we collected 45 primary OEAs and 2 OEA-derived cell lines and carried out a comprehensive molecular analysis of several genes encoding proteins known to function in the Wnt signaling pathway. We found Wnt pathway defects in both OEA cell lines and in nearly half of the primary OEAs analyzed. β-Catenin deregulation was most often attributable to mutation of β-catenin itself and less frequently to inactivating mutations in APC, AXIN1, or AXIN2. Collectively, our findings provide evidence for diverse mechanisms of β-catenin deregulation in this particular subtype of ovarian cancer.

Tumor Samples.

A total of 45 snap-frozen primary OEAs were analyzed. Six specimens were obtained from the Johns Hopkins Hospital; 2 from the University of Michigan Hospital; and 37 from the Cooperative Human Tissue Network/Gynecological Oncology Group Tissue Bank. A small portion of formalin-fixed, paraffin-embedded tissue from each specimen was histologically verified as OEA by a gynecological pathologist (K. R. C.) and classified as well, moderately, or poorly differentiated, based on the tumor’s histological features. Tumor stage (I–IV) was assigned according to the International Federation of Gynecology and Obstetrics (FIGO) system. Analysis of tissues from human subjects was approved by the University of Michigan’s Institutional Review Board (IRB-MED 2001-0022).

Cell Lines.

Two OEA-derived cell lines (TOV-112D and MDAH-2774), two ovarian clear cell carcinoma-derived cell lines (TOV-21G and ES-2), two ovarian adenocarcinoma (histological type unknown)-derived cell lines (NIH:OVCAR-3 and SKOV-3), and colon cancer cell line SW480 were obtained from the American Type Culture Collection (Manassas, VA). Ovarian serous carcinoma-derived cell lines HOC-1, HOC-7, HOC-8, and ovarian serous cystadenoma cell lines ML3 and ML10 were a gift from L. Dubeau (USC School of Medicine, Los Angeles, CA). Ovarian carcinoma cell lines (histological type unknown) OVCAR-4, OVCAR-5, OVCAR-8, PEO1, and PEO4 were a gift of T. Hamilton (Fox Chase Cancer Center, Philadelphia, PA). Ovarian serous carcinoma cell line DOV13 was a gift of D. Fishman (Northwestern University, Chicago, IL). IOSE-80 cells (human ovarian surface epithelial cells expressing SV40 large T Antigen) were a gift of N. Auersperg (University of British Columbia, Vancouver, British Columbia, Canada). TOV-112D and TOV-21G were cultured in 1:1 mixture of MCDB 105 medium (Sigma Chemical Co., St. Louis, MO) and Medium 199 (Life Technologies, Inc., Gaithersburg, MD) with 15% FBS (Life Technologies, Inc.). MDAH-2774 cells were cultured in RPMI 1640/10% FBS. ES-2 cells were cultured in McCoy’s 5A/10% FBS. All other cell lines were maintained in DMEM with 10% FBS.

DNA, RNA, and cDNA Preparation.

Primary tumor tissues were manually microdissected prior to nucleic acid extraction to ensure that each tumor sample contained at least 70% tumor cells. H&E-stained sections of frozen tumor tissues were used as dissection guides. Genomic DNA was isolated from pooled frozen tissue sections, using standard SDS/proteinase K digestion followed by phenol/chloroform extraction. Total RNA was extracted with Trizol (Life Technologies, Inc.) according to the manufacturer’s protocol. First-strand cDNA was synthesized from DNaseI-treated mRNA samples using random hexamer primers (Pharmacia Biotech, Piscataway, NJ) and Superscript II (Life Technologies, Inc.).

PCR.

The PCR primers used for each reaction are specified in Table 1. GenBank accession numbers for the nucleotide sequences used to determine suitable primer sequences are as follows: CTNNB1, X87838; CTNNG1, AF233882; APC, M74088; AXIN1, AF009674; and AXIN2, AF078165. The entirety of CTNNB1 exon 3 was amplified from cDNA using a forward primer in exon 2 and reverse primer in exon 4. A portion of CTNNG1 (γ-catenin) exon 1 was amplified from genomic DNA using exon-based primers flanking the region encoding the GSK3β regulatory domain near the γ-catenin NH2 terminus. The coding region of AXIN1 was amplified from genomic DNA exon-by-exon using 10 pairs of intron-based primers. The coding region of AXIN2 was amplified from cDNA using primers to generate six overlapping cDNA segments. PCR for APC was performed using either cDNA (exons 1–14) or genomic DNA (exon 15) as templates. All PCR reactions were carried out in a final volume of 50 μl containing 50 mm KCl, 1.5 mm MgCl2, 10 mm Tris-HCl (pH 8.3), 200 μm of each deoxynucleotide triphosphate, 0.2 μm each primer, and 2.5 units Taq polymerase (Life Technologies, Inc.). The annealing temperature used for each primer pair is specified in Table 1. After an initial denaturation at 95°C for 3 min, templates were amplified for 35 cycles (95°C for 30 s, 54–66°C for 30 s, and 72°C for 45 to 90 s), followed by a 5-min extension at 72°C. PCR products were visualized on 1- 2% agarose gels and purified with Qiaquick gel extraction kits (Qiagen, Valencia, CA).

Nucleotide Sequence Analysis.

Sequencing of PCR products was carried out using Thermo-Sequenase and 33P-labeled dideoxynucleoside triphosphates (United States Biochemical, Cleveland, OH) or by automated sequencing conducted by the University of Michigan’s Sequencing Core. All sequence alterations were confirmed by bidirectional manual sequencing of PCR products generated by at least two independent reactions.

PCR Amplification of Microsatellite Sequences.

Two microsatellite loci on chromosome 11q23 (D11S1647 and D11S1987; Research Genetics, Huntsville, AL) were amplified from genomic DNA extracted from tumor and matched normal tissue. Each PCR mixture contained 37.5 mm Tris, 2.2 mm MgCl2, 200 μm each dATP, dGTP, dTTP, 25 μm dCTP, 2 μCi (3000 Ci/mmol) [32P]dCTP, 1 μm each primer, and 1 unit of Taq polymerase. Target sequences were amplified for 30 cycles as described above. PCR products were resolved by electrophoresis on 6% polyacrylamide gels, which were dried and subjected to autoradiography.

PTT.

A PTT was used to screen samples for protein truncating mutations in the APC gene. A large portion of the APC coding region (codons 1–2247; exons 1–14 and a portion of exon 15) was amplified from cDNA or genomic DNA (exon 15) in four overlapping segments encompassed by the T7-modified primers (T7-trans) specified in Table 1. The great majority of the APC mutations identified to date are within this region of the gene.4 After verifying the presence of PCR-amplified products for each segment on 1% agarose gels, radioactive in vitro transcription/translation of the PCR-generated fragments was performed using the TNT Quick Coupled Transcription/Translation System (Promega Corp., Madison, WI) according to the manufacturer’s instructions. Products were separated on NuPAGE 10% Bis-Tris precast gels (Invitrogen, San Diego, CA) at 40 V for 60 min. The gels were fixed in methanol and acetic acid for 30 min and then soaked in Amplifying Solution (Amersham, Arlington Heights, IL) for 30 min for fluorographic enhancement of signal. After fixation in 7% acetic acid/7% methanol/1% glycerol, gels were dried and exposed to X-OMAT AR scientific imaging film (Kodak, Rochester NY). For samples with bandshifts in the PTT, the appropriate APC gene regions were amplified by PCR and bidirectionally sequenced.

Immunohistochemical Analysis of β-Catenin.

Five-μm sections of formalin-fixed, paraffin-embedded tissues were mounted on Probe-On slides (Fisher Scientific, Itasca, IL), deparaffinized in xylene, and then rehydrated into distilled H2O through graded alcohols. Antigen retrieval was enhanced by microwaving the slides in citrate buffer (pH 6.0; Biogenex, San Ramon, CA) for 10 min. Endogenous peroxidase activity was quenched by incubation with 6% hydrogen peroxide in methanol, and then the sections were postfixed in 10% buffered formalin, washed, and blocked with 1.5% normal horse serum for 1 h. Sections were then incubated with a mouse monoclonal anti-β-catenin antibody (C19220; Transduction Laboratories, Lexington, KY) at a dilution of 1:500 overnight at 4°C. Slides were washed in PBS and then incubated with a biotinylated horse antimouse secondary antibody for 30 min at room temperature. Antigen-antibody complexes were detected with the avidin-biotin peroxidase method using 3,3′-diaminobenzidine as a chromogenic substrate (Vectastain ABC kit; Vector Laboratories, Burlingame, CA). Immunostained sections were lightly counterstained with hematoxylin and then examined by light microscopy. Immunostaining was scored on a three-tiered scale for intensity (+, absent/weak; ++, moderate; and +++, strong) in the tumor cell nuclei, cytoplasm, and cell membranes.

Immunofluorescence Studies of β-catenin.

Cells were grown on coverslips for 1–2 days, then fixed with 3% paraformaldehyde for 15 min at room temperature, and permeabilized with 1% goat serum/0.5% Triton X-100/PBS for 15 min at room temperature. After washing with PBS, the slides were blocked with 20% goat serum/0.2% Triton X-100/PBS for 30 min at room temperature. Cells were incubated with anti-β-catenin antibody (C19220; Transduction Laboratories) diluted 1:300 at room temperature for 2 h. After washing with 2% goat serum/0.2% Triton-X-100/PBS, cells were incubated with fluorescein (FITC)-conjugated AffiniPure donkey antimouse IgG (Jackson Immuno Research Laboratories, Inc., West Grove, PA) at a dilution of 1:200 for 60 min at room temperature. Slides were washed with PBS and then counterstained with propidium iodide (Sigma Chemical Co., St. Louis, MO) at a concentration of 1 μg/ml for 5 min. After mounting in aqueous medium, fluorescent microscopy was used to observe β-catenin localization.

β-Catenin/TCF Transcription Reporter Assay.

β-Catenin/TCF transcriptional reporter assays were performed essentially as described previously (24, 32). To measure TCF reporter activity in the ovarian carcinoma and other cell lines, cultured cells were plated in six-well plates 16 h prior to transient transfection with the reporter constructs pTopflash or pFopflash, which were gifts from B. Vogelstein (Johns Hopkins University, Baltimore, MD). All transfections were performed with FuGene 6 reagent (Roche, Indianapolis, IN) and 0.5 μg of pTopflash or pFopflash. To normalize transfection efficiency in the reporter assays, cells were cotransfected with 0.5 μg of pCH110 (Amersham), which contains a functional LacZ gene cloned downstream of a cytomegalovirus early region promoter-enhancer element. Forty-eight h after transfection, the cells were washed with PBS and then lysed with reporter lysis buffer (Promega). Luciferase activities were measured with a luminometer (model TD-20E; Turner Corp., Mountain View, CA) after adding luciferase assay reagent (Promega) to the cell lysates. β-galactosidase activities were measured using the β-galactosidase enzyme assay system (Promega) and a microplate reader (model 3550-UV; Bio-Rad, Hercules, CA). Each experiment was performed in triplicate.

TCF-dependent Transcription Is Activated in OEA-derived Cell Lines.

Most available ovarian cancer cell lines were derived from serous carcinomas, not endometrioid, clear cell, or mucinous primary tumors. In some cases, the histological subtype of primary carcinoma from which a cell line was derived was unknown, but the origin was most likely serous, because serous carcinomas are more common than all other histological subtypes combined (33). We assayed TCF transcriptional activity as a strategy for assessing alterations in the Wnt signaling pathway in ovarian carcinoma cell lines, two of which are known to be derived from OEAs (TOV-112D and MDAH-2774). Cells were transfected with either a wild-type TCF-dependent luciferase reporter plasmid (pTopflash) or a mutated control version (pFopflash), and the ratio of the luciferase activity of pTopflash versus pFopflash in a given cell line was considered a measure of relative TCF activity. Representative data are shown in Fig. 1. Both TOV-112D and MDAH-2774 demonstrated constitutively increased TCF-dependent transcriptional activity (about 30- and 7-fold, respectively) compared with ovarian surface epithelial cells (IOSE-80), serous cystadenoma-derived cells (ML3 and ML10), or various cell lines derived from nonendometrioid ovarian carcinomas (TOV-21G, ES-2, DOV13, HOC-1, HOC-7, HOC-8, A1847, NIH:OVCAR-3, OVCAR4, OVCAR5, OVCAR8, OVCAR10, PEO1, PEO4, and SKOV3). Increased (5.3-fold) TCF-dependent transcription in MDAH-2774 cells has been noted previously by Furlong and Morin (34).

Nuclear Localization of β-Catenin in OEA Lines and a Subset of Primary Tumors.

Immunofluorescent staining of the two OEA-derived cell lines, TOV-112D and MDAH-2774, showed nuclear accumulation of β-catenin in a subset of tumor cells, similar to the pattern of β-catenin staining observed in cell lines with known Wnt pathway defects (Fig. 2, A–D). Nuclear immunoreactivity for β-catenin was more diffuse in TOV-112D than in MDAH-2774 cells. The basis for nonuniformity of nuclear β-catenin accumulation in cell lines with pathway defects is unclear, but differences may relate to nonuniformity of β-catenin expression in individual cells and/or to the levels of other proteins, such as ICAT, that may regulate β-catenin or its interaction with TCF/LEF factors (35). Nuclear immunoreactivity for β-catenin was also observed in 14 of the 45 primary OEAs (Table 2 and Fig. 2, E–J). Primary tumors with nuclear accumulation of β-catenin frequently showed reduced membrane staining. Similar to the situation in cell lines, nuclear localization was typically noted in many, but not all, neoplastic cells within a given tumor.

CTNNB1 and CTNNG1 Mutational Analyses.

Somatic missense mutations in CTNNB1 sequences encoding the NH2-terminal portion of β-catenin were identified in 14 of 45 (31%) primary OEAs. All tumors with mutations were well or moderately differentiated, and many showed squamous differentiation. CTNNB1 mutations affected serine (or immediately adjacent) residues in the presumptive GSK3β regulatory motif at the β-catenin NH2 terminus (Table 2 and Fig. 3; Ref. 16). A missense CTNNB1 mutation at codon 37 (Ser→Ala) was also found in the OEA-derived cell line TOV-112D (Fig. 3). Twelve of the 14 primary OEAs with CTNNB1 mutations showed nuclear accumulation of β-catenin protein (Table 2). Exon 1 of CTNNG1, which encodes γ-catenin sequences that are also presumptive targets for phosphorylation by GSK3β, was sequenced in all primary OEAs lacking CTNNB1 mutations and in MDAH-2774 cells. No CTNNG1 mutations were identified.

APC Mutational Analysis.

PTTs for APC mutations were performed on 3 primary tumors; 2 with nuclear β-catenin accumulation and no demonstrable CTNNB1 mutation (OE-13T and OE-32T), and one with moderate cytoplasmic but no detectable membrane staining for β-catenin (OE-15T). The OEA-derived MDAH-2774 cell line was also analyzed for truncating mutations in APC. Four overlapping gene segments spanning APC codons 1–2247 were evaluated. One tumor (OE-32T) showed aberrantly migrating translation products from the first (codons 1–796) and second (codons 686-1211) segments in addition to the wild-type protein product (Fig. 4A and data not shown). Sequence analysis of OE-32T DNA revealed nonsense mutations at codons 554 and 1114; both mutations resulted in the conversion of an arginine residue to a stop codon (Fig. 4 B).

AXIN1 Mutational Analysis.

Interactions between AXIN and APC and AXIN and β-catenin are essential for promoting β-catenin phosphorylation and degradation (36). All primary OEAs with wild-type CTNNB1 and APC genes were evaluated for mutations in exons 1–5 of AXIN1. Although studies to date are somewhat limited, all previously identified AXIN1 mutations in human cancers have been shown to occur within these exons, which encode the domains implicated in binding APC, GSK3β, and β-catenin (Fig. 5,A; Ref. 26). The entirety of the AXIN1 coding region was examined in MDAH-2774 cells and in the 2 primary tumors with wild-type CTNNB1 sequences and nuclear β-catenin accumulation (OE-13T and OE-32T) as well as the tumor with significantly increased cytoplasmic β-catenin staining but no membrane staining (OE-15T). A protein truncating mutation in AXIN1 (exon 4, codon 416, Lys→stop) was identified in tumor OE-29T (Fig. 5,B), and a missense sequence alteration in AXIN1 (exon 5, codon 555, Val→Ile) was identified in MDAH-2774 cells (Fig. 5 C). Although this is a conservative amino acid change, the mutation affects a residue predicted to lie within the region of AXIN1 thought to bind β-catenin (26). Three silent single-nucleotide polymorphisms within AXIN1 were also found, affecting nucleotide 93 (codon 31) in exon 1, nucleotide 873 (codon 291) in exon 1, and nucleotide 2517 (codon 839) in exon 9. The codon 31 and 291 single-nucleotide polymorphisms and several other polymorphisms in AXIN1 have been reported previously (37).

AXIN2 Mutational Analysis.

Previous studies of colorectal carcinomas have shown AXIN2 mutations in four mononucleotide repeats within exon 7 (27). These mutations were found only in colorectal cancers with defective mismatch repair and were not seen in mismatch repair-proficient tumors. Hence, the region encompassing these mononucleotide tracts (codons 640–718) was evaluated in all primary OEAs with wild-type CTNNB1 alleles. In the 3 primary OEAs with abnormal β-catenin levels and/or localization and no detectable CTNNB1 mutations (OE-13T, OE-32T, and OE-15T), the entire AXIN2 coding region was sequenced. A frameshift mutation at codon 665 (single G deletion) was found in one primary tumor (OE-5T; Fig. 6,A). In previous work (38), this tumor was found to exhibit instability at two of two microsatellite sequences (Fig. 6 B).

Mutations of NH2-terminal β-catenin sequences have been demonstrated in various human tumor types, including colorectal carcinomas (24, 39), melanomas (40), hepatoblastomas (41), medulloblastomas (42), prostatic carcinomas (43, 44), and uterine endometrial carcinomas (45, 46, 47, 48), particularly endometrioid adenocarcinomas with squamous differentiation (10). Prior studies of ovarian carcinomas have indicated that β-catenin mutations are common only in OEAs, with estimated mutation frequencies of 16–54% (10, 11, 12, 13, 14).

We have pursued our studies of the prevalence and mechanisms underlying β-catenin deregulation in 45 histologically verified frozen primary OEA tissues. This is, in fact, a substantial number of primary tumors of this particular histological subtype, because only 10–20% of ovarian carcinomas are endometrioid (49). We identified CTNNB1 exon 3 mutations in 31% of our primary ovarian endometrioid carcinomas. Mutations inactivating the APC, AXIN1, and AXIN2 genes were each observed in 1 primary OEA and were found in tumors that showed wild-type CTNNB1 alleles. One of the 45 tumors we studied exhibited nuclear β-catenin accumulation not accounted for by mutations in the CTNNB1, APC, AXIN1, or AXIN2 genes. To our knowledge, our study is the first to identify mutations of APC, AXIN1, or AXIN2 in ovarian carcinomas. Collectively, our findings provide evidence for diverse mechanisms of β-catenin deregulation in OEAs, with demonstrable genetic mechanisms leading to β-catenin deregulation present in roughly 40% of our primary OEA specimens and in both OEA-derived cell lines. Interestingly, we observed that 11 of the 14 OEAs with mutant β-catenin were well differentiated, and none were poorly differentiated. Our findings are consistent with prior reports that OEAs with mutant β-catenin are more frequently low grade, exhibit squamous differentiation, and are associated with a favorable prognosis (10, 12, 13).

Furlong et al.(50) identified a frameshift mutation of APC exon 15 in SW626, a cell line originally thought to be of ovarian origin. On the basis of this finding and immunohistochemical analyses showing expression of cytokeratin 20 and lack of expression of cytokeratin 7 and the estrogen and progesterone receptors in SW626 cells, it is now thought that SW626 was more likely derived from a colorectal carcinoma that metastasized to the ovary rather than a primary ovarian carcinoma. Nevertheless, we believe that confusion about tumor type is an unlikely explanation for the APC mutations identified in our primary OEA (OE-32T), because we have verified that OE-32T is a well-differentiated endometrioid adenocarcinoma, arising in the setting of endometriosis. Furthermore, the tumor was confined to one ovary. Metastatic colon carcinomas typically involve both ovaries, and nearly half of all OEAs are associated with endometriosis (51).

A number of studies have shown that AXIN is critical for mediating the down-regulation of β-catenin [reviewed by Polakis (16)]. AXIN has binding sites for a number of proteins including GSK3β, β-catenin, APC, PP2Ac (the catalytic subunit of protein phosphatase 2A), and itself (26, 52). Although much remains to be learned about how AXIN functions, it appears to play a crucial role in facilitating the phosphorylation of β-catenin and APC by GSK3β (53). On the basis of its ability to down-regulate β-catenin and Wnt signaling, AXIN can be regarded as a tumor suppressor. Moreover, the somatic inactivating mutations found in AXIN1 and AXIN2 in some tumors are consistent with the tumor suppressor gene designation. Although biallelic inactivation of AXIN1 and AXIN2 has been identified in some human cancers, in others, one allele is mutant and the other is wild type (26, 27). Our findings, particularly when considered in light of data in the literature, offer support for the view that the AXIN mutations we report alter AXIN function and deregulate β-catenin. Akin to the mutations we describe in CTNNB1 and APC, the mutations detected in AXIN1 and AXIN2 were clonal in nature. Two of the three mutant AXIN alleles described encode significantly truncated mutant proteins, removing defined functional domains in the AXIN1 and AXIN2 proteins. In the case of the missense mutant AXIN1 allele identified in MDAH-2774 cells, we have presented clear evidence of nuclear accumulation of β-catenin (Fig. 2,D) and increased TCF transcriptional activity (Fig. 1) in the tumor cells harboring the mutation. Although the TCF-dependent transcriptional activity in MDAH-2774 is modest compared with TOV-112D, our results are comparable with those of the Morin laboratory, which identified MDAH-2774 as one of four ovarian cancer cell lines with increased β-catenin/TCF transcriptional activity (34). The AXIN1 sequence alteration in MDAH-2774, which affects a residue in the region of AXIN1 implicated in β-catenin binding, has not been identified in any of over 100 AXIN1 alleles we and others have characterized thus far in other cancers (Refs. 25, 26 and data not shown). Collectively, these findings support the likely functional significance of the AXIN1 defect in MDAH-2774, because these cells do not have mutations in CTNNG1, CTNNB1, APC, or AXIN2. Finally, we note that the primary tumor with the nonsense AXIN1 mutation (OE-29T) did not show nuclear accumulation of β-catenin by immunohistochemistry. Given the limited number of tumors with AXIN1 mutations identified to date, little is known about how well AXIN1 mutation correlates with aberrant β-catenin localization. Even tumors with documented CTNNB1 mutations do not invariably show readily recognizable nuclear or cytoplasmic accumulation of β-catenin protein (see for example, OE-14T and OE-19T; Table 2).

Previous functional studies of human tumor-derived mutants of AXIN2 provide support for a dominant-negative effect of the mutant protein (27). Specifically, transfection of a cDNA encoding the same AXIN2 mutant as the one we identified in tumor OE-5T (2083, del G) into cells expressing wild-type AXIN2 resulted in activation of TCF-dependent transcription. Moreover, this mutant protein was found to be more stable than the wild-type AXIN2 protein in colon cancer cells. These findings are consistent with a dominant-negative role for the mutant AXIN2 protein.

In summary, we have shown here that β-catenin deregulation is a common feature of OEAs, and mechanisms for deregulating β-catenin include mutation of β-catenin itself and mutational inactivation of APC, AXIN1, and AXIN2. The defects in β-catenin regulation presumably lead to activated expression of TCF/LEF-regulated target genes. Although many of these remain unknown, a number of downstream targets have been proposed and include c-MYC, CCND1/cyclin D1, PPARδ, gastrin, Cx43 (connexin 43), WISP-1, WISP-2, and MMP-7 (matrilysin; Refs. 16, 18, 19, 21, 54, 55, 56, 57). Downstream target genes of the β-catenin/TCF signaling pathway crucial for ovarian epithelial cell transformation will likely be up-regulated in all, or at least most, OEAs with β-catenin/TCF pathway defects. Further work evaluating gene expression patterns in OEAs with and without Wnt pathway defects will likely enrich our view of critical downstream TCF/LEF-regulated target genes.

Fig. 1.

Activation of TCF-dependent transcription in TOV-112D and MDAH-2774 endometrioid adenocarcinoma cells. The ratio of luciferase activities from a TCF-responsive reporter (pTopFlash) versus a control luciferase reporter gene construct (pFopFlash) was determined 48 h after transfection with FuGene6. Luciferase activities were normalized for transfection efficiency by cotransfection with a β-galactosidase-expressing vector. TCF-dependent transcription in two endometrioid adenocarcinoma-derived cell lines (TOV-112D and MDAH-2774), ovarian surface epithelial cells (IOSE-80), serous cystadenoma-derived cell lines (ML3 and ML10), clear cell carcinoma-derived cell lines (TOV-21G and ES-2), and serous carcinoma-derived cell lines (DOV13, HOC-1, HOC-7, and HOC-8) are shown. The data represent mean values from triplicate experiments; bars, SD.

Fig. 1.

Activation of TCF-dependent transcription in TOV-112D and MDAH-2774 endometrioid adenocarcinoma cells. The ratio of luciferase activities from a TCF-responsive reporter (pTopFlash) versus a control luciferase reporter gene construct (pFopFlash) was determined 48 h after transfection with FuGene6. Luciferase activities were normalized for transfection efficiency by cotransfection with a β-galactosidase-expressing vector. TCF-dependent transcription in two endometrioid adenocarcinoma-derived cell lines (TOV-112D and MDAH-2774), ovarian surface epithelial cells (IOSE-80), serous cystadenoma-derived cell lines (ML3 and ML10), clear cell carcinoma-derived cell lines (TOV-21G and ES-2), and serous carcinoma-derived cell lines (DOV13, HOC-1, HOC-7, and HOC-8) are shown. The data represent mean values from triplicate experiments; bars, SD.

Close modal
Fig. 2.

Immunofluorescent and immunohistochemical staining of β-catenin in OEAs. Immunofluorescent staining of β-catenin in cell lines: A, nuclear accumulation of β-catenin in SW480 colorectal carcinoma cells with no wild-type APC and mutant APC allele; B, IOSE-80 cells (ovarian surface epithelial cells with SV40 large T antigen and intact β-catenin/TCF signaling pathway) showing membrane localization of β-catenin; C, nuclear accumulation of β-catenin in TOV-112D OEA cells with mutant β-catenin; and D, MDAH-2774 OEA cells with AXIN1 sequence alteration. Representative H&E-stained sections of primary OEAs: E, well-differentiated OEA showing focal squamous differentiation (arrows); F, poorly differentiated OEA. Immunohistochemical staining of β-catenin in primary OEAs: G, representative OEA with β-catenin mutation (OE-2T, see Table 2) showing prominent nuclear accumulation of β-catenin in tumor cell nuclei (arrow), with little cytoplasmic or membrane-associated staining; H, representative OEA with β-catenin mutation (OE-18T) showing both nuclear (arrow) and cytoplasmic accumulation of β-catenin in region of tumor with squamous differentiation; I and J, representative OEAs without β-catenin mutation (OE-28T and OE-29T) showing membrane-associated localization of β-catenin immunoreactivity without detectable nuclear immunoreactivity; K and L, two OEAs (OE-32T and OE-13T) lacking demonstrable β-catenin mutations but showing prominent nuclear and/or cytoplasmic immunoreactivity for β-catenin in the vast majority of neoplastic cells.

Fig. 2.

Immunofluorescent and immunohistochemical staining of β-catenin in OEAs. Immunofluorescent staining of β-catenin in cell lines: A, nuclear accumulation of β-catenin in SW480 colorectal carcinoma cells with no wild-type APC and mutant APC allele; B, IOSE-80 cells (ovarian surface epithelial cells with SV40 large T antigen and intact β-catenin/TCF signaling pathway) showing membrane localization of β-catenin; C, nuclear accumulation of β-catenin in TOV-112D OEA cells with mutant β-catenin; and D, MDAH-2774 OEA cells with AXIN1 sequence alteration. Representative H&E-stained sections of primary OEAs: E, well-differentiated OEA showing focal squamous differentiation (arrows); F, poorly differentiated OEA. Immunohistochemical staining of β-catenin in primary OEAs: G, representative OEA with β-catenin mutation (OE-2T, see Table 2) showing prominent nuclear accumulation of β-catenin in tumor cell nuclei (arrow), with little cytoplasmic or membrane-associated staining; H, representative OEA with β-catenin mutation (OE-18T) showing both nuclear (arrow) and cytoplasmic accumulation of β-catenin in region of tumor with squamous differentiation; I and J, representative OEAs without β-catenin mutation (OE-28T and OE-29T) showing membrane-associated localization of β-catenin immunoreactivity without detectable nuclear immunoreactivity; K and L, two OEAs (OE-32T and OE-13T) lacking demonstrable β-catenin mutations but showing prominent nuclear and/or cytoplasmic immunoreactivity for β-catenin in the vast majority of neoplastic cells.

Close modal
Fig. 3.

β-Catenin mutations in representative primary OEAs and TOV-112D cells. Exon 3 mutations in 3 different tumors and TOV-112D cells are shown (arrows, mutant bands). For each tumor sample, the wild-type sequence is shown at right. For primary tumor samples virtually devoid of nonneoplastic cells, the bands from wild-type and mutant alleles should be of equal intensity. The reduced intensity of the mutant allele relative to wild type in some tumors likely reflects contamination of primary tumor DNA by nonneoplastic cells.

Fig. 3.

β-Catenin mutations in representative primary OEAs and TOV-112D cells. Exon 3 mutations in 3 different tumors and TOV-112D cells are shown (arrows, mutant bands). For each tumor sample, the wild-type sequence is shown at right. For primary tumor samples virtually devoid of nonneoplastic cells, the bands from wild-type and mutant alleles should be of equal intensity. The reduced intensity of the mutant allele relative to wild type in some tumors likely reflects contamination of primary tumor DNA by nonneoplastic cells.

Close modal
Fig. 4.

APC gene mutations in OE-32T. A, representative PTT of APC (segment 2, codons 686-1211) showing a truncated protein product (arrow) in OE-32T. For this APC segment, the control cell line is SW626, which contains no wild-type APC and an insertion of one adenine at nucleotide 2941, predicted to produce a frameshift and downstream termination codon. B, sequence of the APC gene in OE-32T genomic DNA, showing mutations (arrows) at codons 554 and 1114, each predicting conversion of an Arg residue (CGA) to a stop codon (TGA). The two mutations presumably affect different APC alleles. The wild-type sequence from matched normal tissue is shown on the right.

Fig. 4.

APC gene mutations in OE-32T. A, representative PTT of APC (segment 2, codons 686-1211) showing a truncated protein product (arrow) in OE-32T. For this APC segment, the control cell line is SW626, which contains no wild-type APC and an insertion of one adenine at nucleotide 2941, predicted to produce a frameshift and downstream termination codon. B, sequence of the APC gene in OE-32T genomic DNA, showing mutations (arrows) at codons 554 and 1114, each predicting conversion of an Arg residue (CGA) to a stop codon (TGA). The two mutations presumably affect different APC alleles. The wild-type sequence from matched normal tissue is shown on the right.

Close modal
Fig. 5.

AXIN1 structure and mutations. A, schematic diagram of AXIN1 genomic structure and potential interaction domains. The sequence data shown are derived from partial human AXIN1 mRNA and protein sequences (GenBank and Swissprot accession numbers AF009674 and 015169) and human genomic sequence (GenBank accession numbers Z69667, Z98272, and Z99754). The initiation codon for AXIN1 has not been identified (17). Hence, the amino acid sequence shown is numbered according to the available database sequence with the amino acid residue specified by the first three nucleotides of the mRNA sequence/open reading frame arbitrarily designated 1*. Bold lines above the genomic structure indicate the coding regions corresponding to each protein binding site. PP2Ac, protein phosphatase 2Ac. Figure modified from Satoh et al.(26). B, nonsense mutation of AXIN1 in primary tumor OE-29T. Portion of AXIN1 exon 4 sequence in OE-29T (left) and matched normal tissue OE-29N (right). Arrow, mutation (AAG-TAG). The signal intensity of the wild-type versus mutant bands in the tumor DNA suggests the other AXIN1 allele in the tumor DNA is wild type at the sequences shown, even assuming that some percentages of the wild-type sequences were contributed by contaminating nonneoplastic cells. C, missense mutation of AXIN1 in OEA-derived cell line MDAH-2774. Arrow, mutation (GTA-ATA). The sequence shown is in the reverse orientation.

Fig. 5.

AXIN1 structure and mutations. A, schematic diagram of AXIN1 genomic structure and potential interaction domains. The sequence data shown are derived from partial human AXIN1 mRNA and protein sequences (GenBank and Swissprot accession numbers AF009674 and 015169) and human genomic sequence (GenBank accession numbers Z69667, Z98272, and Z99754). The initiation codon for AXIN1 has not been identified (17). Hence, the amino acid sequence shown is numbered according to the available database sequence with the amino acid residue specified by the first three nucleotides of the mRNA sequence/open reading frame arbitrarily designated 1*. Bold lines above the genomic structure indicate the coding regions corresponding to each protein binding site. PP2Ac, protein phosphatase 2Ac. Figure modified from Satoh et al.(26). B, nonsense mutation of AXIN1 in primary tumor OE-29T. Portion of AXIN1 exon 4 sequence in OE-29T (left) and matched normal tissue OE-29N (right). Arrow, mutation (AAG-TAG). The signal intensity of the wild-type versus mutant bands in the tumor DNA suggests the other AXIN1 allele in the tumor DNA is wild type at the sequences shown, even assuming that some percentages of the wild-type sequences were contributed by contaminating nonneoplastic cells. C, missense mutation of AXIN1 in OEA-derived cell line MDAH-2774. Arrow, mutation (GTA-ATA). The sequence shown is in the reverse orientation.

Close modal
Fig. 6.

AXIN2 mutation in primary OEA with microsatellite instability. A, AXIN2 mutation in primary tumor OE-5T. Single nucleotide (G) deletion in short polyG tract is present in tumor DNA (left) but not in matched normal DNA (right). The mutation results in a frameshift, as indicated by the sequencing pattern above the site of the mutation. B, instability of microsatellite sequences in primary tumor OE-5T. The tumor DNA shows an upward shift at D11S1647 and downward shift at D11S1987 compared with matched normal DNA.

Fig. 6.

AXIN2 mutation in primary OEA with microsatellite instability. A, AXIN2 mutation in primary tumor OE-5T. Single nucleotide (G) deletion in short polyG tract is present in tumor DNA (left) but not in matched normal DNA (right). The mutation results in a frameshift, as indicated by the sequencing pattern above the site of the mutation. B, instability of microsatellite sequences in primary tumor OE-5T. The tumor DNA shows an upward shift at D11S1647 and downward shift at D11S1987 compared with matched normal DNA.

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3

The abbreviations used are: OEA, ovarian endometrioid adenocarcinoma; APC, adenomatous polyposis coli; TCF/ LEF, T-cell factor/lymphoid enhancer factor; FBS, fetal bovine serum; PTT, protein truncation test.

4

Internet address: http://archive.uwcm.ac.uk/uwcm/mg/ns/1/119682.html.

Table 1

Primer sequences and annealing temperatures for PCR

GeneProductAnnealing temperature (°C)
CTNNB1   
 F-CGTGGACAATGGCTACTCAA (exon 2) F/R codon 5–82 in exon 3 54 
 R-TGCATACTGTCCATCAATA (exon 4)   
 S-GGAGTTGGACATGGCCATGGAA (Sequencing primer)   
CTNNG1   
 F-GCCACGATGGAGGTGATGAA F/R codon 1–58 in exon 1 62 
 R-CCTGGGTGTAAGTGGTGGTT   
APC   
 T7-trans: GGATCCTAATACGACTCACTATAGGGAGACCACCATGG   
 F-T7-trans-GTCCAAGGGTAGCCAAGG F/R codon 1–796 58 
 R-CATCATGTCGATTGGTGTCA   
 F1-T7-trans-ATGCATGTGGAACTTTGTGG F1/R1 codon 686–1211 58 
 R1-GAGGATCCATTAGATGAAGGTGTGGACG   
 F2-T7-trans-TTTCTCCATACAGGTCACGG F2/R2 codon 1106–1681 56 
 R2-CTGTAGGAATGGTATCTCG   
 F3-T7-trans-CAGGAAAATGACAATGGGAATGA F3/R3 codon 1537–2247 56 
 R3-CTAGGGCTTTTGGAGGCTGGAGT   
AXIN1   
 F1-CTAATCCTTGTCCTCTTAATGG F1/R1 exon 1 60 
 R1-CTGAACTCTCTGCCTTCGCTGTAC   
 F2-TAACATGCCCTGCTTGCCTG F2/R2 exon 2 62 
 R2-GTATCCGGGGCGGGACTT   
 F3-TAACGGCTGCCTCTTTCTCC F3R3 exon 3 64 
 R3-CTGAGGACCGCAAAGCCGGT   
 F4-GTGCCTCACAGTCCTGTCC F4/R4 exon 4 62 
 R4-GCAAGAAAACAGCACGACACC   
 F5-TGGTGCTGCTTGTCCCCAC F5/R5 exon 5 64 
 R5-TCCTCACTGACAGGCGCAC   
 F6-CTCGCAGCTCTTGCCCTTG F6/R6 exon 6 62 
 R6-CTGGCTGCGTGCGGGGTG   
 F7-TCACAACTTGTTCTCTTGTTCC F7/R7 exon 7 60 
 R7-ACCCCACGACGCGGCCGT   
 F8-CCTTTGACGCGGGTTGTTCC F8/R8 exon 8 62 
 R8-GGGAGGACCCTCAGGACG   
 F9-CCACCGCTGCATCTCTTTCC F9/R9 exon 9 66 
 R9-GGGGCACCCCAGCCCTC   
 F10-CCTCCTCACCTCCGTCCTG F10/R10 exon 10 66 
 R10-CGGCCAGCCCACCAGCCT   
AXIN2   
 S1-GCCGATTGCTGAGAGGAACT S1/AS1 codon 1–165 62 
 AS1-CGGTCTGCGCCTGGTCAAA   
 S2-GCCACCAAGACCTACATAAGA S2/AS2 codon 159–292 62 
 AS2-TCACTGGATATCTCACTGTCG   
 S3-GGTTCTGGCTATGTCTTTGC S3/AS3 codon 292–427 60 
 AS3-GTATCGTCTGCGGGTCTTC   
 S4-CACCCCCTCTCCCTACTGC S4/AS4 codon 427–564 60 
 AS4-GCCTCTGCTGCCGCCAAAC   
 S5-GGGGGCAGCGAGTATTACT S5/AS5 codon 551–683 60 
 AS5-GCGTGTTGGGTGGGGTCA   
 F-CAAAGCACAAAAAAGGCCTACC F/R codon 645–712 60 
 R-GATTCCTGTCCCTCTGCTGAC   
 S6-CCCTGACCCCACCCAACA S6/AS6 codon 693–843 60 
 AS6-CCAACAGTTCACCAAAGCCA   
GeneProductAnnealing temperature (°C)
CTNNB1   
 F-CGTGGACAATGGCTACTCAA (exon 2) F/R codon 5–82 in exon 3 54 
 R-TGCATACTGTCCATCAATA (exon 4)   
 S-GGAGTTGGACATGGCCATGGAA (Sequencing primer)   
CTNNG1   
 F-GCCACGATGGAGGTGATGAA F/R codon 1–58 in exon 1 62 
 R-CCTGGGTGTAAGTGGTGGTT   
APC   
 T7-trans: GGATCCTAATACGACTCACTATAGGGAGACCACCATGG   
 F-T7-trans-GTCCAAGGGTAGCCAAGG F/R codon 1–796 58 
 R-CATCATGTCGATTGGTGTCA   
 F1-T7-trans-ATGCATGTGGAACTTTGTGG F1/R1 codon 686–1211 58 
 R1-GAGGATCCATTAGATGAAGGTGTGGACG   
 F2-T7-trans-TTTCTCCATACAGGTCACGG F2/R2 codon 1106–1681 56 
 R2-CTGTAGGAATGGTATCTCG   
 F3-T7-trans-CAGGAAAATGACAATGGGAATGA F3/R3 codon 1537–2247 56 
 R3-CTAGGGCTTTTGGAGGCTGGAGT   
AXIN1   
 F1-CTAATCCTTGTCCTCTTAATGG F1/R1 exon 1 60 
 R1-CTGAACTCTCTGCCTTCGCTGTAC   
 F2-TAACATGCCCTGCTTGCCTG F2/R2 exon 2 62 
 R2-GTATCCGGGGCGGGACTT   
 F3-TAACGGCTGCCTCTTTCTCC F3R3 exon 3 64 
 R3-CTGAGGACCGCAAAGCCGGT   
 F4-GTGCCTCACAGTCCTGTCC F4/R4 exon 4 62 
 R4-GCAAGAAAACAGCACGACACC   
 F5-TGGTGCTGCTTGTCCCCAC F5/R5 exon 5 64 
 R5-TCCTCACTGACAGGCGCAC   
 F6-CTCGCAGCTCTTGCCCTTG F6/R6 exon 6 62 
 R6-CTGGCTGCGTGCGGGGTG   
 F7-TCACAACTTGTTCTCTTGTTCC F7/R7 exon 7 60 
 R7-ACCCCACGACGCGGCCGT   
 F8-CCTTTGACGCGGGTTGTTCC F8/R8 exon 8 62 
 R8-GGGAGGACCCTCAGGACG   
 F9-CCACCGCTGCATCTCTTTCC F9/R9 exon 9 66 
 R9-GGGGCACCCCAGCCCTC   
 F10-CCTCCTCACCTCCGTCCTG F10/R10 exon 10 66 
 R10-CGGCCAGCCCACCAGCCT   
AXIN2   
 S1-GCCGATTGCTGAGAGGAACT S1/AS1 codon 1–165 62 
 AS1-CGGTCTGCGCCTGGTCAAA   
 S2-GCCACCAAGACCTACATAAGA S2/AS2 codon 159–292 62 
 AS2-TCACTGGATATCTCACTGTCG   
 S3-GGTTCTGGCTATGTCTTTGC S3/AS3 codon 292–427 60 
 AS3-GTATCGTCTGCGGGTCTTC   
 S4-CACCCCCTCTCCCTACTGC S4/AS4 codon 427–564 60 
 AS4-GCCTCTGCTGCCGCCAAAC   
 S5-GGGGGCAGCGAGTATTACT S5/AS5 codon 551–683 60 
 AS5-GCGTGTTGGGTGGGGTCA   
 F-CAAAGCACAAAAAAGGCCTACC F/R codon 645–712 60 
 R-GATTCCTGTCCCTCTGCTGAC   
 S6-CCCTGACCCCACCCAACA S6/AS6 codon 693–843 60 
 AS6-CCAACAGTTCACCAAAGCCA   
Table 2

Summary of β-catenin immunodetection and sequence analysis of Wnt pathway genes in OEAs

Sample IDClinical dataβ-catenin IHbCTNNB1 mutation (exon 3)APC mutation (codons 1–2337)AXIN1 mutationAXIN2 mutation
PrimaryTumorsStageGradeaAgeNCMNucleotideAACodonNucleotideAACodonNucleotideAACodonNucleotideCodonType
1T III PD 60               
2T WD 65 +++   GGA-CGA Gly-Arg 34          
5T IIIC PD 58           2083, del G G665X frameshift 
6T III PD 45  ++ ++             
7T IIIC PD 69              
8T III PD 73  ++ ++             
11T IIB PD 43               
12T IC WD 77               
13T IA MD 39              
10 14T IV MD 50  +++ TCT-TGT Ser-Cys 33          
11 15T IC PD 61  ++              
12 16T WD 48               
13 17T IC WD 67  TCT-TGT Ser-Cys 33          
14 18T IIA WD 35 ++ ++  TCT-TAT Ser-Tyr 33          
15 19T IA WD 50   ++ TCT-TAT Ser-Tyr 45          
16 20T IV MD 69   ++             
17 21T IIIB WD 52  GGA-GAA Gly-Glu 34          
18 22T IIB WD 53  GAC-TAC Asp-Tyr 32          
19 23T IIIC PD 68  ++ ++             
20 24T IIIC WD 66   ++             
21 25T IIIC PD 58              
22 26T IIIC MD 48              
23 28T IV PD 73              
24 29T IIIC MD 72  ++       AAG-TAG Lys-Stop 416    
25 30T IC WD 51              
26 31T IIIC PD 49               
27 32T IC WD 47 ++     CGA-TGA Arg-Stop 554, 1114       
28 33T IB PD N/A              
29 34T IIA PD 48               
30 35T IV PD 70              
31 36T IIA WD 45 ++ ++  GAC-CAC Asp-His 32          
32 37T N/A WD N/A  TCT-TGT Ser-Cys 37          
33 38T IIIC MD 49              
34 39T IIIC MD 73  ++ +++             
35 40T IIIC PD 58               
36 42T IIIC MD 61               
37 43T IIIC MD 43              
38 44T WD 69 +++ TCT-TGT Ser-Cys 33          
39 45T N/A MD N/A ++ ++ GAC-CAC Asp-His 32          
40 46T N/A PD N/A              
41 47T IA WD 72 ++   TCT-GCT Ser-Ala 37          
42 48T IC WD N/A GGA-GAA Gly-Glu 34          
43 49T IIIC MD 53  ++             
44 71T IC MD 49 ++   GGA-GTA Gly-Val 34          
45 72T III MD 52               
Cell lines                    
MDAH2774             GTA-ATA Val-Ile 555    
TOV-112D       TCT-GCT Ser-Ala 37          
Sample IDClinical dataβ-catenin IHbCTNNB1 mutation (exon 3)APC mutation (codons 1–2337)AXIN1 mutationAXIN2 mutation
PrimaryTumorsStageGradeaAgeNCMNucleotideAACodonNucleotideAACodonNucleotideAACodonNucleotideCodonType
1T III PD 60               
2T WD 65 +++   GGA-CGA Gly-Arg 34          
5T IIIC PD 58           2083, del G G665X frameshift 
6T III PD 45  ++ ++             
7T IIIC PD 69              
8T III PD 73  ++ ++             
11T IIB PD 43               
12T IC WD 77               
13T IA MD 39              
10 14T IV MD 50  +++ TCT-TGT Ser-Cys 33          
11 15T IC PD 61  ++              
12 16T WD 48               
13 17T IC WD 67  TCT-TGT Ser-Cys 33          
14 18T IIA WD 35 ++ ++  TCT-TAT Ser-Tyr 33          
15 19T IA WD 50   ++ TCT-TAT Ser-Tyr 45          
16 20T IV MD 69   ++             
17 21T IIIB WD 52  GGA-GAA Gly-Glu 34          
18 22T IIB WD 53  GAC-TAC Asp-Tyr 32          
19 23T IIIC PD 68  ++ ++             
20 24T IIIC WD 66   ++             
21 25T IIIC PD 58              
22 26T IIIC MD 48              
23 28T IV PD 73              
24 29T IIIC MD 72  ++       AAG-TAG Lys-Stop 416    
25 30T IC WD 51              
26 31T IIIC PD 49               
27 32T IC WD 47 ++     CGA-TGA Arg-Stop 554, 1114       
28 33T IB PD N/A              
29 34T IIA PD 48               
30 35T IV PD 70              
31 36T IIA WD 45 ++ ++  GAC-CAC Asp-His 32          
32 37T N/A WD N/A  TCT-TGT Ser-Cys 37          
33 38T IIIC MD 49              
34 39T IIIC MD 73  ++ +++             
35 40T IIIC PD 58               
36 42T IIIC MD 61               
37 43T IIIC MD 43              
38 44T WD 69 +++ TCT-TGT Ser-Cys 33          
39 45T N/A MD N/A ++ ++ GAC-CAC Asp-His 32          
40 46T N/A PD N/A              
41 47T IA WD 72 ++   TCT-GCT Ser-Ala 37          
42 48T IC WD N/A GGA-GAA Gly-Glu 34          
43 49T IIIC MD 53  ++             
44 71T IC MD 49 ++   GGA-GTA Gly-Val 34          
45 72T III MD 52               
Cell lines                    
MDAH2774             GTA-ATA Val-Ile 555    
TOV-112D       TCT-GCT Ser-Ala 37          
a

WD, well differentiated; MD, moderately differentiated; PD, poorly differentiated; N/A, not available.

b

IH, immunohistochemistry. +, absent/weak; ++, moderate; +++, strong. N, cell nuclei; C, cytoplasm; M, cell membranes.

1
Greenlee R. T., Murray T., Bolden S., Wingo P. A. Cancer statistics, 2000.
CA Cancer J. Clin.
,
50
:
7
-33,  
2000
.
2
Dubeau L. The cell of origin of ovarian epithelial tumors and the ovarian surface epithelium dogma: does the emperor have no clothes?.
Gynecol. Oncol.
,
72
:
437
-442,  
1999
.
3
Auersperg N., Edelson M. I., Mok S. C., Johnson S. W., Hamilton T. C. The biology of ovarian cancer.
Semin. Oncol.
,
25
:
281
-304,  
1998
.
4
Li A. J., Karlan B. Y. Genetic factors in ovarian carcinoma.
Curr. Oncol. Rep.
,
3
:
27
-32,  
2001
.
5
Aunoble B., Sanches R., Didier E., Bignon Y. J. Major oncogenes and tumor suppressor genes involved in epithelial ovarian cancer.
Int. J. Oncol.
,
16
:
567
-576,  
2000
.
6
Feeley K. M., Wells M. Precursor lesions of ovarian epithelial malignancy.
Histopathology
,
38
:
87
-95,  
2001
.
7
Obata K., Morland S. J., Watson R. H., Hitchcock A., Chenevix-Trench G., Thomas E. J., Campbell I. G. Frequent PTEN/MMAC mutations in endometrioid but not serous or mucinous epithelial ovarian tumors.
Cancer Res.
,
58
:
2095
-2097,  
1998
.
8
Fujita M., Enomoto T., Yoshino K., Nomura T., Buzard G. S., Inoue M., Okudaira Y. Microsatellite instability and alterations in the hMSH2 gene in human ovarian cancer.
Int. J. Cancer
,
64
:
361
-366,  
1995
.
9
King B. L., Carcangiu M. L., Carter D., Kiechle M., Pfisterer J., Pfleiderer A., Kacinski B. M. Microsatellite instability in ovarian neoplasms.
Br. J. Cancer
,
72
:
376
-382,  
1995
.
10
Saegusa M., Okayasu I. Frequent nuclear β-catenin accumulation and associated mutations in endometrioid-type endometrial and ovarian carcinomas with squamous differentiation.
J. Pathol.
,
194
:
59
-67,  
2001
.
11
Sagae S., Kobayashi K., Nishioka Y., Sugimura M., Ishioka S., Nagata M., Terasawa K., Tokino T., Kudo R. Mutational analysis of β-catenin gene in Japanese ovarian carcinomas: frequent mutations in endometrioid carcinomas.
Jpn. J. Cancer Res.
,
90
:
510
-515,  
1999
.
12
Palacios J., Gamallo C. Mutations in the β-catenin gene (CTNNB1) in endometrioid ovarian carcinomas.
Cancer Res.
,
58
:
1344
-1347,  
1998
.
13
Gamallo C., Palacios J., Moreno G., Calvo de Mora J., Suarez A., Armas A. β-Catenin expression pattern in stage I and II ovarian carcinomas: relationship with β-catenin gene mutations. Clinicopathological features, and clinical outcome.
Am. J. Pathol.
,
155
:
527
-536,  
1999
.
14
Wright K., Wilson P., Morland S., Campbell I., Walsh M., Hurst T., Ward B., Cummings M., Chenevix-Trench G. β-Catenin mutation and expression analysis in ovarian cancer: exon 3 mutations and nuclear translocation in 16% of endometrioid tumours.
Int. J. Cancer
,
82
:
625
-629,  
1999
.
15
Cadigan K. M., Nusse R. Wnt signaling: a common theme in animal development.
Genes Dev.
,
11
:
3286
-3305,  
1997
.
16
Polakis P. Wnt signaling and cancer.
Genes Dev.
,
14
:
1837
-1851,  
2000
.
17
Peifer M., Polakis P. Wnt signaling in oncogenesis and embryogenesis—a look outside the nucleus.
Science (Wash. DC)
,
287
:
1606
-1609,  
2000
.
18
He T. C., Sparks A. B., Rago C., Hermeking H., Zawel L., da Costa L. T., Morin P. J., Vogelstein B., Kinzler K. W. Identification of c-MYC as a target of the APC pathway.
Science (Wash. DC)
,
281
:
1509
-1512,  
1998
.
19
Shtutman M., Zhurinsky J., Simcha I., Albanese C., D’Amico M., Pestell R., Ben-Ze’ev A. The cyclin D1 gene is a target of the β-catenin/LEF-1 pathway.
Proc. Natl. Acad. Sci. USA
,
96
:
5522
-5527,  
1999
.
20
Tetsu O., McCormick F. β-Catenin regulates expression of cyclin D1 in colon carcinoma cells.
Nature (Lond.)
,
398
:
422
-426,  
1999
.
21
Crawford H. C., Fingleton B. M., Rudolph-Owen L. A., Goss K. J., Rubinfeld B., Polakis P., Matrisian L. M. The metalloproteinase matrilysin is a target of β-catenin transactivation in intestinal tumors.
Oncogene
,
18
:
2883
-2891,  
1999
.
22
Polakis P. The oncogenic activation of β-catenin.
Curr. Opin. Genet. Dev.
,
9
:
15
-21,  
1999
.
23
Munemitsu S., Albert I., Souza B., Polakis P. Regulation of intracellular β-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein.
Proc. Natl. Acad. Sci. USA
,
92
:
3046
-3050,  
1995
.
24
Morin P. J., Sparks A. B., Korinek V., Barker N., Clevers H., Vogelstein B., Kinzler K. W. Activation of β-catenin-TCF signaling in colon cancer by mutations in β-catenin or APC.
Science (Wash. DC)
,
275
:
1787
-1790,  
1997
.
25
Webster M. T., Rozycka M., Sara E., Davis E., Smalley M., Young N., Dale T. C., Wooster R. Sequence variants of the AXIN gene in breast, colon, and other cancers: an analysis of mutations that interfere with GSK3 binding.
Genes Chromosomes Cancer
,
28
:
443
-453,  
2000
.
26
Satoh S., Daigo Y., Furukawa Y., Kato T., Miwa N., Nishiwaki T., Kawasoe T., Ishiguro H., Fujita M., Tokino T., Sasaki Y., Imaoka S., Murata M., Shimano T., Yamaoka Y., Nakamura Y. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1.
Nat. Genet.
,
24
:
245
-250,  
2000
.
27
Liu W., Dong X., Mai M., Seelan R. S., Taniguchi K., Krishnadath K. K., Halling K. C., Cunningham J. M., Qian C., Christensen E., Roche P. C., Smith D. I., Thibodeau S. N. Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating β-catenin/TCF signalling.
Nat. Genet.
,
26
:
146
-147,  
2000
.
28
Caca K., Kolligs F. T., Ji X., Hayes M., Qian J., Yahanda A., Rimm D. L., Costa J., Fearon E. R. β- and γ-catenin mutations, but not E-cadherin inactivation, underlie T-cell factor/lymphoid enhancer factor transcriptional deregulation in gastric and pancreatic cancer.
Cell Growth Differ.
,
10
:
369
-376,  
1999
.
29
Behrens J. Cadherins and catenins: role in signal transduction and tumor progression.
Cancer Metastasis Rev.
,
18
:
15
-30,  
1999
.
30
Zhurinsky J., Shtutman M., Ben-Ze’ev A. Plakoglobin and β-catenin: protein interactions, regulation and biological roles.
J. Cell Sci.
,
113
:
3127
-3139,  
2000
.
31
Allan G. J., Cottrell S., Trowsdale J., Foulkes W. D. Loss of heterozygosity on chromosome 5 in sporadic ovarian carcinoma is a late event and is not associated with mutations in APC at 5q21–22.
Hum. Mutat.
,
3
:
283
-291,  
1994
.
32
Kolligs F. T., Kolligs B., Hajra K. M., Hu G., Tani M., Cho K. R., Fearon E. R. γ-Catenin is regulated by the APC tumor suppressor and its oncogenic activity is distinct from that of β-catenin.
Genes Dev.
,
14
:
1319
-1331,  
2000
.
33
Russell P. Surface epithelial-stromal tumors of the ovary Ed. 4 Kurman R. J. eds. .
Blaustein’s Pathology of the Female Genital Tract
,
:
705
-782, Springer-Verlag New York  
1994
.
34
Furlong M. T., Morin P. J. Rare activation of the TCF/β-catenin pathway in ovarian cancer.
Gynecol. Oncol.
,
77
:
97
-104,  
2000
.
35
Tago K., Nakamura T., Nishita M., Hyodo J., Nagai S., Murata Y., Adachi S., Ohwada S., Morishita Y., Shibuya H., Akiyama T. Inhibition of Wnt signaling by ICAT, a novel β-catenin-interacting protein.
Genes Dev.
,
14
:
1741
-1749,  
2000
.
36
Hart M. J., de los Santos R., Albert I. N., Rubinfeld B., Polakis P. Downregulation of β-catenin by human AXIN and its association with the APC tumor suppressor, β-catenin and GSK3β.
Curr. Biol.
,
8
:
573
-581,  
1998
.
37
Lin Y. M., Kato T., Satoh S., Nakamura Y., Furukawa Y. Identification of novel polymorphisms in the AXIN1 and CDX-2 genes.
J. Hum. Genet.
,
45
:
254
-256,  
2000
.
38
Wu R., Connolly D. C., Ren X., Fearon E. R., Cho K. R. Somatic mutations of the PPP2R1B candidate tumor suppressor gene at chromosome 11q23 are infrequent in ovarian carcinomas.
Neoplasia
,
1
:
311
-314,  
1999
.
39
Ilyas M., Tomlinson I. P., Rowan A., Pignatelli M., Bodmer W. F. β-Catenin mutations in cell lines established from human colorectal cancers.
Proc. Natl. Acad. Sci. USA
,
94
:
10330
-10334,  
1997
.
40
Rubinfeld B., Robbins P. D., El-Gamil M., Albert I., Porfiri E., Polakis P. Stabilization of β-catenin by genetic defects in melanoma cell lines.
Science (Wash. DC)
,
275
:
1790
-1792,  
1997
.
41
Koch A., Denkhaus D., Albrecht S., Leuschner I., von Schweinitz D., Pietsch T. Childhood hepatoblastomas frequently carry a mutated degradation targeting box of the β-catenin gene.
Cancer Res.
,
59
:
269
-273,  
1999
.
42
Zurawel R. H., Chiappa S. A., Allen C., Raffel C. Sporadic medulloblastomas contain oncogenic β-catenin mutations.
Cancer Res.
,
58
:
896
-899,  
1998
.
43
Voeller H. J., Truica C. I., Gelmann E. P. β-Catenin mutations in human prostate cancer.
Cancer Res.
,
58
:
2520
-2523,  
1998
.
44
Chesire D. R., Ewing C. M., Sauvageot J., Bova G. S., Isaacs W. B. Detection and analysis of β-catenin mutations in prostate cancer.
Prostate
,
45
:
323
-334,  
2000
.
45
Fukuchi T., Sakamoto M., Tsuda H., Maruyama K., Nozawa S., Hirohashi S. β-Catenin mutation in carcinoma of the uterine endometrium.
Cancer Res.
,
58
:
3526
-3528,  
1998
.
46
Mirabelli-Primdahl L., Gryfe R., Kim H., Millar A., Luceri C., Dale D., Holowaty E., Bapat B., Gallinger S., Redston M. β-Catenin mutations are specific for colorectal carcinomas with microsatellite instability but occur in endometrial carcinomas irrespective of mutator pathway.
Cancer Res.
,
59
:
3346
-3351,  
1999
.
47
Saegusa M., Hashimura M., Yoshida T., Okayasu I. β-Catenin mutations and aberrant nuclear expression during endometrial tumorigenesis.
Br. J. Cancer
,
84
:
209
-217,  
2001
.
48
Schlosshauer P. W., Pirog E. C., Levine R. L., Hedrick-Ellenson L. Mutational analysis of the CTNNB1 and APC genes in uterine endometrioid carcinoma.
Mod. Pathol.
,
13
:
1066
-1071,  
2000
.
49
Scully R. E., Young R. H., Clement P. B. .
Tumors of the Ovary, Maldeveloped Gonads, Fallopian Tube, and Broad Ligament. Atlas of Tumor Pathology, Third Series, Fascicle, Vol. 23
, Armed Forces Institute of Pathology Washington, DC  
1998
.
50
Furlong M. T., Hough C. D., Sherman-Baust C. A., Pizer E. S., Morin P. J. Evidence for the colonic origin of ovarian cancer cell line SW626.
J. Natl. Cancer Inst.
,
91
:
1327
-1328,  
1999
.
51
Fukunaga M., Nomura K., Ishikawa E., Ushigome S. Ovarian atypical endometriosis: its close association with malignant epithelial tumours.
Histopathology
,
30
:
249
-255,  
1997
.
52
Smalley M. J., Sara E., Paterson H., Naylor S., Cook D., Jayatilake H., Fryer L. G., Hutchinson L., Fry M. J., Dale T. C. Interaction of AXIN and Dvl-2 proteins regulates Dvl-2-stimulated TCF-dependent transcription.
EMBO J.
,
18
:
2823
-2835,  
1999
.
53
Ikeda S., Kishida M., Matsuura Y., Usui H., Kikuchi A. GSK-3β-dependent phosphorylation of adenomatous polyposis coli gene product can be modulated by β-catenin and protein phosphatase 2A complexed with AXIN.
Oncogene
,
19
:
537
-545,  
2000
.
54
He T. C., Chan T. A., Vogelstein B., Kinzler K. W. PPARδ is an APC-regulated target of nonsteroidal anti-inflammatory drugs.
Cell
,
99
:
335
-345,  
1999
.
55
Koh T. J., Bulitta C. J., Fleming J. V., Dockray G. J., Varro A., Wang T. C. Gastrin is a target of the β-catenin/TCF-4 growth-signaling pathway in a model of intestinal polyposis.
J. Clin. Investig.
,
106
:
533
-539,  
2000
.
56
van der Heyden M. A., Rook M. B., Hermans M. M., Rijksen G., Boonstra J., Defize L. H., Destree O. H. Identification of connexin43 as a functional target for Wnt signalling.
J. Cell Sci.
,
111
:
1741
-1749,  
1998
.
57
Pennica D., Swanson T. A., Welsh J. W., Roy M. A., Lawrence D. A., Lee J., Brush J., Taneyhill L. A., Deuel B., Lew M., Watanabe C., Cohen R. L., Melhem M. F., Finley G. G., Quirke P., Goddard A. D., Hillan K. J., Gurney A. L., Botstein D., Levine A. J. WISP genes are members of the connective tissue growth factor family that are up-regulated in Wnt-1-transformed cells and aberrantly expressed in human colon tumors.
Proc. Natl. Acad. Sci. USA
,
95
:
14717
-14722,  
1998
.