The cytokine hepatocyte growth factor/scatter factor (HGF/SF) protects epithelial and cancer cells against DNA-damaging agents via a pathway involving signaling from c-Met → phosphatidylinositol-3- kinase → c-Akt. However, the downstream alterations in gene expression resulting from this pathway have not been established. On the basis of cDNA microarray and semiquantitative RT-PCR assays, we found that MDA-MB-453 human breast cancer cells preincubated with HGF/SF and then exposed to Adriamycin (ADR), a DNA topoisomerase II inhibitor, exhibit an altered pattern of gene expression, as compared with cells treated with ADR only. [HGF/SF+ADR]-treated cells showed altered expression of genes involved in the DNA damage response, cell cycle regulation, signal transduction, metabolism, and development. Some of these alterations suggest mechanisms by which HGF/SF may exert its protective activity, e.g., up-regulation of polycystic kidney disease-1 (a survival-promoting component of cadherin-catenin complexes), down-regulation of 51C (an inositol polyphosphate-5-phosphatase), and down-regulation of TOPBP1 (a topoisomerase IIB binding protein). We showed that enforced expression of the cdc42-interacting protein CIP4, a cytoskeleton-associated protein for which expression was decreased in [HGF/SF+ADR]-treated cells, inhibited HGF/SF-mediated protection against ADR. The cDNA microarray approach may open up new avenues for investigation of the DNA damage response and its regulation by HGF/SF.

The cytokine HGF/SF3 is a pleiotrophic mediator of multiple biological functions that plays significant roles in embryonic development, tissue and organ repair, tumorigenesis, and angiogenesis. HGF/SF has been found to protect various cell types against apoptosis induced by a variety of stimuli, including loss of contact with the substratum (1), exposure to staurosporine (a protein kinase inhibitor; Refs. 2, 3), and DNA damage (4, 5, 6, 7). We have reported previously that various epithelial and carcinoma cell lines are protected by HGF/SF against apoptotic cell deaths induced by DNA-damaging agents, including ionizing radiation, ultraviolet (UV-C) radiation, and ADR (also known as doxorubicin; Ref. 5). ADR is a DNA intercalator and a DNA topoisomerase IIα inhibitor that induces single- and double-strand DNA breaks similar to those induced by ionizing radiation.

Interestingly, preincubation with HGF/SF also reduced the number of residual DNA strand breaks at 24 h after exposure to ADR or ionizing radiation, suggesting that HGF/SF may also enhance the rate of DNA repair (i.e., strand rejoining; Ref. 6). The increased DNA repair and the cell protection against DNA damage appeared to be attributable to at least in part, to: (a) activation of a cell survival pathway involving PI3K and c-Akt (protein kinase B); and (b) subsequent stabilization of the protein levels of the antiapoptotic mitochondrial pore-forming protein Bcl-XL(5, 6).

These studies have not revealed the downstream effector genes that mediate cytoprotection by HGF/SF. Cytoprotection by HGF/SF might involve nonnuclear events, such as inactivation of proapoptotic effectors (e.g., Bad and caspase-9) by c-Akt-mediated protein phosphorylation events (8, 9). However, it might also involve prolonged patterns of altered gene expression induced by HGF/SF in the DNA-damaged cells. The latter possibility was suggested by the observation that maximal protection required a preincubation of cells with HGF/SF for at least 48 h before exposure to ADR (5). Shorter preincubation periods yielded less protection, and application of HGF/SF only at the time of ADR treatment and during the 72-h postincubation period gave no protection.

To investigate the potential alterations of gene expression that might contribute to HGF/SF-mediated cell protection, we have used a cDNA microassay approach, using a previously studied model for HGF/SF protection (5). MDA-MB-453 human breast cancer cells were preincubated with HGF/SF, exposed to ADR, and then postincubated in ADR-free culture medium for 72 h to allow the repair processes to proceed. Alterations of mRNA expression were examined in cells treated with [HGF/SF+ADR], in comparison with cells treated with ADR alone.

Sources of Reagents and Vectors and Sources of Reagents and Antibodies.

Recombinant human two-chain HGF/SF was generously provided by Dr. Ralph Schwall (Department of Endocrine Research, Genentech, Inc., South San Francisco, CA). ADR (doxorubicin hydrochloride) and MTT dye (thioazyl blue) were purchased from Sigma Chemical Co. (St. Louis, MO). Expression vectors encoding full-length and truncated or deleted forms of human CIP4 have been described earlier (10). These CIP4 cDNAs were cloned into the pRK5-myc mammalian expression vector, which provides an NH2-terminal myc epitope tag.

Cell Lines and Culture.

MDA-MB-453 human breast cancer cells were obtained from the American Type Culture Collection (Rockville, MD). Cells were cultured in DMEM supplemented with FCS (5% v/v), nonessential amino acids (100 mm), l-glutamine (5 mm), streptomycin (100 μg/ml), and penicillin (100 units/ml; all from BioWhittaker, Walkersville, MD). Cells were grown at 37°C in a humidified atmosphere of 95% air and 5% CO2.

ADR Treatment.

Subconfluent proliferating cells in 100-mm plastic dishes or 96-well plates were preincubated in the absence or presence of HGF/SF (100 ng/ml × 48 h) in serum-free DMEM and then sham-treated (control) or treated with ADR (10 μM × 2 h, at 37°C) in complete culture medium (DMEM plus 5% FCS). Cultures were then washed three times to remove the ADR and postincubated in fresh drug-free complete culture medium at 37°C for 72 h (again in the absence or presence of HGF/SF, respectively). Cultures were then harvested for isolation of total cell RNA and cDNA microarray or semiquantitative RT-PCR analyses.

Transient Transfections.

Subconfluent proliferating cells were transfected overnight using Lipofectamine (Life Technologies, Inc., Rockville, MD; 10 μg of plasmid DNA/100-mm dish) and then washed to remove the excess vector and Lipofectamine. As a control for transfection efficiency, cultures were cotransfected with 10 μg of a β-galactosidase expression vector (pSV-β-gal; Promega Corp., Madison, WI) under parallel conditions; and β-galactosidase was detected using a 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside staining kit (Gene Therapy Systems, Inc., San Diego, CA).

MTT Cell Viability Assay.

This assay is based on the ability of viable mitochondria to convert MTT, a soluble tetrazolium salt into an insoluble formazan precipitate, which is dissolved in dimethyl sulfoxide and quantitated by spectrophotometry (11). To test the effect of CIP4 on HGF/SF-mediated cell protection, cells transiently transfected with CIP4 expression vectors (see above) were harvested using trypsin and seeded into 96-well dishes (2000 cell/well) in standard growth medium, incubated for 24–48 h to allow attachment and entry into the cell cycle, preincubated ± HGF/SF (100 ng/ml × 48 h), treated with ADR (10 or 20 μm × 2 h), postincubated for 72 h, and tested for MTT dye conversion. Cell viability was calculated as the amount of MTT dye conversion relative to sham-treated control cells. Ten replicate wells were tested for each experimental condition. Statistical comparisons were made using the two-tailed Student’s t test.

Isolation of RNA.

After cell treatments ± ADR ± HGF/SF, the total cellular RNA was extracted using TRIzol Reagent (Life Technologies, Inc.), according to the manufacturer’s instructions. The RNA was treated with DNase and precipitated using 95% ethanol prior to cDNA synthesis. Isolated RNA was electrophoresed through 1.0% agarose-formaldehyde gels to verify the quality of the RNA, and RNA concentrations were determined from absorbance measurements at 260 and 280 nm.

cDNA Synthesis and Microarray Hybridization.

One hundred μg of total cellular RNA was annealed to oligo(dT) and reverse-transcribed in the presence of Cy3-labeled or of Cy5-labeled dUTP (Amersham Pharmacia Biotech, Piscataway, NJ), using 10,000 units/ml of Superscript II reverse transcriptase (Life Technologies, Inc.). The resulting Cy3- and Cy5-labeled cDNAs were treated with RNase One (Promega) for 10 min at 37°C, combined, purified by using a Centricon-50 filtration spin column (Millipore, Bedford, MA), and concentrated to a final volume of 6.5 μl. The cDNA was then combined with 12.5 μl of hybridization solution and 1.0 μl of blocking solution to a final volume of 20 μl. The mixture was heated at 94°C for 2 min and centrifuged at 13,000 rpm for 10 min, and the supernatant was transferred to a clean tube and incubated at 50°C for 1 h.

Hybridizations were performed on cDNA microarray glass slides prepared at the Albert Einstein College of Medicine microarray facility. Each slide contained 9216 unique human cDNA clones. The hybridization solution was placed on a pretreated microarray slide, covered with Hybri-slip, and then incubated in a hybridization chamber overnight at 50°C. After hybridization, the slide was washed at room temperature, first with 0.2 × SSC, 0.1% SDS for 20 min with gently shaking, and then with 0.2 × SSC two times (20 min each time). The slide was dried by spinning at low speed in a centrifuge for 5 min.

Scanning, Griding, and Analysis.

The slides were scanned using a Microarray Scanner 4000A (Axon Instruments) at the Albert Einstein College of Medicine Cancer Center microarray facility. The scanner output images were localized by overlaying a grid on the fluorescent images, using the ScanAlyze software by Michael Eisen, Stanford University.4 The fluorescent intensities were then calculated, using the program Copy of FUBAR! (the easy way out). The final reported intensity was the difference between average probe intensity and average local background intensity. Both final reported intensities (green and red) were filtered, and the spots with intensity <1.5 were eliminated. The ratios of the red intensity to the green intensity and green intensity to red intensity for all targets were determined. The cDNA microarray results comparing cells treated with (HGF/SF+ADR) versus ADR alone are based on three completely independent experiments involving separate cell treatments, separate RNA isolations, and separate microarray assays. The microarray results comparing cells treated with HGF/SF alone vs 0 (control) are based on two completely independent experiments.

Semiquantitative RT-PCR Analysis.

Aliquots of total cellular RNA (1.0 μg) were subjected to first-strand cDNA synthesis using Superscript II reverse transcriptase (Life Technologies, Inc.), and the cDNA was diluted five times with water. One μl of the diluted cDNA was used for each PCR reaction. PCR amplifications were performed using a Perkin-Elmer DNA thermal cycler. The PCR primer sets used in this study are shown in Table 1. The PCR reaction conditions were individually optimized for each gene product studied. For each gene product, the cycle number was adjusted so that the reactions fell within the linear range of product amplification. PCR reaction conditions and cycle numbers are shown in Table 2. The β-actin and β2-microglobulin genes were used as controls for loading. PCR products were analyzed by electrophoresis through 1.2% agarose gels containing 0.1 mg/ml of ethidium bromide, and the gels were photographed under ultraviolet illumination. The amplified cDNA product bands were quantitated by densitometry.

IP and Western Blotting.

Subconfluent proliferating cells were harvested, and whole cell extracts were prepared, as described earlier (5). Each IP was carried out using 6 μg of antibody and 1000 μg of total extract protein. Precipitated proteins were collected using protein G beads, washed, eluted in boiling Laemmli sample buffer, and subjected to Western blotting. The c-Met IP antibody was c-Met COOH-terminal antibody SP260 (Santa Cruz Biotechnology, Santa Cruz, CA). The control IP antibody was an equivalent quantity (6 μg) of normal mouse IgG (Santa Cruz Biotechnology).

Western blotting was performed as described earlier (5). The immunoprecipitated proteins or equal aliquots of total cell protein (50 μg/lane) were electrophoresed, transferred, and blotted using the appropriate primary antibody. The primary antibodies were: (a) anti-c-Met antibody H-190 (sc-8307, rabbit polyclonal IgG; Santa Cruz Biotechnology; 1:500 dilution); (b) anti-phosphotyrosine antibody (Ab-4, mouse monoclonal; Calbiochem/Oncogene Research Products; 1:500 dilution); and (c) an anti-myc mouse monoclonal antibody (Invitrogen, Carlsbad, CA) at a 1:1500 dilution, to detect the myc epitope tagged wild-type and mutant CIP4 proteins.

cDNA Microarray Analyses.

The purpose of this study was to identify candidate genes, the expression of which is altered by HGF/SF in the setting of DNA damage, that might contribute to the HGF/SF-mediated protection against ADR. ADR is a DNA topoisomerase IIα inhibitor that induces single- and double-stranded DNA breakage. The basic experimental protocol is described in “Materials and Methods” and is summarized in the diagram shown below:

\begin|<|array|>||<|ccc|>|&\mathrm|<|MDA-MB-453 cells|>|&(\mathrm|<|Subconfluent, Proliferating|>|)\\|<|\pm|>| \mathrm|<|HGF/SF|>| (100 \mathrm|<|ng/ml|>|)&
formula
&\mathrm|<|Pre-Incubate|>| |<|\times|>|48 \mathrm|<|h|>|\\&\mathrm|<|ADR|>|&(10 |<|\mu|>|\mbox|<|\textsc|<|\mathrm|<|m|>||>||>| |<|\times|>| 2 \mathrm|<|h|>|)\\&
formula
&\mathrm|<|Postincubate|>| |<|\times|>| 72 \mathrm|<|h|>|\end|<|array|>|\mathrm|<|cDNA microarray analysis|>|: |<|[|>|\mathrm|<|HGF/SF|>||<|+|>|\mathrm|<|ADR|>||<|]|>| versus \mathrm|<|ADR|>|

This design was chosen for several reasons. The main comparison was between [HGF/SF+ADR] versus ADR alone to identify genes for which expression was altered by HGF/SF during the response to DNA damage, because it is likely that some of these alterations may contribute to HGF/SF-mediated cell protection. However, a comparison of cells treated with HGF/SF versus CONTROL (sham treatment only) was also made. A postincubation period of T = 72 h after removal of ADR was used to examine well-established alterations in gene expression rather than transient changes occurring immediately after DNA damage. Furthermore, alterations in mRNA levels observed at T = 72 h are more likely to reflect changes in protein protein levels, because the mRNA alterations are of a prolonged duration.

Previous studies indicate that the ability of HGF/SF to protect cells against DNA-damaging agents is attributable to a c-Met receptor-mediated signaling pathway leading to the activation of a c-Akt-dependent survival pathway (6, 7). The HGF/SF-mediated cell protection was blocked by two fragments of the HGF/SF protein (designated NK1 and NK2) that bind strongly to the c-Met receptor, fail to fully activate c-Met signal transduction, and function as competitive antagonists of the full-length HGF/SF protein (5). Here, we show by IP-Western blotting that exposure of MDA-MB-453 cells to HGF/SF (100 ng/ml × 20 min) causes a large increase in the degree of activation (tyrosine phosphorylation) of c-Met (Fig. 1 A). These findings support the role of the c-Met receptor in HGF/SF-mediated cell protection.

An illustration of cDNA microarrays comparing gene expression in cells treated with [HGF/SF+ADR] versus ADR alone and in cells treated with HGF/SF versus 0 (control) is provided in Fig. 1,B. Gene products whose expression was consistently increased in [HGF/SF+ADR]-treated cells, relative to cells treated with ADR alone, by an average ratio of >1.7 in at least two of three completely independent experiments (i.e., separate cell treatments, RNA isolations, and microarray hybridizations) are listed in Table 3. Those gene products for which expression was consistently decreased in cells treated with [HGF/SF+ADR] relative to ADR alone (ratio <0.7 in at least two of three completely independent experiments) are listed in Table 4. The ratio values shown in these tables represent the mean ± range (n = 2) or mean ± SD (n = 3). Some of the cDNA sequences contained on the microarray slides corresponded to expressed sequence tags for which the full-length sequence is not available in public domain databases. Alterations in the expression of cDNAs corresponding to these cDNAs, for which there is little or no information available on the structure-function of the putative gene product, are not included in Tables 3 and 4.

Although the HGF/SF-induced alterations in gene expression in the setting of DNA damage were not usually very large (1.7–4.0-fold increases and 0.41–0.67-fold decreases), these changes were reproducible. Elevated mRNA levels in the [HGF/SF+ADR] group (relative to ADR alone) were observed for various different functional classes of genes, including genes involved in the DNA damage response (e.g., ATM and FEN1), cell cycle regulation (e.g., Hs-cul-3 and HsGAK), signal transduction (e.g., RHO B and CSBP1), protein/RNA synthesis and metabolism (e.g., elF3, U1, and snRNP70), development and cellular differentiation (e.g., PKD1 and IRX-2a), general cellular metabolism (e.g., LDH-A and PGK1), and other functional categories (see Table 3). The abbreviations for these gene products are defined, and their functions (or putative functions) are shown in Table 3.

Genes for which the mRNA levels were reproducibly decreased in [HGF/SF+ADR]-treated cells (relative to ADR alone) included those in similar functional classes: including DNA damage response (e.g., TOPBP1), cell cycle regulation (e.g., c-Myc and CIP-4), signal transduction (e.g., 51C and STK2), and protein and RNA metabolism (e.g., human Gu protein). Few or no gene products for which expression was reduced were observed in several functional classes, including development and differentiation, transcriptional regulation, and general cellular metabolism. However, in interpreting the significance of the lack of genes whose expression was decreased in certain functional classes, it should be noted that: (a) the number of genes included in each functional class is influenced by the ratio cutoffs, which is arbitrary; (b) fewer genes showed decreased than increased expression, based on the ratio criteria chosen; and (c) the inclusion of genes in the different functional categories was somewhat arbitrary, because some genes could be included in more than one category.

Table 5 shows a cDNA microarray comparison of gene expression in MDA-MB-453 cells treated with HGF/SF relative to untreated control cells. These data indicate that the number of genes whose expression is reproducibly altered and the magnitude of the alterations are relatively small when the experiment is performed in the absence of treatment with ADR. However, it was noted that 51C (INPPL1), which was decreased in [HGF/SF+ADR]-treated cells relative to ADR alone, was also decreased in HGF/SF-treated cells relative to control.

RT-PCR Assays.

Because false-positive results are commonly observed in cDNA microarray analyses, we sought to confirm some of the gene expression alterations shown in Tables 3 and 4, via semiquantitative RT-PCR assays, using techniques described before by us (12, 13). The PCR primers and reaction conditions are provided in Tables 1 and 2, respectively. For each PCR assay, the reaction conditions and cycle numbers were individually optimized and adjusted so that the reaction fell within the linear range of product amplification. β-Actin and β2-microglobulin, two genes whose expression was not altered, were used as controls for loading. The levels of amplified PCR products were quantitated by densitometry and expressed relative to β-actin. Figs. 2 and 3 show semiquantitative RT-PCR results for genes whose expression was either increased (Fig. 2) or decreased (Fig. 3) in cells treated with [HGF/SF+ADR] relative to ADR alone.

In general, qualitative agreement between the cDNA microarray and RT-PCR results was quite good, although there were differences in the quantitative extent of the gene expression alterations between the two assay methodologies. Figs. 2 and 3 show 16 different genes for which expression was either increased (n = 7) or decreased (n = 9) in [HGF/SF+ADR]-treated cells by both cDNA microarray and semiquantitative RT-PCR analyses. Genes confirmed to be increased in the [HGF/SF+ADR] group included: ATM (ataxia-telangiectasia mutated), PKD1 (polycystic kidney disease-1), lysyl hydroxylase, LDH-A (lactate dehydrogenase-A), U1 snRNP70 (U1 small nuclear riboprotein, Mr 70,000), VEGF (vascular endothelial growth factor), and PGK1 (phosphoglycerate kinase). Genes confirmed to be decreased in the [HGF/SF+ADR] group included: c-Myc, CIP4 (cdc42-interacting protein-4), S100A9 (calgranulin), B94 (a TNF-inducible gene product), 51C (an inositol polyphosphate-5-phosphatase, also known as INPPL1 and SHIP-2), TOPBP1 (a DNA topoisomerase IIB binding protein), STK2 (a serine/threonine protein kinase), PTPN2 (a protein tyrosine phosphatase), and Gu protein (an RNA helicase).

Some of these alterations, although novel and not otherwise predictable, make sense within the context of explaining how HGF/SF may protect DNA-damaged cells, as will be considered in depth in the “Discussion.” The down-regulation of 51C in [HGF/SF+ADR]-treated cells was of particular interest because: (a) a decrease in 51C mRNA levels was also noted in cells treated with HGF/SF alone (related to sham-treated control cells); and (b) 51C is a lipid phosphatase, analogous to PTEN, except that 51C removes the 5-phosphate whereas PTEN removes the 3-phosphate (14). Thus, 51C, similar to PTEN(15), might be expected to inhibit c-Akt activation (see “Discussion”). Thus, we also examined 51C expression levels by semiquantitative RT-PCR using a completely different set of primers. Similar results were obtained for 51C using both sets of PCR primers (see Fig. 3).

Finally, it is noted that the RT-PCR assays provide additional information not obtained in the microarray comparisons. The RT-PCR assays allow comparisons of gene expression in cells treated with ADR, relative to control, a comparison not made by cDNA microarray analysis. Thus, in Fig. 2, it was observed that in most cases, the main effect of HGF/SF was not to alter gene expression by itself but to block the ADR-induced reduction of mRNA levels that were observed in the absence of HGF/SF. In Fig. 3, with the exception of 51C and PTPN2, HGF/SF by itself did not significantly alter gene expression; but its main effect was to block the ADR-induced up-regulation of mRNA levels. However in some cases, the mRNA levels in [HGF/SF+ADR]-treated cells were reduced to below control levels (e.g., CIP4 and TOPBP1).

Role of CIP4 in HGF/SF-mediated Protection against ADR.

The cdc42-interacting protein-4 (CIP4) was originally identified as a protein that binds to the activated form of cdc42, a Rho-like small GTPase, and was subsequently found to bind to the Wiskott-Aldrich syndrome protein (WASP) through its COOH terminus and to microtubules through its NH2 terminus (Refs. 10, 16; illustrated in Fig. 4,A). Although CIP4 is not known to be involved in cell survival or apoptosis pathways, the finding that CIP4 mRNA expression is up-regulated by ADR and that HGF/SF blocks the ADR-induced up-regulation of CIP4 raises this possibility. To determine whether CIP4 could modulate the survival of MDA-MB-453 cells in response to of ADR or HGF/SF, MDA-MB-453 cells were transfected with expression vectors encoding wild-type (wt) or mutant (truncated or deleted) forms of CIP4 containing an NH2-terminal myc epitope tage and then assayed for their survival response. The MTT assay, which measures cytotoxicity as the loss of mitochondrial function (i.e., the ability to reduce a tetrazolium dye to formazan) was used to quantitate cell viability (11). Expression of these proteins was confirmed by Western blotting of transfected cells using an anti-myc antibody (see Fig. 4 B).

Cells transfected with wild-type CIP4 (wtCIP4) showed an increased sensitivity to ADR, as well as a significantly decreased degree of cytoprotection by HGF/SF (Fig. 4 C), consistent with a role as a modulator of DNA damage or apoptosis response pathways. In the absence of HGF/SF, the decrease in cell survival (viability) in wtCIP4-transfected cells (relative to the empty vector transfected control) treated with ADR alone was greater at 10 μm ADR (−28%; P < 0.001, two-tailed t test) than at 20 μm ADR (−10%; P < 0.05, two-tailed t test). This finding might reflect a greater degree of up-regulation of endogenous CIP4 expression at the higher dose of ADR, so that the transfected wtCIP4 has a smaller effect. For cells treated with HGF/SF, at both 10 and 20 μm ADR, the survival of the wtCIP4-transfected cells was significantly lower than the empty vector-transfected cells (P < 0.001).

The quantitative degrees of cell protection by HGF/SF were calculated based on the following equation, where (S/So) = cell viability relative to control:

\[\mathrm{Protection\ by\ HGF/SF}\ (\%){=}{\{}{[}(S/S_{\mathrm{o}})_{{+}\mathrm{HGF/SF}{+}\mathrm{ADR}}\ {-}(S/S_{\mathrm{o}})_{0\ \mathrm{HGF/SF}{+}\mathrm{ADR}}{]}/{[}(S/S_{\mathrm{o}})_{0\ \mathrm{HGF/SF},\ 0\mathrm{ADR}}{-}(S/S_{\mathrm{o}})_{0\ \mathrm{HGF/SF}{+}\mathrm{ADR}}{]}{\}}{\times}100\]

The % protection values at doses of 10 and 20 μm ADR were averaged and plotted in the bottom panel of Fig. 4 C. On the basis of these calculations, transfection of wtCIP4 reduced the HGF/SF- mediated cell protection from ∼85 to 40%. On the other hand, there was no effect of wtCIP4 on cell viability in the absence of ADR (100% of control).

Expression vectors encoding mutant forms of CIP4 included a deletion of the microtubule binding domain (CIP4 118–545), a deletion missing the cdc42 binding region (CIP4 Δ 383–481) and a deletion of the COOH-terminal WASP binding domain (Fig. 4,A). In general, these deletion mutants had little or no effect on the degree of HGF/SF-mediated cell protection, nor did they affect cell viability in the absence of ADR (Fig. 4 C). However, cells transfected with the mutant CIP4 cDNAs did show an increase in cell viability (by ≅15–20%) at 20 μm ADR in the absence of HGF/SF. This finding may be attributable to their function as dominant inhibitors of the endogenous wild-type CIP4, although that conclusion cannot be made from this experiment alone.

Similar findings were obtained using another cell type that is also protected against ADR-induced DNA damage by preincubation with HGF/SF, DU-145 human prostate cancer cells (6). Thus, wtCIP4, but not the mutant or truncated forms of CIP4, blocked the HGF/SF-mediated protection against ADR (data not shown). These findings are consistent with a role for CIP4 as a regulator or modulator of cell survival in the setting of DNA damage.

These studies revealed an interesting pattern of up-regulation and down-regulation of genes in MDA-MB-453 cells treated with [HGF/SF+ADR], as compared with ADR alone. Admittedly, some of these gene products may be altered simply because of the higher proportion of surviving cells in the [HGF/SF+ADR]-treated group relative to the ADR-treated group. Gene products of this type might include lactate dehydrogenase [LDH-A] and phosphoglycerate kinase [PGK1], which were increased in [HGF/SF+ADR]-treated cells. However, the complexity of the findings, including many genes that were either increased or decreased in ADR-treated cells, suggest a more selective pattern of altered gene regulation.

We have reported previously that in addition to protecting cells against cytotoxicity and apoptosis induced by DNA damage, HGF/SF enhanced the ability of carcinoma cells, including MDA-MB-453 cells, to repair DNA strand breaks induced by ADR or X-rays (6). The observation that cells treated with [HGF/SF+ADR] show altered expression of certain gene products involved in DNA damage response pathways is consistent with that prior finding. For example, ATM (ataxia-telangectasia mutated), a nuclear protein kinase involved in DNA damage signaling (17), and FEN1 (flap endonuclease-1), an enzyme implicated in the base excision repair pathway (18), were up-regulated in [HGF/SF+ADR]-treated cells. A mutation or deletion of the ATM gene leads to a defect in the repair of double-strand DNA breaks and increased sensitivity to ionizing radiation.

We also found that ADR caused the down-regulation of the PKD1 (polycystic kidney disease-1) gene product, and HGF/SF blocked the ADR-induced down-regulation of PKD1 expression. PKD1 has been identified as a developmentally regulated gene, the absence of which is linked to type I autosomal dominant polycystic kidney disease (19). The function of this gene is not well understood, but PKD1 was found to encode a large cell membrane protein associated with the cadherin-catenin cell:cell adhesion complex (20). Interestingly, the PKD1 gene product was shown recently to play roles in maintaining the structural integrity of blood vessels (21) and in protecting MDCK epithelial cells against apoptosis (22). We had reported previously that HGF/SF protects both vascular endothelial and MDCK epithelial cells against DNA damage-induced apoptosis (4, 5). Thus, inhibition of the down-regulation of PKD1 by HGF/SF may be a cytoprotective function, one which merits further investigation.

On the other hand, the expression of the topoisomerase binding protein TOPBP1, which binds DNA topoisomerase IIB and also shows DNA strand break binding activity (23, 24, 25), was decreased in cells treated with [HGF/SF+ADR]. ADR causes DNA strand breakage in part by converting the DNA topology enzyme topoisomerase II into a DNA cleaving enzyme (26). It is thought that topoisomerase binding proteins such as TOPBP1 may contribute to or potentiate ADR-mediated DNA damage, but the role of TOPBP1 in this process remains to be established. The finding that ADR up-regulates TOPBP1 expression and that the up-regulation is blocked by HGF/SF is provocative, because it suggests a potential mechanism by which HGF/SF might modulate the DNA damage and repair process, upstream of DNA-damage induced apoptosis. HGF/SF blocked the ADR-induced up-regulation of the human Gu protein. Gu is a DEXD box nucleolar RNA helicase, which presumably participates in aspects of RNA synthesis and processing (27). This finding is interesting because recent evidence suggests that, like topoisomerase II, Gu may be a target of ADR (28). However, the significance of this finding relative to HGF/SF-mediated cell protection remains to be determined.

A number of gene products implicated in signal transduction pathways were found to be up-regulated (e.g., RhoB and RAB5A) or down-regulated [e.g., STK2 (a serine/threonine kinase), PTPN2 (also known as T-cell protein tyrosine phosphatase, TCPTP) and 51C (also known as INPPL1 or SHIP-2)]. Expression of the 51C gene, which encodes an the inositol polyphosphate-5-phosphatase (29), was decreased in both HGF/SF-treated cells (relative to control) and [HGF/SF+ADR]-treated cells (relative to ADR alone). This finding is of particular interest because of previous studies demonstrating a requirement for P13K → c-Akt signaling in the HGF/SF-mediated protection of breast cancer (MDA-MB-453) and glioma cell lines against apoptosis (6, 7, 30).

It had been reported previously that the tumor suppressor PTEN/MMAC1, an inositol polyphosphate-3-phosphatase, inhibited the PI3K/Akt pathway through its lipid phosphatase activity (15). Recently, 51C was similarly found to act as an inhibitor of the PI3K/Akt pathway, presumably also by reducing the levels of phosphatidylinsitol-3,4,5-phosphate [PI(3,4,5)P3], which is generated through the lipid kinase activity of PI3K (31). Thus, the reduced expression of 51C in HGF/SF-treated cells should have the effect of maintaining the levels of PI(3,4,5)P3, which is essential for the activation and proper localization of c-Akt.

Interestingly, it has been demonstrated that one of the splice variants of the protein tyrosine phosphatase PTPN2/TCPTP, TC45, can inhibit epidermal growth factor receptor-mediated activation of PI3K/c-Akt signaling (32). Although the role of PTPN2 in c-Met receptor signaling and the important in vivo substrates for PTPN2 are unclear, the finding that HGF/SF down-regulates PTPN2 gene expression again raises the possibility that PTPN2 is a target for the HGF/SF-mediated protection against DNA-damaging agents.

A cytoskeleton-associated cdc42-interacting protein, CIP4, was found to be up-regulated in ADR-treated cells, whereas HGF/SF blocked the up-regulation of CIP4. The function of CIP4 has not been established definitively, but CIP4 may function, in part, to carry the Wiskott-Aldrich syndrome protein (WASP), a multidomain protein involved in cytoskeletal organization, from actin filaments to microtubules (10). We showed that forced expression of wild-type human CIP4 reduced the degree of HGF/SF-mediated protection of MDA-MB-453 cells to 50% or less of that observed in untransfected or empty vector-transfected control cells. On the other hand, expression of internally deleted or truncated CIP4 proteins did not inhibit cell protection. These findings suggests a role for CIP4 in cell survival/apoptosis pathways, a finding that is not obvious based on its known activities and protein interactions.

Although we have focused on some of the more novel findings of this study, not all of the cDNA microarray and RT-PCR results were unexpected. For example, the finding that ADR up-regulates c-Myc mRNA expression and that the up-regulation was blocked by HGF/SF was not unexpected. We reported similar results based on Western blotting of MDA-MB-453 cells (5). The transcription factor c-Myc has been implicated in a variety of cellular processes, including proliferation, differentiation, transformation, and apoptosis. Overexpression of c-Myc renders cells more susceptible to apoptosis through both p53-dependent and p53-independent mechanisms (33, 34). Thus, theoretically, down-regulation of c-Myc by HGF/SF in the setting of DNA damage might be expected to confer protection against apoptosis.

We had also reported that ADR down regulates the protein levels of the antiapoptotic protein Bcl-XL, whereas HGF/SF blocks the ADR-induced downregulation of Bcl-XL protein in MDA-MB-453 cells (5). Bcl-XL was not present among the cDNAs spotted onto the microarrays slides used in this study. However, we examined the Bcl-XL mRNA expression by semiquantitative RT-PCR analysis and found no ADR or HGF/SF alterations in Bcl-XL mRNA levels in multiple repeat assays.(6) Thus, the alterations in Bcl-XL protein levels probably occur through translational or posttranslational mechanisms. This finding suggests that some of the protection conferred by HGF/SF may be attributable to alterations in protein processing and metabolism. We had also noted that cell protection required a relatively long preincubation with HGF/SF of ≥24 h for some protection and ≥48 h for maximal protection (5). This consideration suggests that the ability of HGF/SF to block the reduction of Bcl-XL protein levels induced by ADR might be attributable to alterations in the expression of genes involved in the processing or metabolism of Bcl-XL.

Our findings suggest the viability of the cDNA microarray approach, coupled with additional studies to confirm gene expression alterations and functional studies to evaluate the significance of the findings, as a means of identifying novel and interesting genes that may be involved in HGF/SF cell protection pathways. It is likely that some of the genes for which expression was altered by HGF/SF in the setting of DNA damage are not involved in cell survival or apoptosis pathways. Alterations in these gene products may reflect other activities of HGF/SF than promotion of cell survival or may be a passive consequence of cell survival rather than a cause of survival. On the other hand, it is also likely that genes not implicated previously in cell survival or apoptosis mechanisms will be found to play roles in these processes (e.g., CIP4).

Fig. 1.

HGF/SF activates c-Met and causes altered gene expression during DNA damage. A, HGF/SF causes activation (tyrosine phosphorylation) of the c-Met receptor. Subconfluent proliferating MDA-MB-453 cells were exposed to recombinant human HGF/SF (100 ng/ml × 20 min) and harvested for IP-Western blotting. Cells were immunoprecipitated using an anti-c-Met antibody or the same amount of normal IgG, as a negative control. IPs were then Western blotted using antibodies against c-Met and against phosphotyrosine residues. The basal level of phosphotyrosylated c-Met was low but was increased significantly by treatment with HGF/SF. No c-Met or phosphotyrosylated proteins were detected in the control (normal IgG) IP. B, illustration of cDNA microarray grids comparing gene expression in MDA-MB-453 cells treated with [(HGF/SF+ADR) versus ADR alone] (top panels) or with [HGF/SF versus 0 (control)] (bottom panels). Cells were treated as described in the text. The panels on the right show magnified views corresponding to the boxed regions of the array on the left. cDNAs isolated from cells treated with [HGF/SF+ADR] or HGF/SF were labeled with Cy5 (red dye), whereas cDNAs from cells treated with ADR alone or 0 were labeled with Cy3 (green dye). Spots showing red (or green) fluorescence correspond to genes overexpressed (underexpressed) in cells treated with [HGF/SF+ADR] relative to ADR alone and with HGF/SF relative to 0. Yellow spots correspond to genes equally expressed under the conditions being compared, whereas the absence of fluorescence indicates genes under either experimental condition. Note that alterations in gene expression, indicated by red or green spots, are more prominent in the comparison of [(HGF/SF+ADR) versus ADR] than [HGF/SF versus 0].

Fig. 1.

HGF/SF activates c-Met and causes altered gene expression during DNA damage. A, HGF/SF causes activation (tyrosine phosphorylation) of the c-Met receptor. Subconfluent proliferating MDA-MB-453 cells were exposed to recombinant human HGF/SF (100 ng/ml × 20 min) and harvested for IP-Western blotting. Cells were immunoprecipitated using an anti-c-Met antibody or the same amount of normal IgG, as a negative control. IPs were then Western blotted using antibodies against c-Met and against phosphotyrosine residues. The basal level of phosphotyrosylated c-Met was low but was increased significantly by treatment with HGF/SF. No c-Met or phosphotyrosylated proteins were detected in the control (normal IgG) IP. B, illustration of cDNA microarray grids comparing gene expression in MDA-MB-453 cells treated with [(HGF/SF+ADR) versus ADR alone] (top panels) or with [HGF/SF versus 0 (control)] (bottom panels). Cells were treated as described in the text. The panels on the right show magnified views corresponding to the boxed regions of the array on the left. cDNAs isolated from cells treated with [HGF/SF+ADR] or HGF/SF were labeled with Cy5 (red dye), whereas cDNAs from cells treated with ADR alone or 0 were labeled with Cy3 (green dye). Spots showing red (or green) fluorescence correspond to genes overexpressed (underexpressed) in cells treated with [HGF/SF+ADR] relative to ADR alone and with HGF/SF relative to 0. Yellow spots correspond to genes equally expressed under the conditions being compared, whereas the absence of fluorescence indicates genes under either experimental condition. Note that alterations in gene expression, indicated by red or green spots, are more prominent in the comparison of [(HGF/SF+ADR) versus ADR] than [HGF/SF versus 0].

Close modal
Fig. 2.

Semiquantitative RT-PCR analyses of genes for which expression was increased in MDA-MB-453 cells treated with [HGF/SF+ADR] relative to ADR alone. Subconfluent proliferating cells were preincubated ± HGF/SF (100 ng/ml × 48 h), treated ± ADR (10 μm × 2 h), washed three times to remove the ADR, and postincubated for 72 h in fresh drug-free medium, as described in the text. RNA was collected, and RT-PCR assays were performed (see “Materials and Methods” and Tables 1 and 2 for methodological details). β-Actin and β2-microglobulin were used as controls for loading. The amplified PCR products were quantitated by densitometry and expressed relative to β-actin, as a percentage of the control (0 HGF/SF, 0 ADR).

Fig. 2.

Semiquantitative RT-PCR analyses of genes for which expression was increased in MDA-MB-453 cells treated with [HGF/SF+ADR] relative to ADR alone. Subconfluent proliferating cells were preincubated ± HGF/SF (100 ng/ml × 48 h), treated ± ADR (10 μm × 2 h), washed three times to remove the ADR, and postincubated for 72 h in fresh drug-free medium, as described in the text. RNA was collected, and RT-PCR assays were performed (see “Materials and Methods” and Tables 1 and 2 for methodological details). β-Actin and β2-microglobulin were used as controls for loading. The amplified PCR products were quantitated by densitometry and expressed relative to β-actin, as a percentage of the control (0 HGF/SF, 0 ADR).

Close modal
Fig. 3.

Semiquantitative RT-PCR analyses of genes for which expression was decreased in MDA-MB-453 cells treated with [HGF/SF+ADR] relative to ADR alone. Assays were performed as described in the Fig. 2 legend. Note that 51C was analyzed using two completely different sets of PCR primers.

Fig. 3.

Semiquantitative RT-PCR analyses of genes for which expression was decreased in MDA-MB-453 cells treated with [HGF/SF+ADR] relative to ADR alone. Assays were performed as described in the Fig. 2 legend. Note that 51C was analyzed using two completely different sets of PCR primers.

Close modal
Fig. 4.

Effect of genetic manipulation of cdc42-interacting protein (CIP4) expression on HGF/SF-mediated protection of MDA-MB-453 cells. A, schematic diagrams of CIP4 expression vectors. The human CIP4 cDNAs were cloned into the pRK5-myc mammalian expression vector, which provides an NH2-terminal myc epitope tag. B, expression of wild-type and mutant CIP4 proteins. Cells were transfected with the different CIP4 expression vectors as described below (C), and the dishes were incubated for 24 h to allow expression of the encoded proteins. Proteins of the expected sizes were detected by Western blotting, using an antibody against the myc epitope tag. Cells transfected with the empty pRK5-myc vector showed no myc-tagged proteins. C, effect of transient expression of wild-type (wt) and mutant CIP4 proteins on HGF/SF-mediated cell protection. Subconfluent proliferating cells in 100-mm dishes were transiently transfected overnight with 10 μg of each vector, in the presence of Lipofectamine. Cells were washed, subcultured into 96-well dishes, pre-incubated ± HGF/SF (100 ng/ml × 48 h), exposed to ADR (10 or 20 μm × 2 h), washed, postincubated for 72 h in fresh drug-free medium, and assayed for MTT dye conversion. Cell viability values (means; bars, SE) are based on 10 replicate wells. For each experimental condition, cells treated with [HGF/SF+ADR] showed higher viability than those treated with ADR alone (P < 0.001, two-tailed t test). The viability of cells transfected with wtCIP4 and treated with [HGF/SF+ADR] was significantly reduced, compared with similarly treated untransfected or empty vector-transfected cells (P < 0.001).

Fig. 4.

Effect of genetic manipulation of cdc42-interacting protein (CIP4) expression on HGF/SF-mediated protection of MDA-MB-453 cells. A, schematic diagrams of CIP4 expression vectors. The human CIP4 cDNAs were cloned into the pRK5-myc mammalian expression vector, which provides an NH2-terminal myc epitope tag. B, expression of wild-type and mutant CIP4 proteins. Cells were transfected with the different CIP4 expression vectors as described below (C), and the dishes were incubated for 24 h to allow expression of the encoded proteins. Proteins of the expected sizes were detected by Western blotting, using an antibody against the myc epitope tag. Cells transfected with the empty pRK5-myc vector showed no myc-tagged proteins. C, effect of transient expression of wild-type (wt) and mutant CIP4 proteins on HGF/SF-mediated cell protection. Subconfluent proliferating cells in 100-mm dishes were transiently transfected overnight with 10 μg of each vector, in the presence of Lipofectamine. Cells were washed, subcultured into 96-well dishes, pre-incubated ± HGF/SF (100 ng/ml × 48 h), exposed to ADR (10 or 20 μm × 2 h), washed, postincubated for 72 h in fresh drug-free medium, and assayed for MTT dye conversion. Cell viability values (means; bars, SE) are based on 10 replicate wells. For each experimental condition, cells treated with [HGF/SF+ADR] showed higher viability than those treated with ADR alone (P < 0.001, two-tailed t test). The viability of cells transfected with wtCIP4 and treated with [HGF/SF+ADR] was significantly reduced, compared with similarly treated untransfected or empty vector-transfected cells (P < 0.001).

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

Supported, in part, by USPHS Grants R01-ES09169, R01-82599, and RO1-80000; United States Army Breast Cancer grant DAMD17-99-1-9254; and the Susan G. Komen Breast Cancer Foundation.

3

The abbreviations used are: HGF/SF, hepatocyte growth factor/scatter factor; ADR, Adriamycin; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; IP, immunoprecipitation; PI3K, phosphatidylinositol 3-kinase; RT-PCR, reverse transcription-PCR.

4

Internet address: eisen@genome.stanford.edu, 1998–1999.

Table 1

Primers used for semiquantitative RT-PCR analyses

Gene namePrimer Sequences (5′ → 3′)Genebank accession no.Position in cDNA sequenceExpected size of product (bp)
ATM (ataxia telangiectasia mutated) Sense: ctcagatggtcagaagtgttgaggc NM_000051 8030–8757 728 
 Antisense: tacactgcgcgtataagccaatcgc    
Polycystic kidney disease-1 (PKD-1) Sense: ctcctatcttgtgacagtcaccgcg NM_000296 4528–5211 684 
 Antisense: gtccagctgtaggagacgttggtgc    
Lysyl hydroxylase (LH) Sense: cgtcgatccctaattggccaggcc L06419 2372–2986 615 
 Antisense: aagatcgagctgtgcacagatgcc    
Lactate dehydrogenase type A (LDH-A) Sense: tagttctgccacctctgacgcacc X02152.1 1330–1628 299 
 Antisense: tataacacttggatagttggttgc    
U1 snRNP70 Sense: cgcagatggcaagaagattgatggc NM_003089 1700–2096 397 
 Antisense: actccggctgcttcgccgcttccgg    
Vascular endothelial growth factor (VEGF) Sense: atgtctatcagcgcagctactgcc XM_004512 150–548 399 
 Antisense: caagctgcctcgccttgcaacgcg    
Phosphoglycerate kinase 1 (PGK-1) Sense: ggtagtccttatgagccacctaggc XM_010102 250–1011 762 
 Antisense: cagccagcaggtatgccagaagcc    
c-Myc Sense: cacatcagcacaactacgcagcgc K02276 1331–1847 517 
 Antisense: gactcagccaaggttgtgaggttgc    
Cdc42-interacting protein (CIP-4) Sense: caagacatggatgaacgcagg AJ000414 688–1550 863 
 Antisense: gagatagtgccctcgctgg    
S100A9 (calgranulin B) Sense: aggagttcatcatgctgatggcg NM_002965 275–479 205 
 Antisense: tggcctggcctcctgattagtgg    
TNF-inducible gene product B94 Sense: gagtgcagtggcctggtcatggc M92357 3306–3944 639 
 Antisense: tcctgactcagcactgcagaggc    
51C (inositol-5′-polyphosphate phosphatase like-1, INPPL1) Primer Set #1 Sense: cttccttcgattcagtgaggagg L36818 2062–2804 743 
 Antisense: ccttatcaatgctgatccactcg    
51C (inosital-5′-polyphosphate phosphatase like-1, INPPL1) Primer Set #2 Sense: tcagggcagtatctctctgcc Y14385 4077–4522 446 
 Antisense: accccaataatattaaggtgc    
Topoisomerase binding protein-1 (TOPBP1) Sense: cgacctagagtacactaatcgc NM_007027 4630–5123 494 
 Antisense: gcttcctcattaaaccttgtgc    
Protein Ser/Thr kinase STK2 Sense: caacttacagtgtgaaagctcgcc NM_003157 2646–3144 499 
 Antisense: cttaaggttattaacaatagcagg    
Protein tyrosine phosphatase (PTPN2) Sense: ctaaggaagacttatctcctgcc NM_002828 938–1359 422 
 Antisense: tgtagcactgtcagttactagtg    
Human Gu protein Sense: acaggcagagctggaaggac U41387 1636–2123 488 
 Antisense: actgatgcggtaggtacatc    
β-Actin Sense: tagcggggttcacccacactgtgccccatcta XM_004814 541–1201 661 
 Antisense: ctagaagcatttgcggtggaccgatggaggg    
β2-Microglobulin Sense: ctcgcgctactctctctttc XM_007650 41–176 136 
 Antisense: tgtcggatggatgaaaccag    
Gene namePrimer Sequences (5′ → 3′)Genebank accession no.Position in cDNA sequenceExpected size of product (bp)
ATM (ataxia telangiectasia mutated) Sense: ctcagatggtcagaagtgttgaggc NM_000051 8030–8757 728 
 Antisense: tacactgcgcgtataagccaatcgc    
Polycystic kidney disease-1 (PKD-1) Sense: ctcctatcttgtgacagtcaccgcg NM_000296 4528–5211 684 
 Antisense: gtccagctgtaggagacgttggtgc    
Lysyl hydroxylase (LH) Sense: cgtcgatccctaattggccaggcc L06419 2372–2986 615 
 Antisense: aagatcgagctgtgcacagatgcc    
Lactate dehydrogenase type A (LDH-A) Sense: tagttctgccacctctgacgcacc X02152.1 1330–1628 299 
 Antisense: tataacacttggatagttggttgc    
U1 snRNP70 Sense: cgcagatggcaagaagattgatggc NM_003089 1700–2096 397 
 Antisense: actccggctgcttcgccgcttccgg    
Vascular endothelial growth factor (VEGF) Sense: atgtctatcagcgcagctactgcc XM_004512 150–548 399 
 Antisense: caagctgcctcgccttgcaacgcg    
Phosphoglycerate kinase 1 (PGK-1) Sense: ggtagtccttatgagccacctaggc XM_010102 250–1011 762 
 Antisense: cagccagcaggtatgccagaagcc    
c-Myc Sense: cacatcagcacaactacgcagcgc K02276 1331–1847 517 
 Antisense: gactcagccaaggttgtgaggttgc    
Cdc42-interacting protein (CIP-4) Sense: caagacatggatgaacgcagg AJ000414 688–1550 863 
 Antisense: gagatagtgccctcgctgg    
S100A9 (calgranulin B) Sense: aggagttcatcatgctgatggcg NM_002965 275–479 205 
 Antisense: tggcctggcctcctgattagtgg    
TNF-inducible gene product B94 Sense: gagtgcagtggcctggtcatggc M92357 3306–3944 639 
 Antisense: tcctgactcagcactgcagaggc    
51C (inositol-5′-polyphosphate phosphatase like-1, INPPL1) Primer Set #1 Sense: cttccttcgattcagtgaggagg L36818 2062–2804 743 
 Antisense: ccttatcaatgctgatccactcg    
51C (inosital-5′-polyphosphate phosphatase like-1, INPPL1) Primer Set #2 Sense: tcagggcagtatctctctgcc Y14385 4077–4522 446 
 Antisense: accccaataatattaaggtgc    
Topoisomerase binding protein-1 (TOPBP1) Sense: cgacctagagtacactaatcgc NM_007027 4630–5123 494 
 Antisense: gcttcctcattaaaccttgtgc    
Protein Ser/Thr kinase STK2 Sense: caacttacagtgtgaaagctcgcc NM_003157 2646–3144 499 
 Antisense: cttaaggttattaacaatagcagg    
Protein tyrosine phosphatase (PTPN2) Sense: ctaaggaagacttatctcctgcc NM_002828 938–1359 422 
 Antisense: tgtagcactgtcagttactagtg    
Human Gu protein Sense: acaggcagagctggaaggac U41387 1636–2123 488 
 Antisense: actgatgcggtaggtacatc    
β-Actin Sense: tagcggggttcacccacactgtgccccatcta XM_004814 541–1201 661 
 Antisense: ctagaagcatttgcggtggaccgatggaggg    
β2-Microglobulin Sense: ctcgcgctactctctctttc XM_007650 41–176 136 
 Antisense: tgtcggatggatgaaaccag    
Table 2

PCR reaction conditions for semiquantitative RT-PCR assays

Gene namePCR cycle parametersNo. of cycles
ATM 94°C (1 min); 65°C (1 min); 72°C (1 min) 31 
PKD-1 94°C (1 min); 72°C (2 min) 28 
Lysyl hydroxylase 94°C (1 min); 60°C (1 min); 72°C (1 min) 28 
LDH-A 94°C (30 sec); 57°C (30 sec); 72°C (1 min) 25 
U1 snRNP70 94°C (1 min); 60°C (1 min); 72°C (1 min) 30 
VEGF 94°C (1 min); 57°C (1 min); 72°C (1 min) 28 
Phosphoglycerate kinase-1 (PGK-1) 94°C (1 min); 60°C (1 min); 72°C (1 min) 25 
c-Myc 94°C (1 min); 57°C (1 min); 72°C (1 min) 25 
CIP-4 94°C (1 min); 59°C (1 min); 72°C (1 min) 35 
S100A9 94°C (1 min); 65°C (1 min); 72°C (1 min) 31 
B94 94°C (1 min); 65°C (1 min); 72°C (1 min) 31 
51C [INPPL1] Primer Set #1 (743-bp) 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 33 
51C [INPPL1] Primer Set #2 (446-bp) 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 30 
TOPBP1 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 30 
STK2 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 33 
PTPN2 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 33 
Human Gu protein 94°C (30 sec); 55°C (30 sec); 72°C (1 min) 30 
β-Actin 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 23 
β2-Microglobulin 94°C (1 min); 54°C (1 min); 72°C (1 min) 28 
Gene namePCR cycle parametersNo. of cycles
ATM 94°C (1 min); 65°C (1 min); 72°C (1 min) 31 
PKD-1 94°C (1 min); 72°C (2 min) 28 
Lysyl hydroxylase 94°C (1 min); 60°C (1 min); 72°C (1 min) 28 
LDH-A 94°C (30 sec); 57°C (30 sec); 72°C (1 min) 25 
U1 snRNP70 94°C (1 min); 60°C (1 min); 72°C (1 min) 30 
VEGF 94°C (1 min); 57°C (1 min); 72°C (1 min) 28 
Phosphoglycerate kinase-1 (PGK-1) 94°C (1 min); 60°C (1 min); 72°C (1 min) 25 
c-Myc 94°C (1 min); 57°C (1 min); 72°C (1 min) 25 
CIP-4 94°C (1 min); 59°C (1 min); 72°C (1 min) 35 
S100A9 94°C (1 min); 65°C (1 min); 72°C (1 min) 31 
B94 94°C (1 min); 65°C (1 min); 72°C (1 min) 31 
51C [INPPL1] Primer Set #1 (743-bp) 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 33 
51C [INPPL1] Primer Set #2 (446-bp) 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 30 
TOPBP1 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 30 
STK2 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 33 
PTPN2 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 33 
Human Gu protein 94°C (30 sec); 55°C (30 sec); 72°C (1 min) 30 
β-Actin 94°C (30 sec); 56°C (30 sec); 72°C (1 min) 23 
β2-Microglobulin 94°C (1 min); 54°C (1 min); 72°C (1 min) 28 
Table 3

Genes whose expression is increased in [HGF/SF+ADR]-treated cells relative to ADR alone

Gene nameFunctionRatio
DNA damage response   
ATM (ataxia-telangiectasia mutated) DNA damage signaling, nuclear PI-3-kinase domain protein 2.9 ± 0.0 
FEN1 Flap endonuclease-1, implicated in base excision repair pathway 2.1 ± 0.04 
Cell cycle regulation   
CENP-F kinetochore Microtubule motor protein, component of centromere 2.7 ± 0.3 
Hs-cul-3 Homology to cullin/cdc53 family, ? role in cell proliferation control 2.4 ± 0.15 
HsGAK Unibquitously expressed perinuclear cyclin G-associated kinase 2.3 ± 0.4 
NuMa gene (clone T33) Nuclear mitotic protein, mitotic centromere function 2.1 ± 0.04 
Cell growth regulator CGR19 Ring finger gene induced by p53 2.0 ± 0.2 
Cyclin G2 May mediate proteolysis of G1 family cyclins 1.9 ± 0.2 
Signal transduction-related   
RHO B transforming protein Endosomal Rho protein, roles in receptor trafficking and apoptosis 4.0 ± 1.7 
Dual specificity tyr phosphorylat. regulated kinase Homolog of Drosophila kinase midbrain, ? role in brain development 2.1 ± 0.2 
CSaids binding protein-1 [CSBP1] Also known as p38, homolog of yeast Hog1 MAPK, stress response signaling 2.1 ± 0.15 
Protein phosphatase PPP2R2A [PR53] Mr 53,000 regulatory subunit of Ser/Thr protein phosphatase 2A 1.9 ± 0.2 
RAB5A ras-related small GTPase, regulator of vesicle trafficking 1.6 ± 0.1 
Protein and RNA metabolism   
Lysyl hydroxylase [LH1, also known as PLOD] Collagen modification, defective in Ehlers-Danlos syndrome VI 2.4 ± 0.7 
elF3 Eukaryotic translation initiation factor 2.2 ± 0.3 
U1 snRNP70 (small nuclear ribonucleoprotein) Associated with RNA processing and ubiquitination 2.1 ± 0.3 
SAP49 Spliceosomal associated protein, RNA processing 2.1 ± 0.5 
Cellular and nucleic acid binding protein  2.0 ± 0.3 
SNC19 Putative novel human serine protease mapping to chr. 11q24-25 1.9 ± 0.2 
β-COP Golgi transport protein, component of COTI complex 1.8 ± 0.02 
Cytokine and cytokine-induced   
Vascular endothelial growth factor (VEGF) Stimulates endothelial cell proliferation and angiogenesis 2.8 ± 0.9 
VEGF-related protein [VRP] FLT4 ligand, VEGF family protein 2.1 ± 0.4 
Interferon-induced Mr 17,000 protein Precursor of 15 kDa protein homologous to ubiquitin 1.8 ± 0.2 
Development and differentiation   
Keratin 17 Soft epithelial keratin 9 (e.g., hair follicle) 3.8 ± 1.5 
B4-2 protein Proline-rich natural killer cell protein 2.6 ± 0.8 
Keratin 19 Intermediate filament protein 2.5 ± 0.7 
Iroquois class homeodomain protein IRX-2a Transcription factor involved in embryonic patterning, regionalization 2.3 ± 0.4 
Polycystic kidney disease-1 [PKD1] Component of cadherin-catenin complex, endothelial survival 2.0 ± 0.4 
Cancellous bone osteoblast mRNA expressed in osteoblasts, function unknown 2.0 ± 0.1 
SM22α homologue [TAGLN2] Marker of differentiated smooth muscle (SM)-like cells 1.7 ± 0.2 
Transcriptional regulation   
RIP140 Nuclear receptor-interacting protein, transcriptional coactivator 2.1 ± 0.1 
hkf-1 Novel zinc finger protein isolated from a brain cDNA library 2.1 ± 0.0 
DGS-I DiGeorge (velocardiofacial) syndrome candidate gene 2.0 ± 0.45 
General cellular metabolism   
Lactate dehydrogenase-A [LDH-A] Enzyme involved in anaerobic glycolysis 4.1 ± 1.0 
Phosphoglycerate kinase [PGK1] Glycolytic enzyme, induced by hypoxia-inducible factor HIF-1 4.0 ± 1.4 
Hexokinase-1 Early glucose metabolic enzyme 2.2 ± 0.3 
Glucosylceramidase precursor Degradation of GlcCer, mutated in Gaucher’s disease 2.0 ± 0.4 
Phosphoglycerate mutase 1 [PGAM1] Late glycolytic pathway enzyme 1.7 ± 0.25 
Cytoskeletal and structural proteins   
Ezrin-radixin-moesin phosphoprotein 50 [EBP50] PDZ phosphoprotein, linkage of cell membrane to cytoskeleton 3.8 ± 1.0 
p16-Arc [ARC16] Arp 2/3 complex subunit, control of actin polymerization 1.8 ± 0.1 
Miscellaneous and unknown function   
XAP-5 Unknown function 3.1 ± 0.7 
OriP binding protein [OBP1] Binds to Epstein Barr virus replication origin 2.1 ± 0.2 
JTV-1 Gene overlapping PMS2, function unknown 1.9 ± 0.2 
MAC30 (3′ end) Meningioma expressed protein 1.9 ± 0.2 
Sm-like (CaSm) Cancer-associated Sm motif-like domain protein 1.7 ± 0.2 
Gene nameFunctionRatio
DNA damage response   
ATM (ataxia-telangiectasia mutated) DNA damage signaling, nuclear PI-3-kinase domain protein 2.9 ± 0.0 
FEN1 Flap endonuclease-1, implicated in base excision repair pathway 2.1 ± 0.04 
Cell cycle regulation   
CENP-F kinetochore Microtubule motor protein, component of centromere 2.7 ± 0.3 
Hs-cul-3 Homology to cullin/cdc53 family, ? role in cell proliferation control 2.4 ± 0.15 
HsGAK Unibquitously expressed perinuclear cyclin G-associated kinase 2.3 ± 0.4 
NuMa gene (clone T33) Nuclear mitotic protein, mitotic centromere function 2.1 ± 0.04 
Cell growth regulator CGR19 Ring finger gene induced by p53 2.0 ± 0.2 
Cyclin G2 May mediate proteolysis of G1 family cyclins 1.9 ± 0.2 
Signal transduction-related   
RHO B transforming protein Endosomal Rho protein, roles in receptor trafficking and apoptosis 4.0 ± 1.7 
Dual specificity tyr phosphorylat. regulated kinase Homolog of Drosophila kinase midbrain, ? role in brain development 2.1 ± 0.2 
CSaids binding protein-1 [CSBP1] Also known as p38, homolog of yeast Hog1 MAPK, stress response signaling 2.1 ± 0.15 
Protein phosphatase PPP2R2A [PR53] Mr 53,000 regulatory subunit of Ser/Thr protein phosphatase 2A 1.9 ± 0.2 
RAB5A ras-related small GTPase, regulator of vesicle trafficking 1.6 ± 0.1 
Protein and RNA metabolism   
Lysyl hydroxylase [LH1, also known as PLOD] Collagen modification, defective in Ehlers-Danlos syndrome VI 2.4 ± 0.7 
elF3 Eukaryotic translation initiation factor 2.2 ± 0.3 
U1 snRNP70 (small nuclear ribonucleoprotein) Associated with RNA processing and ubiquitination 2.1 ± 0.3 
SAP49 Spliceosomal associated protein, RNA processing 2.1 ± 0.5 
Cellular and nucleic acid binding protein  2.0 ± 0.3 
SNC19 Putative novel human serine protease mapping to chr. 11q24-25 1.9 ± 0.2 
β-COP Golgi transport protein, component of COTI complex 1.8 ± 0.02 
Cytokine and cytokine-induced   
Vascular endothelial growth factor (VEGF) Stimulates endothelial cell proliferation and angiogenesis 2.8 ± 0.9 
VEGF-related protein [VRP] FLT4 ligand, VEGF family protein 2.1 ± 0.4 
Interferon-induced Mr 17,000 protein Precursor of 15 kDa protein homologous to ubiquitin 1.8 ± 0.2 
Development and differentiation   
Keratin 17 Soft epithelial keratin 9 (e.g., hair follicle) 3.8 ± 1.5 
B4-2 protein Proline-rich natural killer cell protein 2.6 ± 0.8 
Keratin 19 Intermediate filament protein 2.5 ± 0.7 
Iroquois class homeodomain protein IRX-2a Transcription factor involved in embryonic patterning, regionalization 2.3 ± 0.4 
Polycystic kidney disease-1 [PKD1] Component of cadherin-catenin complex, endothelial survival 2.0 ± 0.4 
Cancellous bone osteoblast mRNA expressed in osteoblasts, function unknown 2.0 ± 0.1 
SM22α homologue [TAGLN2] Marker of differentiated smooth muscle (SM)-like cells 1.7 ± 0.2 
Transcriptional regulation   
RIP140 Nuclear receptor-interacting protein, transcriptional coactivator 2.1 ± 0.1 
hkf-1 Novel zinc finger protein isolated from a brain cDNA library 2.1 ± 0.0 
DGS-I DiGeorge (velocardiofacial) syndrome candidate gene 2.0 ± 0.45 
General cellular metabolism   
Lactate dehydrogenase-A [LDH-A] Enzyme involved in anaerobic glycolysis 4.1 ± 1.0 
Phosphoglycerate kinase [PGK1] Glycolytic enzyme, induced by hypoxia-inducible factor HIF-1 4.0 ± 1.4 
Hexokinase-1 Early glucose metabolic enzyme 2.2 ± 0.3 
Glucosylceramidase precursor Degradation of GlcCer, mutated in Gaucher’s disease 2.0 ± 0.4 
Phosphoglycerate mutase 1 [PGAM1] Late glycolytic pathway enzyme 1.7 ± 0.25 
Cytoskeletal and structural proteins   
Ezrin-radixin-moesin phosphoprotein 50 [EBP50] PDZ phosphoprotein, linkage of cell membrane to cytoskeleton 3.8 ± 1.0 
p16-Arc [ARC16] Arp 2/3 complex subunit, control of actin polymerization 1.8 ± 0.1 
Miscellaneous and unknown function   
XAP-5 Unknown function 3.1 ± 0.7 
OriP binding protein [OBP1] Binds to Epstein Barr virus replication origin 2.1 ± 0.2 
JTV-1 Gene overlapping PMS2, function unknown 1.9 ± 0.2 
MAC30 (3′ end) Meningioma expressed protein 1.9 ± 0.2 
Sm-like (CaSm) Cancer-associated Sm motif-like domain protein 1.7 ± 0.2 
Table 4

Genes whose expression is decreased in [HGF/SF+ADR]-treated cells, relative to ADR alone

Gene nameFunctionRatio
DNA damage response   
P glycoprotein 3/MDR3 [PGY3] Homologue of multidrug resistance protein MDR-1, drug transport 0.51 ± 0.07 
Topoisomerase binding protein-1 [TOPBP1] BRCT domain protein, binds DNA topoisomerase IIB 0.61 ± 0.05 
Cell cycle regulation   
 c-Myc Proto-oncogene, functions in growth, differentiation, apoptosis 0.41 ± 0.04 
CIP4 (cdc42-interacting protein) Interacts with Wiskott-Aldrich protein, localized in cytoskeleton 0.42 ± 0.08 
ras inhibitor (3′ end) Effector or regulator of H-Ras activity 0.60 ± 0.07 
Signal transduction-related   
Mr180,000 transmembrane PLA2 receptor Receptor for secretory phospholipases A2, internalizes PLA2 0.51 ± 0.05 
Protein tyrosine phosphatase PTPN2 Also known as PT PTP (T cell protein tyrosine phosphatase) 0.57 ± 0.17 
 Proto-oncogene c-mer [MERTK] Member of Axl subfamily of receptor tyrosine kinases 0.57 ± 0.10 
Protein serine/threonine kinase STK2 Homologue of cell cycle regulatory kinase NIMA 0.60 ± 0.05 
51C [INPPL1] Inositol polyphosphate-5′-phosphatase-like (also known as SHIP-2) 0.61 ± 0.10 
Apoptosis-related   
CD40L receptor Receptor for CD154, member of TNF death receptor family 0.57 ± 0.08 
Protein and RNA metabolism   
Human Gu protein RNA helicase, member of DEXD box family, target of adriamycin 0.46 ± 0.01 
Cathepsin K precursor Lysosomal acid cysteine protease, mediates proteolysis of bone 0.49 ± 0.10 
Cytokine and cytokine-induced   
B94 TNF-induced gene product, unknown function 0.56 ± 0.07 
Tazarotene-induced gene 2 [TIG2] Novel retinoid-responsive gene, deficient in psoriatic skin 0.57 ± 0.02 
IGF-1 (somatomedin-C) Insulin-like growth factor-1 0.58 ± 0.02 
FGF-7 (fibroblast growth factor-7) Also known as keratinocyte growth factor, epithelial-specific growth factor 0.59 ± 0.07 
Development and differentiation   
 None   
Transcriptional regulation   
 None   
General cellular metabolism   
 None   
Cytoskeletal and structural proteins   
S100A9 (calgranulin B) Secretory protein, ? roles in inflammation, eicosanoid metabolism 0.42 ± 0.25 
Human triadin Integral membrane protein, binds calsequestrin 0.58 ± 0.16 
Vascular cell adhesion molecule VCAM1 Ig superfamily, interacts with α-4 integrins, cell trafficking 0.58 ± 0.07 
Ankyrin G Axon nodal protein involved in assembly of specialized structures 0.59 ± 0.13 
Miscellaneous and unknown function   
hORC2L (origin recognition complex) Putative replication initiation protein 0.58 ± 0.05 
CHD2 Chromodomain helicase DNA-binding protein 2 0.60 ± 0.13 
Rip-1 (Rev-interacting protein) Interacts with HIV Rev protein, ? function 0.67 ± 0.01 
Gene nameFunctionRatio
DNA damage response   
P glycoprotein 3/MDR3 [PGY3] Homologue of multidrug resistance protein MDR-1, drug transport 0.51 ± 0.07 
Topoisomerase binding protein-1 [TOPBP1] BRCT domain protein, binds DNA topoisomerase IIB 0.61 ± 0.05 
Cell cycle regulation   
 c-Myc Proto-oncogene, functions in growth, differentiation, apoptosis 0.41 ± 0.04 
CIP4 (cdc42-interacting protein) Interacts with Wiskott-Aldrich protein, localized in cytoskeleton 0.42 ± 0.08 
ras inhibitor (3′ end) Effector or regulator of H-Ras activity 0.60 ± 0.07 
Signal transduction-related   
Mr180,000 transmembrane PLA2 receptor Receptor for secretory phospholipases A2, internalizes PLA2 0.51 ± 0.05 
Protein tyrosine phosphatase PTPN2 Also known as PT PTP (T cell protein tyrosine phosphatase) 0.57 ± 0.17 
 Proto-oncogene c-mer [MERTK] Member of Axl subfamily of receptor tyrosine kinases 0.57 ± 0.10 
Protein serine/threonine kinase STK2 Homologue of cell cycle regulatory kinase NIMA 0.60 ± 0.05 
51C [INPPL1] Inositol polyphosphate-5′-phosphatase-like (also known as SHIP-2) 0.61 ± 0.10 
Apoptosis-related   
CD40L receptor Receptor for CD154, member of TNF death receptor family 0.57 ± 0.08 
Protein and RNA metabolism   
Human Gu protein RNA helicase, member of DEXD box family, target of adriamycin 0.46 ± 0.01 
Cathepsin K precursor Lysosomal acid cysteine protease, mediates proteolysis of bone 0.49 ± 0.10 
Cytokine and cytokine-induced   
B94 TNF-induced gene product, unknown function 0.56 ± 0.07 
Tazarotene-induced gene 2 [TIG2] Novel retinoid-responsive gene, deficient in psoriatic skin 0.57 ± 0.02 
IGF-1 (somatomedin-C) Insulin-like growth factor-1 0.58 ± 0.02 
FGF-7 (fibroblast growth factor-7) Also known as keratinocyte growth factor, epithelial-specific growth factor 0.59 ± 0.07 
Development and differentiation   
 None   
Transcriptional regulation   
 None   
General cellular metabolism   
 None   
Cytoskeletal and structural proteins   
S100A9 (calgranulin B) Secretory protein, ? roles in inflammation, eicosanoid metabolism 0.42 ± 0.25 
Human triadin Integral membrane protein, binds calsequestrin 0.58 ± 0.16 
Vascular cell adhesion molecule VCAM1 Ig superfamily, interacts with α-4 integrins, cell trafficking 0.58 ± 0.07 
Ankyrin G Axon nodal protein involved in assembly of specialized structures 0.59 ± 0.13 
Miscellaneous and unknown function   
hORC2L (origin recognition complex) Putative replication initiation protein 0.58 ± 0.05 
CHD2 Chromodomain helicase DNA-binding protein 2 0.60 ± 0.13 
Rip-1 (Rev-interacting protein) Interacts with HIV Rev protein, ? function 0.67 ± 0.01 
Table 5

Genes whose expression is altered in HGF/SF-treated cells, relative to untreated control cells

Gene nameFunctionRatio
Gene products increased in HGF/SF-treated cells   
Interleukin-8 (IL-8) Proinflammatory & angiogenic cytokine, neutrophil chemotaxis 1.6 ± 0.01 
(Clone ch13 lambda 7) α-tubulin Microtubule protein 1.6 ± 0.02 
Cyctochrome c oxidase VIIc subunit [COX7C] Subunit of COX holoenzyme, mitochondrial energy production 1.5 ± 0.01 
Tubulin β-1 chain Microtubule protein 1.5 ± 0.01 
Gene products decreased in HGF/SF-treated cells   
51C [INPPL1] Inositol polyphosphate-5′-phosphatase-like (aka. SHIP-2) 0.43 ± 0.0 
il-TMP (intestine/liver tetraspan protein) Integral membrane protein, density-dependent growth regulation 0.57 ± 0.13 
Integrin α-8 subunit, 3′ end Integrin expressed in developing brain and mesangial cells 0.58 ± 0.02 
Topoisomerase IIB [TOP2B] Nuclear enzyme involved in DNA replication and transcription 0.65 ± 0.01 
Corticotrophin releasing factor receptor precursor Mediates release of corticotrophin (ACTH) 0.69 ± 0.01 
Osteoblast mRNA for ostenidogen Basement membrane component, entactin/nidogen family 0.69 ± 0.05 
Janus kinase 1 [JAK1] Mediates tyrosine phosphorylation of STAT1 0.70 ± 0.01 
MutS homologue 3 [MSH3] DNA mismatch repair enzyme 0.72 ± 0.01 
Gene nameFunctionRatio
Gene products increased in HGF/SF-treated cells   
Interleukin-8 (IL-8) Proinflammatory & angiogenic cytokine, neutrophil chemotaxis 1.6 ± 0.01 
(Clone ch13 lambda 7) α-tubulin Microtubule protein 1.6 ± 0.02 
Cyctochrome c oxidase VIIc subunit [COX7C] Subunit of COX holoenzyme, mitochondrial energy production 1.5 ± 0.01 
Tubulin β-1 chain Microtubule protein 1.5 ± 0.01 
Gene products decreased in HGF/SF-treated cells   
51C [INPPL1] Inositol polyphosphate-5′-phosphatase-like (aka. SHIP-2) 0.43 ± 0.0 
il-TMP (intestine/liver tetraspan protein) Integral membrane protein, density-dependent growth regulation 0.57 ± 0.13 
Integrin α-8 subunit, 3′ end Integrin expressed in developing brain and mesangial cells 0.58 ± 0.02 
Topoisomerase IIB [TOP2B] Nuclear enzyme involved in DNA replication and transcription 0.65 ± 0.01 
Corticotrophin releasing factor receptor precursor Mediates release of corticotrophin (ACTH) 0.69 ± 0.01 
Osteoblast mRNA for ostenidogen Basement membrane component, entactin/nidogen family 0.69 ± 0.05 
Janus kinase 1 [JAK1] Mediates tyrosine phosphorylation of STAT1 0.70 ± 0.01 
MutS homologue 3 [MSH3] DNA mismatch repair enzyme 0.72 ± 0.01 
1
Frisch S. M., Francis H. Disruption of epithelial cell-matrix interactions induces apoptosis.
J. Cell Biol.
,
124
:
619
-626,  
1994
.
2
Amicone L., Spagnoli F. M., Spath G., Giordano S., Tommasini C., Bernardini S., De Luca V., Della Roca C., Weiss M. C., Comoglio P. M., Tripoldi M. Transgenic expression in the liver of truncated Met blocks apoptosis and permits immortalization of hepatocytes.
EMBO J.
,
16
:
495
-503,  
1997
.
3
Bardelli A., Longatti P., Albero D., Goruppi S., Schneider C., Ponzetto C., Comoglio P. M. HGF receptor associates with the anti-apoptotic protein BAG-1 and prevents cell death.
EMBO J.
,
15
:
6205
-6212,  
1996
.
4
Rosen E. M., Lamszus K., Polverini P. J., Fan S., Goldberg I. D. Scatter factor as a tumor angiogenesis factor Rubyani G. eds. .
Angiogenesis in Healing and Disease. Basic Mechanisms and Clinical Applications
,
:
145
-156, Marcel Dekker New York  
1999
.
5
Fan S., Wang J-A., Yuan R-Q., Rockwell S., Andres J., Zlatapolskiy A., Goldberg I. D., Rosen E. M. Scatter factor protects epithelial and carcinoma cells against apoptosis induced by DNA-damaging agents.
Oncogene
,
17
:
131
-141,  
1998
.
6
Fan S., Ma Y. X., Wang J-A., Yuan R-Q., Meng Q., Laterra J. J., Goldberg I. D., Rosen E. M. The cytokine scatter factor inhibits apoptosis and enhances DNA repair by a common mechanism involving signaling through phosphatidylinositol 3′ kinase.
Oncogene
,
19
:
2212
-2223,  
2000
.
7
Bowers D. C., Fan S., Walter K., Abounder R., Williams J. A., Rosen E. M., Laterra J. Scatter factor/hepatocyte growth factor activates AKT and protects against cytotoxic death in human glioblastoma cells via PI3-kinase-dependent pathways.
Cancer Res.
,
60
:
4277
-4283,  
2000
.
8
Datta S. R., Dudek H., Tao X., Masters S., Fu H., Gotoh Y., Greenberg M. E. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery.
Cell
,
91
:
231
-241,  
1997
.
9
Cardone M. H., Roy N., Stennicke H. R., Salvesen G. S., Franke T. F., Stanbridge E., Frisch S., Reed J. C. Regulation of cell death protease caspase-9 by phosphorylation.
Science (Wash. DC)
,
282
:
1318
-1321,  
1998
.
10
Tian L., Nelson D. L., Stewart D. M. Cdc42-interacting protein 4 mediates binding of the Wiskott-Aldrich syndrome protein to microtubules.
J. Biol. Chem.
,
272
:
7854
-7861,  
2000
.
11
Alley M. C., Scudieco D. A., Monks A., Hursey M. L., Czerwinski M. J., Fine D. L., Abbott B. J., Mayo J. G., Shoemaker R. H., Boyd M. R. Feasibility of drug screening with panels of human tumor cell lines using a microculture tetrazolium assay.
Cancer Res.
,
48
:
589
-601,  
1988
.
12
Fan S., Wang J-A., Yuan R-Q., Ma Y. X., Meng Q., Goldberg I. D., Rosen E. M. BRCA1 as a human prostate tumor suppressor: modulation of proliferation, damage responses, and expression of regulatory proteins.
Oncogene
,
16
:
3069
-3083,  
1998
.
13
Fan S., Wang J-A., Yuan R-Q., Goldberg I. D., Rosen E. M. Co-ordinate down-regulation of BRCA1, BRCA2, Rad51, and p300 during the response to damage in human prostate cancer cell lines.
Prostate
,
40
:
37
-49,  
1999
.
14
Habib T., Hejna J. A., Moses R. E., Decker S. J. Growth factors and insulin stimulate tyrosine phosphorylation of the 51C/SHIP2 protein.
J. Biol. Chem.
,
273
:
18605
-18609,  
1998
.
15
Wu X., Senechal K., Neshat M. S., Whang Y. E., Sawyers C. L. The PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway.
Proc. Natl. Acad. Sci. USA
,
95
:
15587
-15591,  
1998
.
16
Aspenstrom P. A Cdc42 target protein with homology to the non-kinase domain of FER has a potential role in regulating the actin cytoskeleton.
Curr. Biol.
,
7
:
479
-487,  
1997
.
17
Savitsky K., Bar-Shira A., Gilad S., Rotman G., Ziv Y., Vanagaite L., Tagle D. A., Smith S., Uziel T., Sfez S., et al A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science (Wash. DC)
,
268
:
1749
-1753,  
1995
.
18
Prasad R., Dianov G. L., Bohr V. A., Wilson S. H. FEN1 stimulation of DNA polymerase β mediates an excision step in mammalian long patch base excision repair.
J. Biol. Chem.
,
275
:
4460
-4466,  
2000
.
19
Ibraghimov-Beskrovnaya O., Dackowski W. R., Foggensteiner L., Coleman N., Thiru S., Petry L. R., Burn T. C., Connors T. D., Van Raay T., Bradley J., Qian F., Onuchic L. F., Watnick T. J., Piontek K., Hakim R. M., Landes G. M., Germino G. G., Sandford R., Klinger K. W. Polycystin: in vitro synthesis, in vivo tissue expression, and subcellular localization identifies a large membrane-associated protein.
Proc. Natl. Acad. Sci. USA
,
94
:
6397
-6402,  
1997
.
20
Huan Y., van Adelsberg J. Polycystin-1, the PKD1 gene product, is in a complex containing E-cadherin and the catenins.
J. Clin. Investig.
,
104
:
1459
-1468,  
1999
.
21
Kim K., Drummond I., Ibraghimov-Beskrovnaya O., Klinger K., Arnaout M. A. Polycystin 1 is required for the structural integrity of blood vessels.
Proc. Natl. Acad. Sci. USA
,
97
:
1731
-1736,  
2000
.
22
Boletta A., Qian F., Onuchic L. F., Bhunia A. K., Phakdeekitcharoen B., Hanaoka K., Guggino W., Monaco L., Germino G. G. Polycystin-1, the gene product of PKD1, induces resistance to apoptosis and spontaneous tubulogenesis in MDCK cells.
Mol. Cell
,
6
:
1267
-1273,  
2000
.
23
Yamane K., Kawabata M., Tsuruo T. A DNA-topoisomerase-II-binding protein with eight repeating regions similar to DNA-repair enzymes and to a cell-cycle regulator.
Eur. J. Biochem.
,
250
:
794
-799,  
1997
.
24
Yamane K., Tsuruo T. Conserved BRCT regions of TopBP1 and of the tumor suppressor BRCA1 bind strand breaks and termini of DNA.
Oncogene
,
18
:
5194
-5203,  
1999
.
25
Cornarotti M., Tinelli S., Willmore E., Zunino F., Fisher L. M., Austin C. A., Capranico G. Drug sensitivity and sequence specificity of human recombinant DNA topisomerases IIα (p170) and Iβ (p180).
Mol. Pharmacol.
,
50
:
1463
-1471,  
1996
.
26
Bodley A., Liu L. F., Israel M., Seshadri R., Koseki Y., Giuliani F. C., Kirschenbaum S., Silber R., Potmesil M. DNA topoisomerase II-mediated interaction of doxorubicin and daunorubicin congeners with DNA.
Cancer Res.
,
49
:
5969
-5978,  
1989
.
27
Valdez B. C., Henning D., Busch R. K., Woods K., Flores-Rozas H., Hurwitz J., Perlaky L., Busch H. A nucleolar RNA helicase recognized by autoimmune antibodies from a patient with watermelon stomach disease.
Nucleic Acids Res.
,
24
:
1220
-1224,  
1996
.
28
Zhu K., Henning D., Iwakuma T., Valdez B. C., Busch H. Adriamycin inhibits human RH II/Gu RNA helicase activity by binding to its substrate.
Biochem. Biophys. Res. Commun.
,
266
:
361
-365,  
1999
.
29
Habib T., Hejna J. A., Moses R. E., Decker S. J. Growth factors and insulin stimulate tyrosine phosphorylation of the 51C/SHIP2 protein.
J. Biol. Chem.
,
273
:
18605
-18609,  
1998
.
30
Xiao G. H., Jeffers M., Bellacosa A., Mitsuuchi Y., Vande Woude G. F., Testa J. R. Anti-apoptotic signaling by hepatocyte growth factor/Met via the phosphatidylinositol 3-kinase/Akt and mitogen-activated protein kinase pathways.
Proc. Natl. Acad. Sci. USA
,
98
:
247
-252,  
2001
.
31
Taylor V., Wong M., Brandts C., Reilly L., Dean N. M., Cowsert L. M., Moodie S., Stokoe D. 5′-Phospholipid phosphatase SHIP-2 causes protein kinase B inactivation and cell cycle arrest in glioblastoma cells.
Mol. Cell. Biol.
,
20
:
6860
-6871,  
2000
.
32
Tiganis T., Kemp B. E., Tonks N. K. The protein-tyrosine phosphatase TCPTP regulates epidermal growth factor receptor-mediated and phosphatidylinositol 3- kinase-dependent signaling.
J. Biol. Chem.
,
274
:
27768
-27775,  
1999
.
33
Packham G., Porter C. W., Cleveland J. L. c-Myc induces apoptosis and cell cycle progression by separable, yet overlapping, pathways.
Oncogene
,
13
:
461
-469,  
1996
.
34
Lenahan M. K., Ozer H. L. Induction of c-myc mediated apoptosis in SV40-transformed rat fibroblasts.
Oncogene
,
12
:
1847
-1854,  
1996
.