To determine whether N-methyl-N-nitrosourea (MNU) can induce malignant transformation of human fibroblasts and whether O6-methylguanine(O6-MeG) is involved, two populations of infinite life span cell strain MSU-1.1, differing only in level of O6-alkylguanine-DNA alkyltransferase, were treated with MNU and assayed for focus formation. MNU caused a dose-dependent increase in the frequency of foci in both groups, but the dose required was significantly lower in the cells lacking O6-alkylguanine-DNA alkyltransferase,indicating that O6-MeG was causally involved. Of 35 independent focus-derived strains assayed for p53 transactivating ability, one was heterozygous, and 15 had lost all activity, 1 of 7 from untreated cells and 14 of 27 from MNU-treated cells. These results indicate that loss of p53 is not required for focus formation but may permit cells to form foci. Of 35 strains assayed for tumorigenicity, 10 formed malignant tumors with a short latency, all 10 lacked wild-type p53. The p53 heterozygous strain also formed tumors after a long latency, and the cells from those tumors lacked p53 transactivating ability. None of the 19 strains with wild-type p53 formed tumors. These results indicate that although loss of p53 is not sufficient for malignant transformation of MSU-1.1 cells, it may be necessary. Analysis of the p53 cDNA from several focus-derived strains lacking p53 activity revealed that each contained the same mutation, an A to G transition at codon 215,resulting in a change from serine to glycine. Because p53 can be inactivated by mutations at any one of a large number of sites, finding the same mutation in each strain assayed strongly suggests that the target population included a subpopulation of cells with this codon 215 mutation in one allele. Further analysis showed that all 15 focus-derived cells strains that lacked p53 transactivating activity contained two alleles, each with the same codon 215 mutation, and that the mutant allele in the heterozygous strain also had that mutatation. Analysis of the p arm of chromosome 17 of the focus-derived cell strains containing the codon 215 mutation revealed seven patterns of loss of heterozygosity,evidence of mitotic homologous recombination. Similar analysis of a separate series of cell strains, derived from foci induced by cobalt-60, revealed four patterns of loss of heterozygosity, only two of which had been found with those induced by MNU. These data suggest that homologous mitotic recombination, induced by O6-MeG in a subpopulation of cells heterozygous for p53 mutation, rendered the cells homozygous for loss of p53 activity, that this allowed the cells to form foci, and that although loss of p53 is not sufficient for malignant transformation, it predisposes cells to acquire the additional changes needed for such transformation.

It is generally accepted that transformation of normal cells into tumorigenic cells involves mutations in critical genes that control cellular proliferation, and that mutations occur as the result of replication of a DNA template containing endogenous or exogenous damage. An important area in cancer research is determination of the genetic change(s) associated with this transformation. As a model system for such studies, McCormick and colleagues (1)developed and characterized the infinite life span, near-diploid,karyotypically stable, nontumorigenic human fibroblast cell strain MSU-1.1. MSU-1.1 cells can be transformed into tumorigenic cells by transfection of a highly overexpressed H-Ras(2) or N-Ras(3) oncogene or by a single exposure to BPDE4(4) or ionizing radiation (5, 6). Focus formation is used as the assay for detecting transformed cells. Analysis shows that Ras oncogene-transformed cell strains derived from prominent foci and expressing Ras at a high level form malignant tumors in athymic mice with a short latency. These Ras-transformed MSU-1.1 cells, even those derived from malignant tumors, exhibited no change in karyotype (2, 3) and recently were shown to retain wild-type p53 transactivating ability.5In contrast, MSU-1.1 cell strains derived from foci induced by BPDE(5) or 60Co γ radiation(6) that were found to form tumors in athymic mice had lost p53 transactivating ability. What is more, these cell strains showed changes in karyotype (4, 5).

The product of the p53 gene is a potent transcription factor involved in the transcriptional control of genes that play critical roles in cell cycle control, DNA repair, and apoptosis (see Refs7, 8) and is inactivated in >50% of all human tumors(9, 10). In addition, inactivation of p53 has resulted in the progression of mammalian fibroblasts in culture to a transformed phenotype (11, 12).

Alkylating agents covalently attach alkyl groups to cellular macromolecules. Reaction of a methylating agent with DNA results in the formation of up to 13 different adducts (13), with methylation of the O6 position of guanine being the most potentially mutagenic lesion(14, 15, 16), inducing primarily G:C to A:T transitions(16, 17, 18). Repair of O6-MeG in human cells is accomplished primarily through the action of AGT, which transfers the methyl group from O6-MeG in DNA to an interior cysteine residue of AGT (19, 20, 21) and inactivates the AGT protein. O6-BzG can serve as a substrate analogue for AGT (22), resulting in the transfer of the benzyl group from O6-BzG to the same cysteine of AGT involved in removal of the methyl group from O6-MeG. Therefore, cells in culture can be depleted of AGT by addition of O6-BzG to the medium, allowing one to manipulate the capacity of the cells to repair O6-MeG and therefore to determine the cellular effects of this particular adduct.

The present study asked four questions: (a) whether the simple methylating agent MNU can transform MSU-1.1 cells to focus formation; (b) whether O6-MeG plays a causal role in this transformation; (c) whether MNU treatment results in the malignant transformation of MSU-1.1 cells; and (d) whether mutations in the p53 gene play a role in focus formation and/or transformation. For this purpose, two populations of MSU-1.1 cells were prepared, one group that was depleted of AGT activity by pretreatment with O6-BzG and another not depleted, exposed to MNU, and assayed for focus formation. Representative focus-derived cell strains were assayed for p53 transactivating ability and for tumorigenicity. A single, brief exposure of the cells to MNU induced a dose-dependent increase in focus formation, and pretreatment with O6-BzG significantly decreased the dose of MNU needed to induce such foci, indicating that O6-MeG is the lesion principally responsible for this transformation. A substantial fraction of the focus-derived cell strains formed tumors in athymic mice, and all but one of these strains lacked transactivating ability. The latter was heterozygous for p53 transactivation ability, but the cells from the tumors produced by that strain contained two mutant p53 alleles. Evidence suggests that the MSU-1.1 population used for these studies contained a very low frequency of cells that were heterozygous for a specific p53 mutation, and that MNU-induced homologous mitotic recombination generated cells with that mutation in both alleles. The data also suggest that loss of p53 transactivating ability allows these cells to form foci. The results indicate that loss of p53 transactivating ability is not sufficient to cause malignant transformation of MSU-1.1 cells, but they strongly suggest that it greatly facilitates such transformation.

Cell Culture.

Unless otherwise noted, the MSU-1.1 cells and all focus-derived cell strains were cultured in Eagle’s MEM (pH 7.2; Life Technologies,Gaithersburg, MD), supplemented with 0.2 mml-aspartic acid, 0.2 mml-serine,1.0 mm sodium pyruvate, penicillin (100 U/ml), streptomycin(100 μg/ml), hydrocortisone (1 μg/ml), and 10% supplemented calf serum (HyClone, Logan, UT; complete medium). Cells were grown in a 5% CO2 humidified incubator and subcultured before they reached confluence.

Carcinogen Treatment.

Cells to be treated were plated in complete medium at 104 cells/cm2. After ∼16 h, the medium was removed, and the cells were rinsed twice with PBS and covered with Eagle’s MEM lacking serum and buffered with 20 mm HEPES (pH 7.25; treatment medium). MNU (Sigma, St. Louis, MO) was dissolved in anhydrous DMSO immediately before use. The appropriate amount of the MNU-DMSO solution was added to each dish to give the designated concentrations. The total concentration of DMSO in the medium was <0.5%. Control populations were treated the same way but received DMSO only. The cells were incubated for 30 min at 37°C in a humidified incubator with 5% CO2, after which the treatment medium was removed, the cells were rinsed twice with PBS, and complete medium was added.

Elimination of AGT Activity Using O6-BzG.

O6-BzG was dissolved in DMSO at a concentration of 25 mm and stored at −20°C under nitrogen gas. For the population of cells to be depleted of AGT by O6-BzG, the compound was added at a final concentration of 25 μm 2 h before treatment with MNU. For this population, O6-BzG (25 μm)was also added to the treatment medium, and at the end of the MNU treatment, these cells were refed with complete medium containing O6-BzG. After 48 h, the medium for these cells and also for the other population was changed to complete medium lacking O6-BzG.

Cytotoxicity Assay.

Immediately after treatment, cells were rinsed with PBS, dislodged with trypsin, suspended in complete medium with or without O6-BzG, and plated at densities designed to yield ∼40 clones per 100-mm-diameter dish. At a minimum,three dishes were used per group. All cells were refed with complete medium at 48 h after treatment and after 1 week. After 2 weeks,the cells were stained with crystal violet. The clones were counted,and the surviving fraction was calculated using the cloning efficiency of the treated cells and expressed as a fraction of the cloning efficiency of untreated cells.

Focus Assay.

The focus assay was performed essentially as described(6). Briefly, cells to be assayed for the ability to form foci were kept in exponential growth after MNU treatment, subculturing as needed. After 8 days, the cells were dislodged with trypsin, pooled,and suspended in complete medium supplemented with 20 mmHEPES (pH 7.5) and with the serum level reduced to 0.5% supplemented calf serum. For each dose, 106 cells were assayed at 5 × 104 cells per 100-mm-diameter dish. Cells were refed weekly with this medium. After 4–6 weeks, the dishes were scanned for foci, i.e., densely piled, clonal proliferations of cells exhibiting an altered morphology on a confluent monolayer, visible when the dishes were illuminated from beneath with a focused beam of light. Representative foci were isolated using trypsin and subcloned twice to eliminate background,non-focus-forming cells. The remaining cells in the dishes used to assay for focus formation were fixed with methanol and stained with methylene blue, and the foci were counted to determine the frequency.

p53 Transactivation Ability Assay.

A transgenic yeast assay designed by Schärer and Iggo(23) was used essentially as described (24)with the exceptions noted. Briefly, total RNA was isolated from the cell strain to be assayed using the RNAzol B method (TEL-TEST,Friendswood, TX) according to the manufacturers’ instructions. RT of mRNA was performed using 2.5 μg of total RNA denatured at 65°C for 15 min in a 20-μl volume containing 50 mm Tris-HCl (pH 8.3), 75 mm KCl, 3 mmMgCl2, 10 mm DTT, a 500 nm concentration of each dNTP, 400 ng of oligo(dT)12–18, and 40 units of murine leukemia virus reverse transcriptase (Life Technologies) and incubated at 37°C for 90 min. The p53-specific primers used for PCR were described previously (23). The RT reaction product was diluted 1:10 in water, and 5 μl were used as a template in a 50-μl reaction containing 10 mm KCl, 6 mm(NH4)2SO4,20 mm Tris-HCl (pH 8.2), 2 mm MgCl2, 0.1% Triton X-100, 10 μg/ml BSA, a 400 nm concentration of each dNTP, a 400 nm concentration of each primer,and 2.5 units of Pfu polymerase (Stratagene, La Jolla, CA). The PCR reaction was carried out in a HyBaid (Woodbridge, NJ)thermocycler for 40 cycles (94°C for 30 s, 55°C for 30 s,and 72°C for 90 s), and the amplified p53 cDNA product was purified using a silica gel column (Qiagen, Valencia, CA). A gapped plasmid carrying a selectable marker (leucine autotrophy) and the purified PCR product were electroporated into yeast using the Cell-Porator system (Life Technologies) set at 400 V, 10 μF, and low resistance. Yeast that incorporated a p53 cDNA into the gapped plasmid by homologous recombination were selected. These yeast cells also contained a resident plasmid carrying a p53-responsive reporter gene. Yeast cells that incorporate p53 cDNA from a wild-type allele of the human cells can be identified by the expression of this reporter gene, which requires wild-type p53 for transcriptional activation. Because of its design, the assay can only detect inactivating mutations located within exons 4–10, but it offers the advantage of assaying each allele separately and, therefore, can determine that a cell is heterozygous for p53. However, the assay cannot reveal that a cell is hemizygous for p53.

Nucleotide Sequencing of the p53 Gene.

The sequence of the p53 RT-PCR product was determined by automated dye terminator sequencing (Applied Biosystems Division,Perkin-Elmer, Foster City, CA). The primers, specifically designed to bind to p53 cDNA and used for sequencing, are shown in Table 1 .

Mismatch Amplification Mutation Assay.

The protocol used was essentially that of Cha et al.(25). Briefly, this protocol uses a primer designed to amplify a specific mutant sequence but not the wild-type sequence. In our case, the primers were designed to amplify DNA containing the codon 215 mutation. The primers (written 5′ to 3′) used were primer 1(control), CCTGGGCATCCTTGAGTT; primer 2 (control), TCACAGCACATGACG; and primer 3 (mismatch), CAGAAACACTTTTCGACAGG. The mismatch primer was designed so that the two terminal bases at the 3′ end would not bind to the sequence of wild-type p53 and, therefore, would not amplify the wild-type p53 sequence. In contrast, the terminal base of the mismatch primer was able to bind to the mutant p53 sequence; therefore, amplification was possible. PCR was carried out using 100 ng of purified p53 cDNA from the cell strain to be assayed in a 50-μl reaction containing 50 mm Tris-Cl (pH 9.0), 20 mm(NH4)2SO4,1.5 mm MgCl2, a 400 nm concentration of each dNTP, an 80 nm concentration of each primer, and 2.5 units of Tfl polymerase (Epicentre Technologies, Madison, WI) using a PCR profile of 94°C for 3 min followed by 25 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 60 s). Each cDNA template was used in two reactions, one containing the control primers,and another containing the mismatch primer in place of control primer 1. Results were analyzed by electrophoresis of 5 μl of PCR product on a 1% agarose gel containing 0.5 μg/μl EtBr and visualizing the DNA with UV light.

Restriction Enzyme Analysis.

Analysis of p53 RT-PCR product involved digestion of 1 μg of purified p53 coding sequence in a 20 μl reaction volume using NlaIII restriction enzyme (New England Biolabs,Beverly, MA) following the manufacturers’ recommended procedure. The entire reaction was resolved on a 3% agarose gel containing 0.5μg/ml EtBr, and the DNA was visualized using UV light.

Southern Blotting Analysis.

DNA was isolated using the Puregene kit (Gentra Systems, Research Triangle Park, NC). DNA (15 μg) was digested with the designated restriction enzyme (Boehringer Mannheim, Indianapolis, IN) (5 U/μg DNA) following manufacturers’ instructions. The reactions were carried out at 37°C for 16 h, and the products were purified by phenol:chloroform extraction. Purified digest (10 μg) was resolved on a 1% agarose gel by electrophoresis at 35 V (constant) for 16–18 h. DNA was transferred to a Zeta Probe membrane (Bio-Rad, Hercules, CA),crosslinked using the UV Stratalinker 2400 (Stratagene, La Jolla, CA),and analyzed. For RFLP analysis, probe pUC10–41 (American Type Culture Collection, Rockville, MD), which is homologous to D17S71, and pYNZ22.1(ATCC, Rockville MD), which is homologous to D17S5, were used. To determine the number of p53 alleles, p53 DNA(RT-PCR product) was used as a probe for p53, and an intron 1 DNA sequence of the HPRT gene (26) was used as a probe for the HPRT gene, which served as a loading control. The random primer labeling of probes and hybridization conditions used were as described (27). Blots were exposed to PhosphoImaging cassettes, and the data were analyzed using Image Quant 3.1 software (Molecular Dynamics, Sunnyvale, CA).

Microsatellite Analysis.

The sequences for the primer pairs (Whitehead Institute database) used to amplify the region surrounding the microsatellite repeats are given in Table 2 . PCR was performed using 250 ng genomic DNA in a 25 μl mixture containing: 50 mm Tris-Cl (pH 9.0); 20 mm(NH4)2SO4;1.5 mm MgCl2; 400 nm of each dNTP; 150 ng of each primer; and 2.5 U Tfl polymerase(Epicentre Technologies, Madison, WI). Amplification was performed using a HyBaid thermocycler (Woodbridge, NJ) and using a PCR profile of 94°C for 3 min, followed by 35 cycles of 94°C for 10 s, X°for 10 s and 72°C for 15 s. The value “X” depended upon the specific primer set used. These are listed in Table 2. The PCR products were analyzed by 15% nondenaturing PAGE [100 V (constant)for 16–18 h]. The bands were stained with EtBr and visualized using UV illumination.

Tumorigenicity Assay.

The tumorigenicity assay, using s.c. injection of 106 cells per site into athymic BALB/c mice, was performed as described (6). Tumors were measured weekly using calipers and removed when they reached 1 cm in diameter. A portion of each tumor was returned to culture, whereas the remainder was fixed with formalin and prepared for histological evaluation. Slides of tumor tissue were examined to determine the histological classification of the tumor.

Evidence that O6-MeG Is the Principal Lesion Involved in the Transformation of MSU-1.1 Cells to Focus Formation by MNU.

To determine whether MNU can transform MSU-1.1 cells into focus-forming cells and whether the O6-MeG lesion plays a causal role in this transformation, we prepared two populations of MSU-1.1 cells, i.e., one depleted of AGT activity by being treated with 25 μmO6-BzG for 2 h before MNU treatment and the other not receiving O6-BzG. These two populations were exposed to various doses of MNU for 30 min in medium containing or not containing O6-BzG. One set of cells was immediately assayed for cell survival. The rest of the cells were maintained in exponential growth for 7–8 days (expression period) and then assayed for the frequency of focus formation. In either case, the cells that had been depleted of AGT were maintained in medium containing O6-BzG for an additional 48 h. Such treatment reduces AGT protein in human fibroblasts to undetectable levels, and that AGT remains low for at least an additional 24 h after removal of O6-BzG from the medium(16). As shown in Fig. 1,A, with both sets of cells, there was a dose-dependent decrease in survival, but this was significantly greater in the cells depleted of AGT activity, indicating that O6-MeG is the principal cytotoxic adduct formed. The cells exhibited a corresponding dose-dependent increase in focus induction, and O6-BzG pretreatment significantly enhanced the frequency of this induction (Fig. 1 B).

Tumorigenic Potential of the Focus-derived Cell Strains.

Because our earlier studies showed that a significant proportion of unequivocally independent foci formed by MSU-1.1 cells treated with benzo(a)pyrene diol epoxide (4) or ionizing radiation (6) form malignant tumors in athymic mice, cells from representative MNU-induced foci were similarly assayed. Foci were isolated, subcloned twice to be sure that normal background cells had not been included, expanded to a population of ∼7 × 107 cells, and injected into mice as described(106 cells per site). The foci used for these assays were taken from experiments in which the frequency of foci was at least four times higher than background; the majority of them were from experiments yielding frequencies 6–30 times higher than the background frequencies. A total of 35 independent focus-derived cell strains were assayed for the ability to form tumors in athymic mice, 28 from MNU-treated populations and 7 from nontreated control populations. The nontumorigenic MSU-1.1 parental cells were also tested. The data for MSU-1.1 cells are shown in Table 3 . They included results from a large series of experiments over several years. As shown in Table 3, 10 of 35 strains (28.6%) formed tumors that reached a diameter of 1 cm in a relatively short period (6–16 weeks). One of these strains, MA0-1, was from a focus taken from an untreated population. An additional cell strain, MA2-1, derived from a focus from an MNU-treated group, gave rise to tumors after a somewhat longer period (11–31 weeks). All of the tumors were malignant.

p53 Status of the Focus-derived Cell Strains.

O’Reilly et al.(6) recently reported that 15 of 19 (79%) cell strains derived from foci induced by a single exposure of MSU-1.1 cells to cobalt-60 radiation showed loss of p53 transactivating function as determined by the yeast assay of Iggo and colleagues (23, 24). This same yeast assay showed that three of the eight cell strains derived from foci induced by BPDE treatment of MSU-1.1 cells assayed had lost p53 transactivation ability.5 Therefore, we used the yeast assay to test the 35 cell strains shown in Table 3 for p53 transactivating ability. Parental MSU-1.1 cells were also tested. The p53 status results are included in Table 3. Of the 28 strains derived from MNU-induced foci, 14 (50%) had lost all p53 transactivating ability. Ten of these 14 were strains that had proven able to produce tumors rapidly. Because the other four did not form tumors, loss of p53 activity is not sufficient to convert the cells into tumor-forming cells. One MNU-induced focus-derived strain, i.e., MA2-1, the one that produced tumors only after a relatively long latency, was heterozygous for p53 activity, but analysis of cells derived from a tumor formed by strain MA2-1 revealed that the tumor-derived cells no longer contained a wild-type p53 allele. Of the seven foci-derived strains from nontreated populations, only the one that formed tumors(MA0-1) had lost p53 transactivating ability (Table 3).

Nature of the Mutation in the p53 Gene.

Nucleotide sequencing of the coding region of the p53 gene from several representative cell strains that expressed only mutant p53 showed that each contained an A:T to G:C transition at the first position of codon 215, which changes the amino acid from serine to glycine. Finding a common mutation was highly unexpected,because each strain had been derived from a focus that developed in an independent population of cells treated with MNU, and the frequency of such foci was significantly higher than background. Furthermore, the coding region of p53 has hundreds of sites where a mutation can eliminate its transactivating function (7, 10). In addition, an A:T to G:C transition is not commonly induced by methylating agents (15, 17). This strongly suggested that the focus-derived strains that exhibited complete loss of p53 transactivating ability arose as the result of an effect of MNU on a subpopulation of cells in the target population that already contained the A:T to G:C transition at codon 215 in p53.

The A:T to G:C base change at codon 215 creates a recognition site for the restriction enzyme NlaIII. Therefore, we used restriction enzyme digestion and gel electrophoresis to rapidly screen for the presence of this specific base substitution in additional focus-derived cell strains that the yeast assay indicated were devoid of p53 transactivating ability. NlaIII restriction of wild-type p53 gives three fragments of lengths 477, 414, and 173 bp and five fragments <30 bp. The A:T to G:C transition at codon 215 results in the 173-bp fragment being further digested to yield fragments of 107 and 66 bp (see Fig. 2). Analysis using NlaIII digestion confirmed that all focus-derived cell strains that exhibited loss of wild-type p53, as determined by the yeast assay, including the heterogygous strain, MA2-1, contained the identical codon 215 mutation.

Evidence of Homologous Recombination in Focus-derived Cell Strains That Have Lost p53 Transactivating Function.

Finding a focus-derived cell strain that had one wild-type allele and one allele with the transition at codon 215 suggested that the proposed subpopulation of cells with the codon 215 mutation in the target population used for the MNU study were heterogygous for this allele. If so, MNU treatment could convert a portion of the cells to the homozygous mutant state by inducing homologous recombination or to the hemizygous state by inducing loss of part of the chromosome containing the wild-type p53 allele. To test this hypothesis, we used analysis for LOH of informative markers and Southern blotting to determine the number of p53 alleles in each cell strain.

Southern blotting analysis of EcoRI-digested DNA was carried out, using an RT-PCR product from p53 mRNA as the probe for the p53 gene. The HPRT gene, used as a loading control for the DNA blots, was probed with an intron 1 segment of that gene (26). The blot was initially probed for p53 and then stripped and reprobed for HPRT.MSU-1.1 cells are derived from a male donor and contain a single X chromosome (1). Because HPRT is located on the X chromosome, it represents a single-copy gene for these male cells. The intensities of the resulting bands from the different probes were normalized using DNA from parental MSU-1.1 cells as the standard. The results from the comparative Southern analysis showed that all 15 focus-derived cell strains that expressed only mutant p53contained two copies of p53. These data are included where appropriate in the characterization of the strains in Table 3.

Investigation of parental MSU-1.1 cells revealed two informative RFLP markers on the p arm of chromosome 17. One locus, located telomeric to p53 and detected by the pYNZ22.1 probe, produces multiple bands in the range of 0.5–1.3 kb in MspI-digested DNA. The other locus, centromeric to p53 and detected by the pUC10-41 probe, yields bands of 2.4 and 1.9 kb in MspI-digested DNA. Using these markers, we examined each of the focus-derived cell strains that had lost p53 transactivating function. Three patterns of LOH were found: loss of the telomeric marker, loss of both markers,and no LOH (data not shown). A representative RFLP Southern blot is shown in Fig. 3 .

Because the LOH at the p53 locus was not caused by loss of chromosomal material, we hypothesized that it resulted from mitotic recombination. If so, the recombination events should be random and should yield different patterns of LOH. To test this, we used six informative microsatellite markers on the p arm of chromosome 17 that were identified in the parental MSU-1.1 cell strain (Fig. 4). Three are located between p53 and the telomeric RFLP marker; the other three are located between p53 and the centromeric RFLP marker. A representative microsatellite analysis gel is shown in Fig. 5 . Analysis of the 15 focused-derived cell strains using these informative microsatellite markers revealed seven distinct patterns of LOH (Fig. 6). To determine whether the LOH seen in these strains for 17p resulted from some kind of generalized genomic instability caused by the loss of p53 function, we examined the status of informative microsatellite markers on chromosomes 11 and 18 in these focus-derived cell strains. The data revealed no LOH of these markers for any cell strain tested (data not shown). The results from the RFLP analysis,taken together with the comparative Southern blotting data indicating that focus-derived cell strains that expressed only mutant p53 contain two copies of p53, support the hypothesis that homologous recombination was involved in the generation of the of MNU-induced, focus-derived cell strains that express two mutant p53 alleles.

The observed multiple patterns of LOH indicate that recombination occurred within these focus-derived cell strains but cannot indicate that such recombination necessarily was stimulated by MNU treatment,rather than arising spontaneously. To examine this question, we analyzed a second series of focus-derived cell strains. These were generated by cobalt-60 irradiation of the same target population of MSU-1.1 cells that had been used for the MNU study. Analysis of focus-derived strains induced by cobalt-60 revealed four patterns of LOH compared with the seven seen with MNU-induced foci. Only two of the four LOH patterns were identical to patterns found with the latter strains, i.e., pattern 1 (no LOH at any marker) and pattern 7 (LOH at all markers tested). The latter pattern was the most common pattern seen with the cells from ionizing radiation-induced foci. These results support the hypothesis that the LOH patterns we observed with MNU-treated cell strains did not preexist within the subpopulation in the target MSU-1.1 cells used for these studies but rather resulted from MNU-induced LOH.

Attempt to Isolate the Preexisting Precursor Containing the Mutation at Codon 215.

The role that loss of p53 function plays in causing or allowing cells to form foci is not readily apparent. Because the majority, 54% (19 of 35), of the focus-derived cell strains assayed retained wild-type p53, clearly such loss is not required for focus formation. The fact that 15 of the 35 strains assayed (43%)lost p53 function raises the question of whether loss of p53 activity can directly cause MSU-1.1 cells to form foci. Our data show that assaying MSU-1.1 cells for focus formation provides an efficient method for identifying cells that lack functional p53, but that changes other than loss of p53function may also be involved. However, if loss of p53transactivating ability did not cause the MSU-1.1 cells to form foci,and the foci resulted from an additional, as yet unidentified, genetic change induced by MNU, it is difficult to understand why such a high proportion of the MNU-induced, focus-derived cell strains were found to lack wild-type p53. If loss of p53 were not somehow being “selected for,” the frequency of cells containing the codon 215 mutation that preexisted in the population would have to be very high indeed, i.e., ∼43%. We plated parental MSU-1.1 cells at cloning densities and used RT-PCR and NlaIII digestion to analyze 80 independent clones for their p53status. None of the 80 exhibited a transition at codon 215. Therefore,the frequency of cells in that population that contain that codon 215 mutation has to be <1 in 80. We estimate that the frequency is not lower than 1 in 10,000 cells, because near the beginning of our studies on the frequency of MNU-induced focus formation, we carried out a limiting dilution of our MSU-1.1 target cell population to reduce the background frequency of foci. We plated 10 dishes at 5,000 cells per dish, expanded these subpopulations, and stored them for future use. Progeny of five of these limiting dilution sets of cells were assayed for the frequency of foci, using 3 × 105 from cells from each population. No foci were found, indicating a background of <1 × 10-6 cells. One of these limiting dilution sets was then expanded and used as the target population for the MNU experiments reported here, as well as for the studies with cobalt-60 irradiation referred to above. Each carcinogen treatment yielded cells able to form foci, and some of these contained the codon 215 mutation.

It is well documented that methylating agents, including MNU, can induce malignant tumors in animals (28). An early study(29) showed that the frequency of induction of thymomas in mice by MNU or ethylnitrosourea was correlated with the frequency of adducts formed by these carcinogens at the O6 position of guanine. Maher and colleagues (14, 15) demonstrated that O6-MeG is the principal cytotoxic and mutagenic adduct formed by MNNG in diploid human fibroblasts. This was confirmed by Lukash et al.(16), who pretreated the cells with O6-BzG to deplete them of AGT activity and showed that this very significantly increased the cytotoxic and mutagenic effect of MNNG but did not alter the spectrum of mutations induced in the HPRT gene. Zhang et al.(30), using several approaches with a series of human cell strains, including an MSU-1.1 derivative strain, showed that O6-MeG is the adduct principally responsible for MNNG-induced intrachromosomal homologous recombination. The present study was designed to see whether MNU could transform MSU-1.1 cells into focus-forming cells, whether O6-MeG was responsible for this effect, whether cell strains derived from the foci were able to form tumors, and whether loss of p53 was involved. The results indicate that the answer to each of these questions is positive. O6-MeG is the MNU adduct principally responsible for inducing transformation of the target cells into focus-forming cells, because they arose at much lower doses in populations in which rapid elimination of O6-MeG was prevented. Because the majority of the focus-derived strains retained p53 activity,this transformation does not have to involve loss of wild-type p53, but loss of p53 transactivating ability appears to promote focus formation. The data indicate that one way for O6-MeG to eliminate wild-type p53 is to stimulate homologous mitotic recombination between a mutant p53 allele and a wild-type allele. A single reciprocal exchange between homologous chromatids, occurring spontaneously or induced by O6-MeG,anywhere on the p arm of chromosome 17 between the centromere and the p53 gene, can yield a daughter cell in which both the maternal and the paternal chromosome 17 carry the mutant allele. Our data suggest but do not prove that such elimination of p53 activity allows the cell to form foci.

The data in Fig. 1 indicate that MNU plays a role in converting a substantial number of target MSU-1.1 cells into focus-forming cells. However, the role of MNU in converting focus-forming cells into malignant cells appears to be indirect. As shown in Table 3, the ability to form foci is not sufficient for tumorigenicity. Neither is mere loss of p53 transactivating ability, because only 10 of 15 strains that lacked functional p53 were able to form tumors. Nevertheless, of 35 focus-derived cell strains tested, only those that had lost this p53 function were able to form tumors. (In the one case in which the function of only one p53 allele was lost, the cells derived from the tumors formed by the latter strain, MA2-1T, no longer contained the wild-type p53 allele.) These data indicate that although loss of p53 function is not sufficient for transformation of MSU-1.1 cells into malignant cells, it greatly increases the chance that a cell will acquire the additional changes required for such transformation.

The fact that tumorigenic cell strains were isolated from foci induced by a much lower dose of MNU in cells from which AGT had been eliminated by pretreatment with O6-BzG than was required for populations not depleted of AGT strongly suggests that O6-MeG adducts played an indirect causal role in the malignant transformation. Unpublished data from this laboratory5 show that the latency period is a function of the number of malignant cells injected into athymic mice. The fact that finding that the tumors formed by cell strain MA2-1,which is heterozygous for p53, exhibited a longer latency period than those from strains totally devoid of p53transactivating ability, whereas the cells derived from those tumors(MA2-1T) were devoid of wild-type p53 activity, supports the hypothesis that loss of p53 enables cells to acquire the additional changes needed to become malignant. We hypothesize that during the propagation of the heterozygous MA2-1 cells to obtain sufficient cells for injection, a fraction of the population lost the wild-type p53 allele, and their progeny cells gave rise to the tumors that arose after a relatively long latency.

The data suggesting that by causing mitotic recombination between homologous chromatids, MNU was indirectly able to cause cells to become malignant may have clinical significance, because alkylating agents are used in chemotherapy (31, 32). Chemotherapy protocols try to maximize the cytotoxic effects of specific agents without increasing the chances that therapy-related new malignancies arise. The results of our study indicate that such agents, e.g., those that act through formation of adducts on the O6position of guanine, not only cannot induce point mutations but also may produce cells that have been converted from a heterozygous state for a particular mutation into a homozygous state by inducing homologous mitotic recombination. Recent evidence that such recombination occurs in carcinogen-treated mice that carry a mutant p53 transgene (33) supports this hypothesis.

Fig. 1.

Cytotoxicity (A) and induction of foci(B) by MNU as a function of dose in the presence or absence of O6-BzG. ▴, cells were pretreated with 25 μmO6-BzG for 2 h, had O6-BzG present during the 30-min MNU treatment, and were maintained in O6-BzG for an additional 48 h;•, cells received MNU treatment only. The background frequencies of foci have been subtracted.

Fig. 1.

Cytotoxicity (A) and induction of foci(B) by MNU as a function of dose in the presence or absence of O6-BzG. ▴, cells were pretreated with 25 μmO6-BzG for 2 h, had O6-BzG present during the 30-min MNU treatment, and were maintained in O6-BzG for an additional 48 h;•, cells received MNU treatment only. The background frequencies of foci have been subtracted.

Close modal
Fig. 2.

Gel electrophoresis of NlaIII restriction digests of p53 RT-PCR product. Lane 1,size markers; Lane 2, wild-type p53product; Lane 3, p53 RT-PCR product heterozygous at codon 215; Lane 4, p53 RT-PCR product fully mutant at codon 215.

Fig. 2.

Gel electrophoresis of NlaIII restriction digests of p53 RT-PCR product. Lane 1,size markers; Lane 2, wild-type p53product; Lane 3, p53 RT-PCR product heterozygous at codon 215; Lane 4, p53 RT-PCR product fully mutant at codon 215.

Close modal
Fig. 3.

Representative RFLP analysis of an informative marker on 17p of MSU-1.1 cells using the pYNZ22.1 probe. Lane 5,parental MSU-1.1 cells; Lanes 1–4, focus-derived cell strains that express mutant p53. The pattern shown for the parental MSU-1.1 cell strain indicates retention of heterozygosity;alterations from this pattern denote LOH for this marker.

Fig. 3.

Representative RFLP analysis of an informative marker on 17p of MSU-1.1 cells using the pYNZ22.1 probe. Lane 5,parental MSU-1.1 cells; Lanes 1–4, focus-derived cell strains that express mutant p53. The pattern shown for the parental MSU-1.1 cell strain indicates retention of heterozygosity;alterations from this pattern denote LOH for this marker.

Close modal
Fig. 4.

Relative location of informative RFLP and microsatellite markers on the p arm of chromosome 17 in MSU-1.1 cells.

Fig. 4.

Relative location of informative RFLP and microsatellite markers on the p arm of chromosome 17 in MSU-1.1 cells.

Close modal
Fig. 5.

Representative microsatellite analysis of the informative D17S796 marker on the p arm of chromosome 17. PCR was carried out as described in “Materials and Methods,” and 10 μl of PCR product were loaded per sample. Lane 12, parental cell strain MSU-1.1; Lanes 1–11 and 13,focus-derived cell strains that express only mutant p53.

Fig. 5.

Representative microsatellite analysis of the informative D17S796 marker on the p arm of chromosome 17. PCR was carried out as described in “Materials and Methods,” and 10 μl of PCR product were loaded per sample. Lane 12, parental cell strain MSU-1.1; Lanes 1–11 and 13,focus-derived cell strains that express only mutant p53.

Close modal
Fig. 6.

Patterns of LOH at informative markers on the p arm of chromosome 17 in MNU-induced focus-derived cell strains that express only mutant p53. The top line represents the p arm of chromosome 17 and the relative distance between each marker and the telomere, expressed in cM. ○, retention of heterozygosity at a marker; •, LOH. The number of independent focus-derived cell strains exhibiting each pattern is as follows:patterns 2–4, one strain each; patterns 1 and 6, two strains; pattern 5, three strains; pattern 7, five strains.

Fig. 6.

Patterns of LOH at informative markers on the p arm of chromosome 17 in MNU-induced focus-derived cell strains that express only mutant p53. The top line represents the p arm of chromosome 17 and the relative distance between each marker and the telomere, expressed in cM. ○, retention of heterozygosity at a marker; •, LOH. The number of independent focus-derived cell strains exhibiting each pattern is as follows:patterns 2–4, one strain each; patterns 1 and 6, two strains; pattern 5, three strains; pattern 7, five strains.

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1

This work was supported by United States Department of Health and Human Services Grants CA21253 and CA60907 from the National Cancer Institute and Training Grant ES07255 from the National Institute of Environmental Health Sciences.

4

The abbreviations used are: BPDE,(±)-7β,8α-dihydroxy-9α,10α-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene;AGT, O6-alkylguanine-DNA alkyltransferase;EtBr, ethidium bromide; HPRT, hypoxanthine phosphoribosyltransferase;LOH, loss of heterozygosity; MNU, N-methyl-N-nitrosourea; MNNG, N-methyl-N′-nitro-N-nitrosoguanidine; O6-BzG, O6-benzylguanine; O6-MeG, O6-methylguanine; RT, reverse transcription.

5

J. J. McCormick, unpublished data.

Table 1

Sequencing primers for p53 RT-PCR product

Primer sequenceaBinding siteb
GCTGTCCCCGGACG 267–280 
GCAGCTACGGTTTCCG 449–464 
TCACAGCACATGACG 631–645 
CTGACTGTACCACCAT 815–832 
CCGGCGCACAGAGG 978–991 
TGAATGAGGCCTTGG 1166–1180 
AGCTTCATCTGGACCTGGG 324–306 
ATGCAAGAAGCCCAG 480–465 
CTCATGGTGGGGGC 675–662 
GCCGCCCATGCAGGAA 870–855 
TCCCCTTTCTTGCGG 1016–1002 
CCTGGGCATCCTTGAGTT 1338–1315 
Primer sequenceaBinding siteb
GCTGTCCCCGGACG 267–280 
GCAGCTACGGTTTCCG 449–464 
TCACAGCACATGACG 631–645 
CTGACTGTACCACCAT 815–832 
CCGGCGCACAGAGG 978–991 
TGAATGAGGCCTTGG 1166–1180 
AGCTTCATCTGGACCTGGG 324–306 
ATGCAAGAAGCCCAG 480–465 
CTCATGGTGGGGGC 675–662 
GCCGCCCATGCAGGAA 870–855 
TCCCCTTTCTTGCGG 1016–1002 
CCTGGGCATCCTTGAGTT 1338–1315 
a

The first six primers are forward primers, and the rest are reverse primers. Each is written 5′to 3′.

b

Primer binding locations on the p53 cDNA where 1 represents the start codon.

Table 2

Microsatellite PCR primer information

Name of locusaTmb (°C)Location (cM)cAnnealing temperature (°C)Primer sequenced
D17S1828 54 9.8 54 1) TTAAGCCAGTTCGGATTTG 
 54   2) TGCACTCACAGATTTGCC 
D17S796 60 14.8 60 1) AGTCCGATAATGCCAGGATG 
 58   2) CAATGGAACCAAATGTGGTC 
D17S960 52 16.5 55 1) TGATGCATATACATGCGTG 
 54   2) TAGCGACTCTTCTGGCA 
D17S952 58 18 58 1) ACCTTACCATGCACACAGTT 
 52   2) TCCCCAGGAGACAGCA 
D17S945 54 22 56 1) CCTGAAGCCTGACCCC 
 56   2) AACCAATCTGGACTCCCC 
D17S947 58 32.8 56 1) GACAAGAATTTCCCAAGATAG 
 52   2) TGTCCCAGAGTTTCGATA 
D11S1338 62 14.9 60 1) TAATGCTACTTATTTGGAGTGTG 
 68   2) GACGGTTTAACTGTATATCTAAGAC 
D11S4083 58 50.7 56 1) TTTAACCCAAGGGCAGGAC 
 60   2) CATGTGTACCCAAGGGCAG 
D11S1344 60 62.5 56 1) CCCTGAACTTCTGCATTCAC 
 60   2) GCGCCTGGCTTGTACATATA 
D18S68 54 94.4 57 1) ATGCTGCTGGTCTGAGG 
 60   2) ATGGGAGACGTAATACACCC 
Name of locusaTmb (°C)Location (cM)cAnnealing temperature (°C)Primer sequenced
D17S1828 54 9.8 54 1) TTAAGCCAGTTCGGATTTG 
 54   2) TGCACTCACAGATTTGCC 
D17S796 60 14.8 60 1) AGTCCGATAATGCCAGGATG 
 58   2) CAATGGAACCAAATGTGGTC 
D17S960 52 16.5 55 1) TGATGCATATACATGCGTG 
 54   2) TAGCGACTCTTCTGGCA 
D17S952 58 18 58 1) ACCTTACCATGCACACAGTT 
 52   2) TCCCCAGGAGACAGCA 
D17S945 54 22 56 1) CCTGAAGCCTGACCCC 
 56   2) AACCAATCTGGACTCCCC 
D17S947 58 32.8 56 1) GACAAGAATTTCCCAAGATAG 
 52   2) TGTCCCAGAGTTTCGATA 
D11S1338 62 14.9 60 1) TAATGCTACTTATTTGGAGTGTG 
 68   2) GACGGTTTAACTGTATATCTAAGAC 
D11S4083 58 50.7 56 1) TTTAACCCAAGGGCAGGAC 
 60   2) CATGTGTACCCAAGGGCAG 
D11S1344 60 62.5 56 1) CCCTGAACTTCTGCATTCAC 
 60   2) GCGCCTGGCTTGTACATATA 
D18S68 54 94.4 57 1) ATGCTGCTGGTCTGAGG 
 60   2) ATGGGAGACGTAATACACCC 
a

The first six loci detect microsatellites located on the p arm of chromosome 17; the next three loci detect microsatellites located on chromosome 11; and the last one detects a microsatellite located on chromosome 18.

b

Melting temperature of indicated primer sequence.

c

Distance from the top of the linkage group as determined by Genethon mapping.

d

Sequences are written 5′ to 3′. They were obtained from the Whitehead Institute database.

Table 3

Characterization of MNU-induced focus-derived cell strains

Cell strainMNU (mm)O6-BzGaFunctional status of p53 genebTumors/ injection siteTumor latency (weeks)c
MSU-1.1  − + /+ 0 /50 NAd 
MA0-1 0.0 − − /− 6 /8 6–10 
MB5-1 0.7 − /− 6 /6 6–10 
MA4-1 0.9 − − /− 3 /4 7–9 
MA3-3 0.8 − − /− 3 /4 8–12 
MB3-1 0.3 − /− 4 /4 
MB4-2 0.5 − /− 1 /8 
MB4-3 0.5 − /− 4 /4 11 
MA3-2 0.8 − − /− 2 /4 13 
MB2-2 0.2 − /− 2 /4 14 
MA5-1 1.3 − − /− 2 /8 16 
MA2-1 0.7 − + /− 4 /8 11–31 
MA2-1Te 0.7 − − /− NDe NDf 
MB2-3 0.2 − /− 0 /8 NA 
MB4-5 0.5 − /− 0 /4 NA 
MB5-2 0.7 − /− 0 /8 NA 
MA3-1 0.8 − − /− 0 /8 NA 
MA5-2 1.3 − − /− 0 /4 NA 
MA0-2 0.0 − + /+ 0 /4 NA 
MA0-3 0.0 − + /+ 0 /4 NA 
MB0-1 0.0 + /+ 0 /4 NA 
MB0-2 0.0 + /+ 0 /4 NA 
MB0-3 0.0 + /+ 0 /4 NA 
MB0-4 0.0 + /+ 0 /4 NA 
MB1-1 0.1 + /+ 0 /4 NA 
MB1-2 0.1 + /+ 0 /4 NA 
MB2-1 0.2 + /+ 0 /8 NA 
MB2-4 0.2 + /+ 0 /4 NA 
MB3-2 0.3 + /+ 0 /4 NA 
MB4-1 0.5 + /+ 0 /4 NA 
MB4-4 0.5 + /+ 0 /4 NA 
MA3-4 0.8 − + /+ 0 /4 NA 
MA3-5 0.8 − + /+ 0 /4 NA 
MA3-6 0.8 − + /+ 0 /4 NA 
MA4-2 0.9 − + /+ 0 /4 NA 
MA4-3 0.9 − + /+ 0 /4 NA 
MA4-4 0.9 − + /+ 0 /4 NA 
Cell strainMNU (mm)O6-BzGaFunctional status of p53 genebTumors/ injection siteTumor latency (weeks)c
MSU-1.1  − + /+ 0 /50 NAd 
MA0-1 0.0 − − /− 6 /8 6–10 
MB5-1 0.7 − /− 6 /6 6–10 
MA4-1 0.9 − − /− 3 /4 7–9 
MA3-3 0.8 − − /− 3 /4 8–12 
MB3-1 0.3 − /− 4 /4 
MB4-2 0.5 − /− 1 /8 
MB4-3 0.5 − /− 4 /4 11 
MA3-2 0.8 − − /− 2 /4 13 
MB2-2 0.2 − /− 2 /4 14 
MA5-1 1.3 − − /− 2 /8 16 
MA2-1 0.7 − + /− 4 /8 11–31 
MA2-1Te 0.7 − − /− NDe NDf 
MB2-3 0.2 − /− 0 /8 NA 
MB4-5 0.5 − /− 0 /4 NA 
MB5-2 0.7 − /− 0 /8 NA 
MA3-1 0.8 − − /− 0 /8 NA 
MA5-2 1.3 − − /− 0 /4 NA 
MA0-2 0.0 − + /+ 0 /4 NA 
MA0-3 0.0 − + /+ 0 /4 NA 
MB0-1 0.0 + /+ 0 /4 NA 
MB0-2 0.0 + /+ 0 /4 NA 
MB0-3 0.0 + /+ 0 /4 NA 
MB0-4 0.0 + /+ 0 /4 NA 
MB1-1 0.1 + /+ 0 /4 NA 
MB1-2 0.1 + /+ 0 /4 NA 
MB2-1 0.2 + /+ 0 /8 NA 
MB2-4 0.2 + /+ 0 /4 NA 
MB3-2 0.3 + /+ 0 /4 NA 
MB4-1 0.5 + /+ 0 /4 NA 
MB4-4 0.5 + /+ 0 /4 NA 
MA3-4 0.8 − + /+ 0 /4 NA 
MA3-5 0.8 − + /+ 0 /4 NA 
MA3-6 0.8 − + /+ 0 /4 NA 
MA4-2 0.9 − + /+ 0 /4 NA 
MA4-3 0.9 − + /+ 0 /4 NA 
MA4-4 0.9 − + /+ 0 /4 NA 
a

Treatment protocol from which the focus-derived cell strain was isolated. +, cells received a 2-h pretreatment before and during the 1-h exposure to MNU, followed by an additional 48 h of 25 μmO6-BzG after MNU treatment; −, cells received MNU treatment only.

b

Transactivating activity of p53 as determined by a transgenic yeast assay or by detection of the A to G mutation in codon 215 by NlaIII digestion, as described in “Materials and Methods.” −/−, cell strains that express only mutant p53 and contain two alleles as determined by Southern blotting analysis; +/+, cell strains that express only wild-type p53, but the number of alleles was not verified by Southern blotting; +/−, a cell strain that is heterozygous for p53.

c

Time required for tumors to reach 1 cm in diameter (500 mm3).

d

NA, not applicable.

e

MA2-1T indicates the cells derived from one of the tumors formed by injecting the focus-derived cell strain MA2-1.

f

ND, not determined. The MA2-1T tumor-derived cells were found to have lost the wild-type p53 allele. They were not retested for tumorigenicity.

We thank Richard Iggo (Institut Suissede Recherches, Lausanne,Switzerland) for generously providing the materials for the yeast assay of the transactivating ability of p53 and Dr. A. E. Pegg (M. S. Hershey Medical Center, Pennsylvania State University,Hershey, PA) for the gift of O6-BzG. We acknowledge the expert technical assistance of Amanda Barrett and Clarissa S. Dallas and thank our colleague Dr. Sandra O’Reilly(Michigan State University) for the focus-derived strains induced by cobalt-60.

1
Morgan T. L., Yang D., Fry D. G., Hurlin P. T., Kohler S. K., Maher V. M., McCormick J. J. Characteristics of an infinite life span diploid human fibroblast cell strain and a near-diploid strain arising from a clone of cells expressing a transfected v-myc oncogene.
Exp. Cell Res.
,
197
:
125
-136,  
1991
.
2
Hurlin P. J., Maher V. M., McCormick J. J. Malignant transformation of human fibroblasts caused by expression of a transfected T24 HRAS oncogene.
Proc. Natl. Acad. Sci. USA
,
86
:
187
-191,  
1989
.
3
Wilson D. M., Yang D., Dillberger J. E., Dietrich S. E., Maher V. M., McCormick J. J. Malignant transformation of human fibroblasts by a transfected N-ras oncogene.
Cancer Res.
,
50
:
5587
-5593,  
1990
.
4
Yang D., Louden C., Reinhold D. S., Kohler S. K., Maher V. M., McCormick J. J. Malignant transformation of human fibroblast strain MSU-1 by (±)-7β8α-dihydroxy-9α,10α-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene..
Proc.Natl.Acad.Sci.USA
,
89
:
2237
-2241,  
1992
.
5
Reinhold D. S., Walicka M., El Kassaby M., Milam L. D., Kohler S. K., Dunstan R. W., McCormick J. J. Malignant transformation of human fibroblasts by ionizing radiation.
Int. J. Radiat. Biol.
,
69
:
707
-715,  
1996
.
6
O’Reilly S., Walicka M., Kohler S. K., Dunstan R., Maher V. M., McCormick J. J. Dose-dependent transformation of cells of human fibroblast cell strain MSU-11 by cobalt-60 gamma radiation and characterization of the transformed cells..
Radiat. Res.
,
150
:
577
-584,  
1998
.
7
Levine A. J. p53, the cellular gatekeeper for growth and division.
Cell
,
88
:
323
-331,  
1997
.
8
Ko L. J., Prives C. p53: puzzle and paradigm.
Genes Dev.
,
10
:
1054
-1072,  
1996
.
9
Hollstein M., Rice K., Greenblatt M. S., Soussi T., Fuchs R., Sorlie T., Hovig E., Smith-Sorensen B., Montesano R., Harris C. C. Database of p53 gene somatic mutations in human tumors and cell lines.
Nucleic Acids Res.
,
22
:
3551
-3555,  
1994
.
10
Toguchida J., Yamaguchi T., Ritchie B., Beauchamp R. L., Dayton S. H., Herrera G. E., Yamamuro T., Kotoura Y., Sasaki M. S., Little J. B., Weichselbaum R. R., Ishizaki K., Yandell D. W. Mutation spectrum of the p53 gene in bone and soft tissue sarcomas.
Cancer Res.
,
52
:
6194
-6199,  
1992
.
11
Eliyahu D., Michalovitz D., Eliyahu S., Pinhasi-Kimhi O., Oren M. Wild-type p53 can inhibit oncogene-mediated focus formation.
Proc. Natl. Acad. Sci. USA
,
86
:
8763
-8767,  
1989
.
12
Finlay C. A., Hinds P. W., Levine A. J. The p53 proto-oncogene can act as a suppressor of transformation.
Cell
,
57
:
1083
-1093,  
1989
.
13
Singer B., Kusmierek J. T. Chemical mutagenesis.
Annu. Rev. Biochem.
,
52
:
655
-693,  
1982
.
14
Domoradzki J., Pegg A. E., Dolan M. E., Maher V. M., McCormick J. J. Correlation between O6-methylguanine-DNA-methyltransferase activity and resistance of human cells to the cytotoxic and mutagenic effect of N-methyl-N′-nitro-N-nitrosoguanidine.
Carcinogenesis (Lond.)
,
5
:
1641
-1647,  
1984
.
15
Domoradzki J., Pegg A. E., Dolan M. E., Maher V. M., McCormick J. J. Depletion of O6-methylguanine-DNA-methyltransferase in human fibroblasts increases the mutagenic response to N-methyl-N′-nitro-N-nitrosoguanidine.
Carcinogenesis (Lond.)
,
6
:
1823
-1826,  
1985
.
16
Lukash L., Boldt J., Pegg A. E., Dolan M. E., Maher V. M., McCormick J. J. Effect of O6-alkylguanine-DNA alkyltransferase on the frequency and spectrum of mutations induced by N-methyl-N′-nitro-N-nitrosoguanidine in the HPRT gene of diploid human fibroblasts.
Mutat. Res.
,
250
:
397
-409,  
1991
.
17
Cariello N. F., Keohavong P., Kat A. G., Thilly W. G. Molecular analysis of complex human cell populations: mutational spectra of MNNG and ICR-191.
Mutat. Res.
,
231
:
165
-176,  
1990
.
18
Palombo F., Kohfeldt E., Calcagnile A., Nehls P., Dogliotti E. N-Methyl-N-nitrosourea-induced mutations in human cells.
Effects of the transcriptional activity of the target gene. J. Mol. Biol.
,
223
:
587
-594,  
1992
.
19
Yarosh D. The role of O6-methylguanine-DNA methyltransferase in cell survival, mutagenesis and carcinogenesis.
Mutat. Res.
,
145
:
1
-16,  
1985
.
20
Pegg A. E. Properties of mammalian O6-alkylguanine-DNA transferases.
Mutat. Res.
,
233
:
165
-175,  
1990
.
21
Pegg A. E., Byers T. L. Repair of DNA containing O6-alkylguanine.
FASEB J.
,
6
:
2302
-2310,  
1992
.
22
Dolan M. E., Moschel R. C., Pegg A. E. Depletion of mammalian O6-alkylguanine-DNA alkyltransferase activity by O6-benzylguanine provides a means to evaluate the role of this protein in protection against carcinogenic and therapeutic alkylating agents.
Proc. Natl. Acad. Sci. USA
,
87
:
5368
-5372,  
1990
.
23
Schärer E., Iggo R. Mammalian p53 can function as a transcription factor in yeast.
Nucleic Acids Res.
,
20
:
1539
-1545,  
1992
.
24
Ishioka C., Frebourg T., Yan Y. X., Vidal M., Friend S. H., Schmidt S., Iggo R. Screening patients for heterozygous p53 mutations using a functional assay in yeast.
Nat. Genet.
,
5
:
124
-129,  
1993
.
25
Cha R. S., Zarbl H., Keohavong P., Thilly W. G. Mismatch amplification mutation assay (MAMA): application to the c-H-ras gene.
PCR Methods Appl.
,
2
:
14
-20,  
1992
.
26
Lin D., Chinault A. C. Comparative study of DNase I sensitivity at the X-linked human HPRT locus.
Somat. Cell Mol. Genet.
,
14
:
261
-272,  
1988
.
27
Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory, 1982.
28
IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans, vol. 17, pp. 227–255. Lyon, France: IARC, 1978.
29
Frei J. V., Swenson D. H., Warren W., Lawley P. D. Alkylation of deoxyribonucleic acid in vivo in various organs of C57BL mice by the carcinogens N-methyl-N-nitrosourea, N-ethyl-N-nitrosourea and ethyl methanesulphonate in relation to induction of thymic lymphoma.
Some applications of high-pressure liquid chromatography. Biochem. J.
,
174
:
1031
-1044,  
1978
.
30
Zhang H., Tsujimura T., Bhattacharyya N. P., Maher V. M., McCormick J. J. O6-Methylguanine induces intrachromosomal recombination in human cells.
Carcinogenesis (Lond.)
,
17
:
2229
-2235,  
1996
.
31
Souliotis V. L., Boussiotis V. A., Pangalis G. A., Kyrtopouloss S. A. In vivo formation and repair of O6-methylguanine in human leukocyte DNA after intravenous exposure to dacarbazine.
Carcinogenesis (Lond.)
,
12
:
285
-288,  
1991
.
32
Kyrtopouloss S. A., Souliotis V. L., Valavanis C., Boussiotis V. A., Pangalis G. A. Accumulation of O6-methylguanine in human DNA after therapeutic exposure to methylating agents and its relationship with biological effects.
Environ. Health Perspect.
,
99
:
143
-147,  
1993
.
33
Boley, S. E., Anderson, E. E., French, J. E., Donehower, L. A., and Recio, L. Loss of p53 in benzene-induced thymic lymphomas in p53+/- mice: Evidence of homologous recombination. Cancer Res. 60: 2831–2835, 2000.