Two distinct regions of minimal deletion (RMD) have been identified at 6q25-q27 in non-Hodgkin’s lymphoma (RMD-1), and at 6q21-q23 in acute lymphoblastic leukemia (ALL; RMD-2) by loss of heterozygosity and fluorescence in situ hybridization studies. In this study, 30 overlapping yeast artificial chromosomes (YACs), 1 expressed sequence tag, and 11 novel YAC ends were identified using bidirectional YAC walks between markers D6S447 (proximal) and D6S246 (distal) in RMD-2. The genes AF6q21, human homologue of the Drosophila tailless(HTLX), CD24 antigen, the Kruppel-like zinc finger BLIMP1, and cyclin C (CCNC),previously mapped to 6q21, were accurately positioned in a telomere-to-centromere orientation. Approximately 3.5 Mb were found to separate the BLIMP1 (adjacent to D6S447) and AF6q21 genes (telomeric to D6S246). Deletions of 6q were investigated in 21 cases of ALL using the newly characterized YAC clones in dual-color fluorescence in situ hybridization studies. A region centromeric to D6S447 (containing marker D6S283) and a region telomeric to marker CHLC.GGAT16CO2 (and containing marker D6S268) were identified as distinct and nonoverlapping regions of deletion in ALL.

Abnormalities of the long arm of chromosome 6 (6q) involving the chromosomal regions 6q16-q27 have been reported in a variety of hematological malignancies and solid tumors (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). The location and extent of deletions in lymphoid malignancies vary according to the disease type, whether B or T cell immunophenotype, and the technique used, for example,FISH4or LOH. The accurate characterization of 6q deletions is of clinical importance in lymphoid malignancies because they are related to prognosis (10, 11). Two distinct RMD have been identified at 6q25-q27 in non-Hodgkin’s lymphoma (RMD-1) and at 6q21-q23 in ALL (RMD-2) by LOH and FISH. This study focused on the molecular definition of a commonly deleted region between markers D6S447 and D6S246 in RMD-2 (5, 6, 7, 8, 9, 10) in an attempt to identify candidate tumor suppressor genes within this region. A number of genes have been localized to 6q21: the B-cell surface marker CD24(12); the cyclin C gene (13); the human homologue of the Drosophila tailless gene (HTLX;Ref. 14); a member of the Kruppel-like zinc finger family, BLIMP1, the β-IFN gene positive regulatory domain I-binding factor (15); and the AF6q21 gene,which was discovered as a result of its involvement in the t(6;11)(q21;q23) (16, 17). To evaluate the role of any one of these genes as candidate tumor suppressor genes in patients with 6q deletions, their precise localization was paramount.

Cytogenetic and FISH Analysis of 6q Deletions.

Metaphases from bone marrow samples of 21 patients with ALL and phytohemagglutinin-stimulated cultured blood lymphocytes from normal individuals were prepared and G-banded for cytogenetic analysis using standard procedures. Karyotypes were described according to the International System for Human Cytogenetic Nomenclature. DNA probes for FISH were labeled indirectly with biotin-16-dUTP or digoxigenin-11-dUTP(Life Technologies, Inc.) or directly with Spectrum Red,Spectrum Green (Vysis Ltd.), or Chromatide Alexa 532-5-dUTP (Molecular Probes Inc.). Biotinylated probes were detected with green (FITC) and digoxigenin-labeled probes with red (Texas red) fluorescence labeled reporter molecules. Directly labeled probes were prepared using a Comparative Genomic Hybridization Nick translation kit (Vysis Ltd.) according to the manufacturer’s instructions. Hybridization and washing procedures were conducted as described previously(18). Dual-color FISH was carried out using pairs of biotin- and digoxigenin-labeled YAC DNA probes hybridized to metaphases from patients with deletions of 6q. The extent of the deletions was determined by mapping the retention and loss of red and green probe signals in serial dual-color hybridizations. The presence of a normal chromosome 6 with evidence of both red and green signals in each cell was used as an indicator of hybridization efficiency. Deletion was defined by loss of signal in a minimum of five cells and not less than 20% of the total observed. A minimum of 10 metaphases were scored for each patient. The relative positions of YAC and PAC probes were determined by dual- or triple-color FISH on interphase cells or extended DNA prepared from cytospins of granulocytes isolated from normal peripheral blood.

DNA Preparation from YAC, PAC, and Vectorette Library Preparations.

High-molecular weight DNA was prepared from a 72-h yeast culture using phenol-chloroform extraction (14). The sequences of YAC ends were obtained using the PCR products of Vectorette libraries prepared as described previously (19). All sequences were checked against database sequence repositories. Primers derived from YAC ends were tested for chromosome 6-specific amplification using chromosome 6 hybrid DNA (MRC Resource Center, Hinxton, United Kingdom). Novel and overlapping YAC clones were identified using PCR screening of the Zeneca YAC library according to the protocol recommended (MRC Resource Center). Alternatively, YAC ends were used to generate probes for hybridization to the CEPH library.

YAC Mapping of 6q21.

A partial YAC contig map of RMD-2 was generated by bidirectional cloning, using specific proximal (D6S447) and distal (D6S246) markers. Two large previously described contigs, WC6.13 and WC6.14, were identified (through the GDB database5) using 12 known markers (D6S246, D6S278, D6S268, CD24,D6S1592, CHLC.GGAT16CO2, CHLC.GGAT14A05, D6S1296, D6S447, D6S1592,D6S301, and D6S283). WC6.13 is proximal, is composed of 119 YACs and spans the markers D6S1288 (proximal) and CHLC.GGAT16CO2 (distal). WC6.14 is distal, is composed of 211 YACs, and spans the markers D6S268(proximal) and D6S474 (distal). Y853b7 delineates the distal end of the WC6.13 contig and extends from marker D6S447 to CHLC.GGAT16CO2. Y856e1 contains D6S246 and D6S268 and overlaps with Y916c5, which defines the proximal end of WC6.14. Thus, Y853b7 was used to initiate the distal walk toward the D6S246 marker and Y916c5 to walk in the centromeric direction toward D6S447.

Bidirectional walking was also applied to an additional eight YAC clones (Fig. 1, ▪). Eleven new STSs, 1 EST (Table 1,856e1-L) and 16 YAC clones were identified (Fig. 1) in centromeric and telomeric directions. Thus, the distance between CD24 and the telomeric end of Y856e1 was determined to be ∼1.5 Mb. Similarly, the distance between the ends of Y830d9 and Y853b7 was estimated to be ∼2 Mb. Our data therefore suggested that the distance between markers D6S246 and D6S447 was not less than 3.5 Mb, larger than initially postulated(10). No overlap between clones 36CB11 (distal) or 860e12,860f10, and 760d2 (proximal) was demonstrated by FISH or PCR.

Gene Localization within 6q21.

The HTLX gene had been localized previously to Y28CD7,containing marker D6S246 (Fig. 1; Ref. 14). The surface antigen CD24 was mapped to a 100-kb region of Y3GA3, and it was also contained within Y916c5. Primers from the COOH-terminal region of the AF6q21 gene (Ref. 16; Table 1) were used to screen and isolate a positive clone from the libraries developed by Zeneca (Y8CE4; Fig. 1 and Fig. 2,a). FISH on extended DNA showed this clone to overlap with Y856e1. In addition, clones distal to Y856e1 (Y950a8, Y846d8, Y776a5,and Y953c2) were found to contain AF6q21 sequences by PCR,whereas clones proximal to Y856e1 (Y28CD7, Y37ED8, and Y916c5) were negative. This confirmed the localization of the AF6q21 gene distal to HTLX and D6S246. CD24, HTLX,and AF6q21 were mapped within a contiguous region of ∼1.5 Mb. The BLIMP1 gene had been localized previously to 6q21-q22.1 adjacent to D6S447 (15) on clone Y665f3 (780 kb in size), which was described to contain D6S447, BLIMP1, and D6S268 (15). This suggested a physical link between D6S447 and D6S246. However, in our study BLIMP1 sequences were detected on Y830d9 and Y900f10 but not on Y860f10, Y860e2, Y916c5,Y856e1, or Y28CD7. Y665f3 was positive for D6S268 but not D6S447 or BLIMP1, as suggested previously (15). This restricted the position of BLIMP1 proximal to D6S447 and confirmed the position of Y665f3 distal to CD24. Finally,the PAC clone P13743, containing CCNC (a kind gift from Dr. J. E. Lahti), was positioned by triple-color FISH analysis relative to Y748c8 and PAC clone dJ202B13 (corresponding to the marker D6S1060;Fig. 2,b). FISH demonstrated the relative order to be as follows: centromere, dJ202B13, P13743, Y748c8, with no evidence of overlap between P13743 and YAC 748c8. This was confirmed by the lack of PCR amplification using primers for CCNC and DNA from Y748c8, ruling out the proximity of CCNC to D6S283. The region containing D6S283 has been the focus of several investigations by LOH analysis. Merup et al., (8) mapped the minimally deleted region (∼500 kb) between markers D6S1709 and D6S434, centered around D6S283. Y748c8 is ∼1.78 Mb in size. It contains all three markers and does not contain or overlap with clones containing CCNC. Therefore, this gene must be located proximal to D6S283 (Fig. 2 b), outside the small deletion described by Merup et al.(8). Studies by Li et al.(13) had previously ruled out a major role for CCNC as a tumor suppressor gene in ALL. Despite the detection of CCNC in 90% of patients with a visible cytogenetic deletion or rearrangement involving 6q21, the authors found no mutations by single-strand conformation polymorphism within the coding region or flanking intronic sequences on the retained allele in patients heterozygous for a CCNC deletion. Thus, they concluded that either haploinsufficiency of the cyclin C protein promoted tumor formation or that a tumor suppressor gene was linked to the CCNC locus.

FISH Analysis of Patients with Cytogenetically Visible 6q Deletion.

FISH analysis was carried out on a series of ALL patients with cytogenetically detectable 6q21 deletions. A panel of probes localized to the proximal (Y748c8, Y830d9, and Y860f10) or distal (Y36CB11,Y856e1, Y28CD7, and Y8CE4) regions were used in combination with more centromeric (Y38AH1 at 6q14) and telomeric (Y19IF11 at 6q25) clones. The results are summarized in Fig. 3 . Y36CB11 was the most proximal clone within the distal WC6.14 contig,and Y860f10 represented the most distal clone from the proximal WC6.13 contig. In 13 patients (Fig. 3, patients 1–13) the 6q deletion encompassed both markers D6S447 and D6S246. In patients 1–10,deletions extended beyond and included markers D6S283 and D6S246. In two patients (Fig. 3, patients 14 and 15),deletion of Y36CB11 was associated with the retention of Y830d9(containing marker D6S447), including the most distal Y860f10 (tested in patient 15; Fig. 2 and d). In four patients(Fig. 3, patients 17–20), probes containing markers D6S447 and D6S246 were retained, whereas loss of signal was observed for clones containing D6S283 (Fig. 3, patient 18) and more proximal clones (Fig. 3, patients 17, 19, and 20). In one patient (patient 21), the results of FISH analysis were consistent with the coexistence of two cell populations,both carrying 6q deletions (Fig. 3, 21a-b). A proximal 6q deletion extended between Y38AH1 (6q14) and Y748c8 (containing marker D6S283), whereas Y830d9 (containing marker D6S447) was retained. This pattern of hybridization was present in 95% of cells. Within this clone, 15% of the cells displayed an extension of the deletion detected by the absence of signals for the clones Y830d9, Y856e1, and Y811d4 (6q21). Y19IF11 (6q25) was retained in all cells examined. It is plausible to postulate karyotypic evolution occurring in this patient in the form of sequential deletion of 6q.

Conventional cytogenetic analysis revealed the same highly complex karyotype in all cells with the 6q deletion. The extended 6q deletion could not be differentiated from the smaller deletion by G-banded analysis. FISH revealed a cryptic complex rearrangement in patient 16. In this case, a proximal deletion was accompanied by inversion of part of distal 6q, resulting in the reversed order of the two YACs 856e1 and 19IF11, from centromere:856e1:19IF11:telomere to centromere:19IF11:856e1:telomere (Fig. 2 and f). Discrepancies were found in the breakpoint assignments between G-banded and FISH results in four additional patients (patients 2, 13, 18, and 20). A range of deleted subregions has been identified within the chromosomal region 6q14-q21, in a variety of acute and chronic lymphoid diseases, that may be related to the different methodologies used or the types of patients included in each series(5, 6, 7, 8, 9, 10, 20). However, it cannot be excluded that a single gene with large intronic sequences may span different areas of 6q. It may be significant that the most proximal region was identified in a study of adult T-cell leukemia, whereas the more distal regions were found predominantly in childhood B-cell leukemias and in 7% of chronic lymphocytic leukemia patients (7, 8, 9, 10, 20). It is therefore possible that the loss of two different genes in this region may be associated with different types of lymphoid malignancy. The true extent and precise localization of a deletion may also be masked by other associated cryptic rearrangements involving the same chromosome arm. Noncontiguous deletions of 6q have been reported in patients with lymphoid malignancies and deletions have been found in association with inversions of distal sequences, including one patient in this study(patient 17; Refs. 9, 11).

In conclusion, this investigation confirms the presence of two discrete and independent regions of deletion in 6q16-q21, one proximal and one distal to D6S447. The former region overlaps with a restricted area of minimal deletion in one patient described recently by Merup et al.(9), and a more proximal region described by Hatta et al.(6). This study has considerably reduced the extent of the previously described deletion distal to D6S447 (8, 10, 11), and this region will remain the focus of further investigations, particularly the gap between CHLC.CGAT16002 and CD24.

We thank Dr. J. E. Lahti from the Department of Cell Biology,St. Jude Children’s Research Hospital, Memphis, TN for kindly providing the clone containing the CCNC gene, and Dr. B. H. Czepulkowski from the Hematology Department, King’s College Hospital,London for providing material from patient 17. We would also like to thank Professor A Madrigal for constructive comments and criticisms during the preparation of the manuscript.

Fig. 1.

Overlapping YAC contig of 6q21. YAC contig map of human chromosome 6 between DNA markers D6S1592 and D6S246. YACs are depicted as horizontal lines with their STS content (•). The size of each YAC is indicated (when available). YAC ends that have been sequenced as part of this study are indicated by ▪. The positions of the gdb contigs (W6C13 and W6C14) are illustrated by horizontal arrows. The existing genomic gaps are indicated by two forward slashes.

Fig. 1.

Overlapping YAC contig of 6q21. YAC contig map of human chromosome 6 between DNA markers D6S1592 and D6S246. YACs are depicted as horizontal lines with their STS content (•). The size of each YAC is indicated (when available). YAC ends that have been sequenced as part of this study are indicated by ▪. The positions of the gdb contigs (W6C13 and W6C14) are illustrated by horizontal arrows. The existing genomic gaps are indicated by two forward slashes.

Close modal
Fig. 2.

FISH analysis using YACs and PAC clones. Representative FISH images: a, Y856e1 (green) and Y8CE4(red; containing AF6q21) hybridized to extended DNA prepared from a normal individual, demonstrating that the two clones are partially overlapping; b, clone P13743(orange; containing the CCNC gene) is mapped to a position between Y748c8 (red) and PAC clone DJ202B13 (green) using three-color FISH on normal interphase cells; c, Y860f10 (green) and Y830d9 (red) hybridized to a metaphase cell from patient 15, demonstrating retention of both probes on the deleted chromosome 6; d, Y36CB11 (green; deleted) and Y830d9(red; retained) hybridized to metaphase cells from patient 15; e, Y38IC6 (green; deleted)and Y830d9 (red; retained) hybridized to metaphase cells from patient 17; f, Y856e1 (green) and 19IF11 (red) hybridized to metaphase cells from patient 17, demonstrating that a distal inversion accompanies deletion of 6q in this case.

Fig. 2.

FISH analysis using YACs and PAC clones. Representative FISH images: a, Y856e1 (green) and Y8CE4(red; containing AF6q21) hybridized to extended DNA prepared from a normal individual, demonstrating that the two clones are partially overlapping; b, clone P13743(orange; containing the CCNC gene) is mapped to a position between Y748c8 (red) and PAC clone DJ202B13 (green) using three-color FISH on normal interphase cells; c, Y860f10 (green) and Y830d9 (red) hybridized to a metaphase cell from patient 15, demonstrating retention of both probes on the deleted chromosome 6; d, Y36CB11 (green; deleted) and Y830d9(red; retained) hybridized to metaphase cells from patient 15; e, Y38IC6 (green; deleted)and Y830d9 (red; retained) hybridized to metaphase cells from patient 17; f, Y856e1 (green) and 19IF11 (red) hybridized to metaphase cells from patient 17, demonstrating that a distal inversion accompanies deletion of 6q in this case.

Close modal
Fig. 3.

Patient analysis using a panel of YAC clones identified by this study. On the left a diagram illustrates the G-banding of the chromosome 6 q arm. Relevant markers and the list of YAC clones used for analysis are listed in vertical order from the centromere(top) to the telomere (bottom). Patients results are given in a vertical order. ○, retained YAC; •, deleted YAC. The two subclones identified in patient 21 are given as clone 21a-b, one next to the other. (See “Results and Discussion” for further information).

Fig. 3.

Patient analysis using a panel of YAC clones identified by this study. On the left a diagram illustrates the G-banding of the chromosome 6 q arm. Relevant markers and the list of YAC clones used for analysis are listed in vertical order from the centromere(top) to the telomere (bottom). Patients results are given in a vertical order. ○, retained YAC; •, deleted YAC. The two subclones identified in patient 21 are given as clone 21a-b, one next to the other. (See “Results and Discussion” for further information).

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This work was supported by the Kay Kendall Leukaemia Fund (to A. J. and P. C.)

The abbreviations used are: FISH, fluorescence in situ hybridization; LOH, loss of heterozygosity; RMD,region(s) of minimal deletion; ALL, acute lymphoblastic leukemia; YAC,yeast artificial chromosome; PAC, plasmid amplified chromosome; STS,sequence-tagged site; EST, expressed sequence tag.

Available at http://www.gdb.org.

Table 1

A. Primers used to generate YAC ends using the Vectorette method.
Primer name5′-3′ sequencea
Vectorette oligonucleotide A CAAGGAGAGGACACTGTCTG 
Vectorette oligonucleotide B CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTG 
Left arm primers 1089 CACCCGTTCTCGGAGCACTGTCCGACCGC 
Left arm primer 1201 (nested) TAGAAGCTTAGTATACTCTTTCTTCAACAATTAAATACTCTCGGT 
Right arm primer 1091 ATATAGGCGCCAGCAACCGCACCTGTGGCG 
Right arm primer 20359 (nested) TAGAAGCCTCTTGCAAGTCTGGGAAGTCTGGGAAGTGAATGGAGAC 
224-Universal Vectorette reverse TAGGGATCCCGAATCGTAACCGTTCGTACGAGAATCGCT 
A. Primers used to generate YAC ends using the Vectorette method.
Primer name5′-3′ sequencea
Vectorette oligonucleotide A CAAGGAGAGGACACTGTCTG 
Vectorette oligonucleotide B CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTG 
Left arm primers 1089 CACCCGTTCTCGGAGCACTGTCCGACCGC 
Left arm primer 1201 (nested) TAGAAGCTTAGTATACTCTTTCTTCAACAATTAAATACTCTCGGT 
Right arm primer 1091 ATATAGGCGCCAGCAACCGCACCTGTGGCG 
Right arm primer 20359 (nested) TAGAAGCCTCTTGCAAGTCTGGGAAGTCTGGGAAGTGAATGGAGAC 
224-Universal Vectorette reverse TAGGGATCCCGAATCGTAACCGTTCGTACGAGAATCGCT 
B. Novel STSsb and ESTs developed by sequence analysis of YAC ends
YACcForward primerReverse primer
830d9-R GAAGTATGATTTAAGGGAAAAAATTA ATGAAGTGTGTGAATCACAAGGC 
853b7-L AGACTCATCAGAGCTTAGAGACAAAGATA TCCTAGGCCCAGAAACTAGAGTATTATTAG 
36CB11-L TTCCAGAAAGACCACCTGAGCAATCAAT TGTGCACCACCGATTTGGAGGCCCTT 
3GA3-R AGCCAATGAAAAGCACCAGCAAGAGATC CTCTTGGACAGGAGTAGTGACTTTTAGTC 
3GA3-L TACCAAATGTTTGAGTCTTAGAGGAGTA AGTAATAGAATCAGCAGAAACCAGTGGCA 
6EH12-R GAGGGTCACCTGCACTAATTCCTGC AGCTTTCTTTCCCTCTTCCTGCTAAGCT 
6EH12-L ACTGATCTTAGCATAGTGTGTCCCTCAT ATTGCCATCTAGTTGGTCCTGTAACTTG 
HTLX-1 CAGCGCGCCCACCAACCG ACCGTGCGCGCCTAGGCC 
856e1-L GATGGTCCAGGACACATACTCCTCCTGTG TAGGCTGGTACTTGTGCTGTGTGCTGAAGA 
916c5-R AGAGTCTCTAAAAAAAACTAAGAAAATCTA GGAGCGCAGAAACAGTTGCTGTTCAG 
916c5-L ACTGCTTTTCTAGCTTATTAGGGTGT GATGAATAAAATATAAATCCACACGTC 
D6S268 CTAGGTGGCAGAGCAACATA AAAAGGAGGTCATTTTAATCG 
D6S278 GCCTGGTGCATGATCTTTTT CAGACAGAGTAGGGCATTCC 
D6S447 GCTGAAATCATGCCACTGT AGAAGGGTTCTGTGCTTGC 
28CD7-L GCAACTTGGTGATGACAGGGC TGCTAGGGGGACTTCTGATAAAG 
D6S301 CAGCCTCCACAATCATATGT AATGTGCATACGCAAAAGTC 
CCNC/EX1 GAGCGCGGTTACCGGACGGG TAGTGGGAGCTCTGCCAAAAGTT 
CCNC/EX12 ATAGTTGTGCCACAGAATAAT GTTTATTTCCAAGTGGTCCA 
BLIMP1 GCGCTCTAGATCTTAAGGATCCATTGGTTC GACATCAGTGACAATGCTGAC 
AF6q21 GCCGGGGGCGGCTGGGGGCTCCGGGCA TTCCAGCCGGCAGAGCTGTTGC 
B. Novel STSsb and ESTs developed by sequence analysis of YAC ends
YACcForward primerReverse primer
830d9-R GAAGTATGATTTAAGGGAAAAAATTA ATGAAGTGTGTGAATCACAAGGC 
853b7-L AGACTCATCAGAGCTTAGAGACAAAGATA TCCTAGGCCCAGAAACTAGAGTATTATTAG 
36CB11-L TTCCAGAAAGACCACCTGAGCAATCAAT TGTGCACCACCGATTTGGAGGCCCTT 
3GA3-R AGCCAATGAAAAGCACCAGCAAGAGATC CTCTTGGACAGGAGTAGTGACTTTTAGTC 
3GA3-L TACCAAATGTTTGAGTCTTAGAGGAGTA AGTAATAGAATCAGCAGAAACCAGTGGCA 
6EH12-R GAGGGTCACCTGCACTAATTCCTGC AGCTTTCTTTCCCTCTTCCTGCTAAGCT 
6EH12-L ACTGATCTTAGCATAGTGTGTCCCTCAT ATTGCCATCTAGTTGGTCCTGTAACTTG 
HTLX-1 CAGCGCGCCCACCAACCG ACCGTGCGCGCCTAGGCC 
856e1-L GATGGTCCAGGACACATACTCCTCCTGTG TAGGCTGGTACTTGTGCTGTGTGCTGAAGA 
916c5-R AGAGTCTCTAAAAAAAACTAAGAAAATCTA GGAGCGCAGAAACAGTTGCTGTTCAG 
916c5-L ACTGCTTTTCTAGCTTATTAGGGTGT GATGAATAAAATATAAATCCACACGTC 
D6S268 CTAGGTGGCAGAGCAACATA AAAAGGAGGTCATTTTAATCG 
D6S278 GCCTGGTGCATGATCTTTTT CAGACAGAGTAGGGCATTCC 
D6S447 GCTGAAATCATGCCACTGT AGAAGGGTTCTGTGCTTGC 
28CD7-L GCAACTTGGTGATGACAGGGC TGCTAGGGGGACTTCTGATAAAG 
D6S301 CAGCCTCCACAATCATATGT AATGTGCATACGCAAAAGTC 
CCNC/EX1 GAGCGCGGTTACCGGACGGG TAGTGGGAGCTCTGCCAAAAGTT 
CCNC/EX12 ATAGTTGTGCCACAGAATAAT GTTTATTTCCAAGTGGTCCA 
BLIMP1 GCGCTCTAGATCTTAAGGATCCATTGGTTC GACATCAGTGACAATGCTGAC 
AF6q21 GCCGGGGGCGGCTGGGGGCTCCGGGCA TTCCAGCCGGCAGAGCTGTTGC 

Underlined sequences indicate restriction sites.

STSs, sequence-tagged sites; ESTs, expressed sequence tags.

c STSs are identified by the YAC name and an L or R, indicating the left or right YAC arm, respectively.

1
Menasce L. P., Orphanos V., Santibanez-Koref M., Boyle J. M., Harrison C. J. Deletion of a common region on the long arm of chromosome 6 in acute lymphoblastic leukaemia.
Genes Chromosomes Cancer
,
10
:
26
-29,  
1994
.
2
Guan X. Y., Zhang H., Yang J. M., Wang J., Taetle R., Meltzer P. S., Trent J. M. Detection of chromosome 6 abnormalities in melanoma cell lines by chromosome arm painting probes.
Cancer Genet. Cytogenet.
,
107
:
89
-92,  
1998
.
3
Trent J. M., Salmon S. E. Karyotypic analysis of human ovarian carcinoma cells cloned in short term agar culture.
Cancer Genet. Cytogenet.
,
3
:
279
-291,  
1981
.
4
Thomas G. A., Raffel C. Loss of heterozygosity on 6q, 16q, and 17p in human central nervous system primitive neuroectodermal tumors.
Cancer Res.
,
51
:
639
-643,  
1991
.
5
Hauptschein R. S., Gamberi B., Rao P. H., Frigeri F., Scotto L., Venkatraj V. S., Giadano G., Rutner T., Edwards Y. H., Chaganti R. S., Dalla-Favera R. Cloning and mapping of human chromosome 6q26–q27 deleted in B-cell non-Hodgkin’s Lymphoma and multiple tumour types.
Genomics
,
50
:
170
-186,  
1998
.
6
Hatta Y., Yamada Y., Tomonga M., Miyoshi I., Said J. W., Koeffler H. P. Detailed deletion mapping of the long arm of chromosome 6 in adult T-cell leukemia.
Blood
,
93
:
613
-616,  
1999
.
7
Takeuchi S., Koike M., Seriu T., Bartram C. R., Schrappe M., Reiter A., Park S., Taub H. E., Kubonishi I., Miyoshi I., Koeffler H. P. Frequent loss of heterozygosity on the long arm of chromosome 6: identification of two distinct regions of deletion in childhood acute lymphoblastic leukemia.
Cancer Res.
,
58
:
2618
-2623,  
1998
.
8
Merup M., Moreno T. C., Heyman M., Ronnberg K., Grander D., Detlofsson R., Rasool O., Liu Y., Soderhall S., Juliusson G., Gahrton G., Einhorn S. 6q deletions in acute lymphoblastic leukaemia and non-Hodgkin’s lymphomas.
Blood
,
91
:
3397
-3400,  
1998
.
9
Gerard B., Cave H., Guidal C., Dastugue N., Vilmer E., Grandchamp B. Delineation of a 6cM commonly deleted region in childhood acute lymphoblastic leukemia on the 6q chromosomal arm.
Leukemia
,
11
:
228
-232,  
1997
.
10
Sherratt T. G., Morelli C., Boyle J. M., Harrison C. J. Analysis of chromosome 6 deletions in lymphoid malignancies provides evidence for a region of minimal deletion within a 2 Mb segment of 6q21.
Chromosome Res.
,
5
:
118
-124,  
1997
.
11
Walters R., Kantarjian H. M., Keating M. J., Estey E. H., Trujillo J., Cork A., McCredie K. B., Freireich E. J. The importance of cytogenetic studies in adult acute lymphocytic leukemia.
Am. J. Med.
,
89
:
579
-587,  
1990
.
12
Hough M. R., Rosten P. M., Sexton T. L., Kay R., Humphries R. K. Mapping of CD24 and homologous sequences to multiple chromosomal loci.
Genomics
,
22
:
154
-161,  
1994
.
13
Li H., Lahti J. M., Valentine M., Saito M., Reed S. I., Look A. T., Kidd V. J. Molecular cloning and chromosomal localization of the human cyclin C (CCNC) and cyclin E (CCNE) genes: deletion of the CCNC gene in human tumors.
Genomics
,
32
:
253
-259,  
1996
.
14
Jackson A., Panayiotidis P., Foroni L. The human homologue of the Drosophila tailless gene: characterization and mapping to an area of common deletion in human lymphoid leukaemia on chromosome 6q21.
Genomics
,
50
:
34
-43,  
1998
.
15
Mock B. A., Liu L., LePaslier D., Huang S. The B-lymphocyte maturation promoting transcription factor BLIMP1/PRDI-BF1 maps to D6S447 on human chromosome 6q21–q22.1 and the syntenic region of mouse chromosome 10.
Genomics
,
37
:
24
-28,  
1996
.
16
Hillion J., Le Coniat M., Joneaux P., Berger R., Bernard O. A. AF6q21, a novel partner of the MLL gene in t(6: 11)(q21:q23), defines a Forkhead transcriptional factor subfamily.
Blood
,
90
:
3714
-3719,  
1997
.
17
Bernard O. A., Hillion J., Le Coniat M., Berger R. A new case of translocation t(6: 11)(q21;q23) in a therapy-related acute myeloid leukemia resulting in an MLL-AF6q21 fusion.
Genes Chromosomes Cancer
,
22
:
221
-224,  
1998
.
18
Sinclair P. B., Green A. R., Grace C., Nacheva E. P. Improved sensitivity of BCR-ABL detection: a triple-probe three-colour fluorescence in situ hybridisation system.
Blood
,
90
:
1395
-1402,  
1997
.
19
Riley J., Butler R., Ogilvie D., Finniear R., Jenner D., Powell S., Anand R., Smith J. C., Markham A. F. A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosomes (YAC) clones.
Nucleic Acids Res.
,
18
:
2887
-2890,  
1990
.
20
Stingelbauer S., Bullinger L., Benner A., Widenberger K., Bentz M., Dohner K., Ho A. D., Lichter P., Dohner H. Incidence and clinical significance of 6q deletions in B cell chronic lymphocytic leukemia.
Leukemia
,
13
:
1331
-1334,  
1999
.