Nasopharyngeal carcinoma (NPC) is an epithelial cancer that is causally associated with Epstein-Barr virus (EBV) infection. NPC tumor biopsies are characterized histopathologically by an abundant infiltration of nonmalignant lymphocytes. We analyzed the expression of various cytokines in NPC tissues to investigate the interaction of the infiltrating lymphocytes and tumor cells. Analysis using reverse transcriptase-PCR revealed the expression of a panel of cytokines in the NPC biopsies: interleukin (IL)-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IFN-γ, tumor necrosis factor-α, transforming growth factor-β, and IL-1 receptor types I and II. Elevated expression of IL-1α and IL-1β was observed in primary tumors and NPC metastases compared to control tissues. Interestingly, this increased expression correlated with the EBV-encoded viral IL-10 transcript. To determine which cells were responsible for producing IL-1, we determined the cellular constituents of NPC biopsies by immunoflow cytometric analysis. On the basis of data from these analyses, the three major specific cell populations, epithelial cells, CD4+ T cells, and CD8+ T cells, were selected from five NPC tumors using specific, antibody-coated paramagnetic beads. Reverse transcriptase-PCR of RNA from these fractionated cells showed that transcripts of IL-1α and IL-1β were present not only in the malignant epithelial cells but also in CD4+ T cells infiltrating the tumor, a finding confirmed by immunohistochemical staining. We hypothesize that the unusual synthesis of IL-1α and IL-1β by EBV-positive epithelial cells as well as by CD4+ T cells might contribute to lymphocyte infiltration and/or tumor growth during NPC development.

Multiple effects of cytokines on the following events have been documented: regulation of cell proliferation, differentiation, and activation in embryogenesis; inflammatory processes; and immune responses (1). Recently, a role has been suggested for these inflammatory cytokines in tumorigenesis because data from animal models showed that these low molecular weight peptides might be involved in cancer formation. A transgenic mouse model of hepatocellular carcinoma clearly demonstrated that an inflammatory response was a necessary step in the progression to tumor in mice that were transgenic for the hepatitis B virus surface antigen (2). Furthermore, Oberyszyn et al.(3) demonstrated that production of inflammatory cytokines, such as IL-1α,3 TNF-α, and granulocyte macrophage colony-stimulating factor, induced leucocyte infiltration and resulted in carcinoma formation in 12-O-tetradecanoylphorbol-13-acetate-treated mice. Moreover, tumor formation could be prevented by pretreating the mice with either antibodies to or inhibitors of these inflammatory cytokines (3, 4). On the basis of the above findings, the role of these cytokines in tumor formation may be that they act as autocrine growth factors and contribute to tumor expansion and that they may have the capacity to activate several mediators, such as IL-1-induced adhesion molecules, and promote tumor cell migration and spreading (5).

NPC, which has a high incidence in Southeast Asia and East Africa, is a malignant epithelial cancer associated with a high frequency of neck and distant metastases (6). Microscopically, the NPC tumors are characterized by a heavy infiltration of nonmalignant lymphocytes, and most of these TILs have been shown to be T cells (7, 8). The characteristics of these TILs have not been well defined, although it has been suggested that, in the NPC microenvironment, the reciprocal interaction between tumor cells and TILs might play an important role in tumor development or progression. Some of the key interactive mediators of this reciprocal effect may be cytokines. This hypothesis is supported by the observation that high levels of intercellular adhesion molecule 1 and class II MHC antigens have been found on NPC tumor cells, and these unusual phenotypic changes might be induced by cytokines released by the infiltrating lymphocytes or the tumor cells themselves (9, 10). The recruitment of distinct lymphocytes and their activation in NPC biopsies also may be attributable to cytokines secreted from the tumor. Elevated expression of cytokines is a common phenomenon of tumor cell lines derived from many cancers, for example, melanomas, leukemias, and gastric and ovarian carcinomas (11, 12, 13, 14). In the case of NPC, the presence of IL-1α was demonstrated in tumors transplanted to nude mice, and strong IL-1α activity also was detected in the medium from short-term-cultured fresh biopsies (15, 16). Thus far, detailed investigations of the expression of cytokines in NPC tumors have not been well documented, perhaps because of the limited size of biopsies and the difficulties in establishing NPC cell lines.

Another important feature of NPC is its association with EBV infection. Etiological evidence comes from serological data, DNA-DNA hybridization analyses, and PCR studies (17, 18). In NPC, viral genomes were clearly demonstrable in the malignant epithelial tumor cells but not in the TILs, despite the fact that EBV readily infects primate B lymphocytes in vitro and is associated with several human lymphoproliferative diseases, such as Burkitt’s and T-cell lymphomas (19). Recently, the expression of EBV gene products involved in the latent and lytic cycles has been demonstrated in the NPC specimens, and some of these viral gene products might have the capacity to induce or influence cytokine production (20, 21). Expression of EBV latent membrane protein 1, one of the most oncogenic EBV products, enhances the production of IL-6 and IL-10 in latent membrane protein-expressing cells (22, 23). Zta, an EBV immediate-early gene product and key lytic switch transactivator, has been shown to induce the synthesis of TGF-β following transfection (24). The most interesting finding was that the product of the EBV BCRF-1 open reading frame, EBV vIL-10, is highly homologous to human IL-10 (∼70% at the amino acid level) and has immunosuppressive effects (25). In addition, the observation that activated molecules are always found on TILs of NPC might be the result of presentation of EBV antigens on tumor cells (8). On the basis of effects of cytokines on tumor formation, the progression of tumors in animal models, and the fact that EBV gene products influence cytokine expression, we considered it worthwhile to investigate the profile of cytokine expression in NPC biopsies. We wanted to understand the effects of induced cytokines on NPC tumor cells and TILs, and the data may provide important information to further our understanding of the role of these cytokines in NPC tumorigenesis.

The expression profiles of various cytokines were examined, including of IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IFN-γ, TNF-α, TGF-β, IL-1 RI and IL-1 RII, and vIL-10. The major reason for choosing these cytokines was their capacity to promote the proliferation of lymphocytes, enhance MHC antigen expression, or induce adhesion molecule production, all of which are features often observed in the NPC microenvironment. Some cytokines that could be induced by EBV viral proteins were also examined. In this investigation, biopsy specimens from primary NPC, NPC metastases, and control nasopharyngeal tissues were analyzed.

Biopsy Samples.

NPC biopsies were obtained from the Department of Otolaryngology, National Taiwan University Hospital. Biopsy samples were collected from 24 untreated primary NPC tumors, 17 NPC metastases, and 21 nasopharyngeal tissues. Detailed information for each study group is presented in Table 1. Generally, primary NPC tumors were classified into four types; T1, T2, T3, and T4, according to pathological and clinical extension (26). All tumor specimens were histopathologically diagnosed as either differentiated nonkeratinizing or undifferentiated types of NPC (27). Metastatic NPC tumors were defined by the anatomical site of metastasis. Nasopharyngeal tissues containing nonmalignant squamous epithelium and lymphocytes without pathological evidence of cancer cells were retained as control samples.

RNA Extraction and RT-PCR.

Total cellular RNA was extracted from frozen tumor biopsies or paramagnetic bead-selected cell subpopulations using TRIzol reagent (Life Technologies, Inc., Grand Island, NY), according to the manufacturer’s instructions. Single-stranded cDNA was then generated in a 20-μl RT reaction containing 1 μg of RNA as template, random primers, and SuperScript II RNase H reverse transcriptase (Life Technologies, Inc.). One μl of RT products was used for PCR amplification in a 50-μl reaction containing sense and antisense primers (400 nm), dNTPs (200 mm), 1× PCR buffer, and 1.6 units of DynaZyme II DNA polymerase (Finnzymes, Oy, Finland). All primer sequences are listed in Table 2. Amplification was carried out on a Perkin-Elmer Thermocycler for 30 cycles consisting of: 94°C, 1 min; 55°C, 1 min; and 72°C, 2 min. In some cases, a second PCR was carried out with an additional 30 cycles of amplification under the same PCR conditions, using 2 μl of the first-round products as templates. PCR products were electrophoresed on 1.6% agarose gels and visualized with ethidium bromide staining under UV light. RNA extracted from healthy donor PBMCs stimulated with 5 μg/ml PHA was used as a positive control for cytokine and receptor transcripts. Negative controls used the products of RT reactions identical to the positive control sample, but without reverse transcriptase. In addition, RNA derived from EBV-producing P3HR-1 cells served as a positive control for vIL-10 detection. Simultaneously, transcripts encoding β-actin were detected in all samples and served as internal controls.

Southern Hybridization.

RT-PCR products were transferred from the agarose gels described above onto a nitrocellulose membrane, following denaturation and neutralization. Then the blot was prehybridized for 2 h at 68°C, hybridized at 55°C with an oligonucleotide probe (probe sequences are listed in Table 2), and labeled at the 3′ end with DIG (Boehringer Mannheim, Mannheim, Germany) for 16 h. The prehybridization and hybridization buffers contained 5× SSC (0.5 m NaCl plus 0.075 m sodium citrate), 2% blocking reagent (Boehringer Mannheim), 0.1% lauroyl sarkosine, 0.02% SDS, and 0.012% calf thymus DNA. After washing twice in 2× SSC followed by 0.1× SSC at 55°C, the blot was incubated with alkaline phosphatase-conjugated anti-DIG mAb at 30°C for 1 h in a reaction mixture comprising 1% blocking reagent, 0.1 m maleic acid, and 0.15 m NaCl (pH 7.5). Thereafter, a chemiluminescent substrate (Boehringer Mannheim) was added, and the blot was exposed to X-ray film.

Immunoflow Cytometric Analysis of Nonepithelial Cells from NPC Biopsies.

Monocellular suspensions were obtained from four fresh NPC biopsies by mechanically dissociating and passing it through a nylon mesh. After absorbing the epithelial cells using Ber-EP4 mAb-coated paramagnetic beads (Dynal, Oslo, Norway; Ref. 28), the remaining cells were pelleted and resuspended in staining medium (RPMI 1640 plus 1% fetal bovine serum and 0.1% sodium azide). Various FITC- or phycoerythrin-conjugated mAbs, directed against CD3, CD4, CD8, CD14, CD16, CD19, CD45, CD56, and CD66b (all from Immunotech, Marseille, France), were added to the staining medium. Freshly prepared, total peripheral WBC were used as a positive control for immunoflow cytometric assay. After a 1-h incubation at 4°C, unbound mAb was removed by washing the cells with washing medium (PBS plus 1% fetal bovine serum and 0.1% sodium azide). Cell pellets were resuspended in staining buffer and analyzed by immunoflow cytometry on a FACScan (Becton Dickinson, San Jose, CA) using CellQuest software.

Isolation of Specific Cell Populations from NPC Biopsies Using Paramagnetic Beads.

Cell suspensions, prepared from five fresh NPC biopsies, were first incubated with Ber-EP4 mAb-coated paramagnetic beads at 4°C for 45 min. The selected epithelial cells were washed five times with PBS containing 1% FCS. The remaining cells were then sequentially incubated with CD4 and CD8 mAb-coated beads. To examine the purity of these selected cells, a proportion of bound CD4+ or CD8+ T cells was released from the beads by reaction with DETACHa BEAD competing antibodies (Dynal), and the released cells were analyzed by immunoflow cytometry to check their purity. The purity of each bead-selected cell population was >95%. Total RNA was extracted from bead-binding epithelial cells, CD4+ T cells, and CD8+ T cells and prepared for RT-PCR.

Immunohistochemical Staining.

Expression of IL-1 protein in NPC tumors was detected using a standard immunohistochemical assay with some modifications. Frozen sections of NPC biopsies were fixed in a methanol and acetone mixture (methanol:acetone = 1:1, v/v) at −20°C for 7 min, immersed in 3% H2O2 (diluted in PBS) for 20 min to inactivate endogenous peroxidase and then incubated with avidin and d-biotin (Zymed, San Francisco, CA) to block endogenous cellular biotin. After saturating with 6% normal goat serum, the sections were stained by a routine, avidin-biotin complex reaction method. Briefly, sections were incubated for 1 h with rabbit anti-IL-1α or anti-IL-1β polyclonal antibodies (1:250 dilution; Genzyme, Cambridge, MA) at room temperature, followed by biotin-conjugated goat anti-rabbit IgG antibody and avidin-peroxidase mixture (Dako, Carpinteria, CA). Finally, the reactions were developed using diaminobenzidine as substrate (Dako). Sections were counterstained with Mayer’s hematoxylin. PBMCs, stimulated for 24 hours with PHA, were stained as an IL-1-positive control. Negative controls were identical specimens processed simultaneously with the omission of the primary antibody.

Examination of Cytokine Expression Profiles in NPC Biopsies by RT-PCR.

To determine the patterns of expression of cytokines in NPC, 24 primary NPC, 17 NPC metastases, and 21 control nasopharyngeal tissue samples were analyzed for the presence of cytokine transcripts using RT-PCR followed by Southern hybridization. The RT-PCR patterns for IFN-γ, IL-1α, IL-1β, IL-10, and vIL-10 in the various samples are shown in Fig. 1. Two patterns of expression are seen. (a) Some cytokines were expressed in all three groups of tissues: primary NPC, NPC metastases, and control tissues; cytokines displaying this pattern included IFN-γ, one of the major Th1 cytokines, and IL-10, one of the major Th2 cytokines. (b) Some cytokines, including two major inflammatory cytokines, IL-1α and IL-1β, were detectable in the majority of primary NPC biopsies (17 of 24 and 17 of 24 for IL-1α and IL-1β, respectively) and NPC metastases (9 of 17 and 12 of 17, respectively) but were very rarely detected or undetected in control tissues (1 of 21 and 0 of 21, respectively). Furthermore, vIL-10 expression exhibited the same pattern as IL-1α and IL-1β, except that more cases were positive (Fig. 1). In this investigation, the primers and probes for IL-10 and vIL-10 were designed so that the products could be distinguished (29). A notable finding is the coexpression of IL-1α, IL-1β, and vIL-10. The expression of vIL-10 in most primary NPC biopsies and NPC metastases confirms EBV expression and its association with NPC (18). However, no significant correlation was found between the expression of any cytokine and the tumor stage of primary NPC or the localization of metastasized NPC (Fig. 1).

Extensive RT-PCR assays were carried out to analyze the expression of other related cytokines, and the compiled results are summarized in Table 3. A percentage was calculated for the expression of each cytokine on the basis of the number of positive cases in each group of biopsies. IL-2, another Th1-specific cytokine, was detected in most primary NPC biopsies and neck NPC metastases; this was similar to the finding for IFN-γ, except that IL-2 was never detected in distant metastatic lesions, such as those in the skin, lungs, and liver (data not shown). Other Th2-specific cytokines, including IL-4, IL-5, and IL-6, were also detectable in most samples (Table 3). In addition, the transcripts of TNF-α, TGF-β, IL-1 RI, and IL-1 RII could be amplified from either NPC or from control samples. In this study, it was noted that most of the examined cytokines could be detected in primary NPC, NPC metastases, and nasopharyngeal control tissues. However, IL-1α and IL-1β, along with vIL-10, were demonstrated only in NPC biopsies and in metastatic NPC specimens and were not detected in control nasopharyngeal tissues.

Phenotypic Analysis of Nonepithelial Cell Compartments of NPC Biopsies.

To determine which cell types were responsible for the production of IL-1, we undertook a phenotypic analysis of the cellular components of NPC biopsies using immunoflow cytometric assays. After mechanical disruption, cell suspensions isolated from four fresh NPC lesions were incubated with the Ber-EP4 mAb to absorb epithelial components. The remaining cells were collected, and immunoflow cytometric analysis was used to analyze the nonepithelial cell populations. Nine mAbs that reacted with leukocyte markers were used to differentiate the cell populations. These mAbs recognized CD45 (marker on all leukocytes), CD3 (marker on all T lymphocytes), CD4 (marker on a subset of T lymphocytes), CD8 (marker on a subset of T lymphocytes), CD14 (marker on monocytes), CD19 (marker on B lymphocytes), CD56 plus CD16 (marker on NK cells), and CD66b (marker on granuolocytes). The immunoflow cytometric results in Fig. 2,A show that the major cell populations in the nonepithelial compartment of one NPC biopsy, according to antibody recognition, were total leukocytes (CD45+; 95.65%), CD4+ T cells (26.65%), CD8+ T cells (39.95%), B lymphocytes (CD19+ CD3; 18.70%), monocytes (CD45+ CD14+; 2.00%), granulocytes (CD66b+; 0.40%), and NK cells (CD56+ CD16+ CD3; 0.80%). However, in our immunoflow cytometric assay, there were some small, undefined subpopulations that were not stained by any of our antibodies (Fig. 2,A). Four fresh NPC biopsies were analyzed to verify the cell populations in the nonepithelial compartment. The percentage of each cell population was calculated on the basis of total antibody-positive cells, and the data are shown in Fig. 2,B. We found that the cells in tumor biopsies could be divided into several major groups. The most abundant population consisted of CD4+ Th cells (27.86–35.68%). The second-most prominent population exhibited the CD8 marker (10.4–41.77%), indicating that the presence of cytotoxic T lymphocytes. The third population was CD19+ B cells (6.19–37.35%). Finally, the smaller populations included monocytes (CD45+ CD14+; 2.09–12.54%), granuocytes (CD66b+; 0.42–4.71%), and NK cells (CD56+ CD16+ CD3; 0.74–1.91%). As shown in Fig. 2 B, a similar pattern was observed for four NPC specimens, although there were some variation. Our overall conclusion is that the nonepithelial cell compartment of NPC tumors comprises three major cell populations: CD4+ T cells, CD8+ T cells, and B cells. To confirm these findings, immunohistochemical assays were carried out to check the phenotype and localization of the cells infiltrating NPC biopsies. The immunostaining clearly demonstrated that all these three cell types were major components of the NPC tumor mass but their distributions varied; T cells were located in the tumor-infiltrated area and in the stroma, whereas B cells were frequently detected in the stroma (data not shown). This result is consistent with some reports of the detection of B cells in NPC tissues by immunohistochemistry (30, 31).

Expression of IL-1 Transcripts in Epithelial and CD4+ T Cells in NPC Biopsies.

RT-PCR and immunohistochemical analyses were carried out to determine which cell subpopulation was the major producer of IL-1. For RT-PCR, RNA was isolated from bead-selected, CD4+ T cells, CD8+ T cells, and epithelial cells from five fresh primary NPC cases. In all five biopsies tested, there was a significant signal of IL-1β expression in CD4+ T cells and in epithelial cells, indicating that this inflammatory gene was expressed predominantly in NPC in CD4+ T cells and in epithelial cells but not in CD8+ T cells (Fig. 3, middle). Simultaneously, the expression of the IL-1α gene also was detected both in epithelial cells and in CD4+ T cells of NPC biopsies (Fig. 3, top). In one of the biopsies, IL-1α transcripts were also detected in CD8+ cells. Detection of β-actin gene expression was the internal control for RT-PCR analysis (Fig. 3, bottom).

Distribution of IL-1 Proteins in NPC Sections.

To confirm the RT-PCR results, immunohistochemistry was carried out to determine whether the transcripts of IL-1 were translated and where the IL-1 protein was located in the biopsy sections. In this assay, the frozen specimens from the same NPC patients were stained with rabbit polyclonal anti-IL-1α and anti-IL-1β antibodies. The IL-1α (Fig. 4,A) and IL-1β (Fig. 4,B) proteins were detected in biopsy sections at significantly higher levels than in the negative controls (Fig. 4,C). Microscopically, epithelial carcinoma cells were those with a large nucleolus, and positive signals for IL-1α and IL-1β were located in the cytoplasm and plasma membrane as well as intercellular areas. In the same sections, lymphoid cells were smaller cells with a central nucleolus and a discrete rim of cytoplasm, whereas the IL-1 protein was distributed in the cytoplasm and in the plasma membrane of IL-1-expressing, infiltrating lymphocytes (Fig. 4, A and B, arrows).

We investigated the expression of a panel of cytokines in NPC biopsies, NPC metastases, and control tissues, and the results are summarized in Table 3. Transcripts encoding Th1- and Th2-specific cytokines, such as IL-2, IFN-γ, IL-4, IL-5, IL-6, and IL-10 and other cytokines and receptors, such as TNF-α, TGF-β, IL-1 RI, and IL-1 RII, were detectable by RT-PCR in most of the NPC biopsies, as well as NPC metastases and control nasopharyngeal tissues. These expression profiles were consistent with the histopathological observation of extensive infiltration of the tumors by T lymphocytes (7, 8). Furthermore, there were some novel findings, in that IL-1α- and IL-1β-specific transcripts were both detected in 17 of 24 NPC tumors. These two inflammatory cytokines were rarely detected or undetectable in the nasopharyngeal control tissues (Fig. 2). Moreover, using selection by paramagnetic beads prior to the RT-PCR assay, we demonstrated that both epithelial and CD4+ T cells expressed the IL-1 transcripts (Fig. 3). Immunohistochemistry confirmed the detection of IL-1 in malignant tumor cells and in lymphoid cells (Fig. 4). To our knowledge, this is the first report of detection of IL-1α and IL-1β in NPC tumor cells and infiltrating lymphocytes using two different assays.

The capacity of EBV to induce or affect the expression of cytokines has been studied intensively in EBV-immortalized, lymphoblastoid cell lines. Several have been shown to express IL-1, which acts an autocrine growth factor, although the mechanism of its induction is not clear (32, 33). In NPC, which is strongly associated with EBV, only Tursz and his colleagues (15, 16) have demonstrated the detection of IL-1α activity. Roberge et al.(34) reported that EBV-infected neutrophils produce IL-1. However, in our phenotypic analysis of NPC, the percentage of granulocytes (CD66b+) in the nonepithelial compartment was low (0.42–4.71%), and cells with multiple nuclei were seen very rarely following immunostaining (data not shown). On the basis of RT-PCR and immunohistochemical data, we believe that both tumor cells and lymphocytes synthesize IL-1, but we still cannot discount the possibility that the neutrophils in NPC biopsies also produce IL-1.

Initially, IL-1 genes are expressed as two inactive, precursor proteins that are processed to their active forms by specific proteinases. The mature products, IL-1α and IL-1β, share 22% amino acid sequence similarity, and both can transduce signals through binding the IL-1 receptor (35). Generally, synthesis of IL-1 is up-regulated in response to infection or tissue damage, and IL-1 has been implicated as a major mediator of a variety of host defense mechanism, including induction of fever, inflammation, and immune cell activation (36). One likely explanation of the pleiotropic biological effects of IL-1 is that it is synthesized not only by peripheral blood monocytes but also by many other cell lineages, including endothelial cells, keratinocytes, and activated T cells (37, 38). We demonstrated that both IL-1α and IL-1β could be synthesized by epithelial tumor cells and CD4+ T cells in NPC biopsies (Figs. 3and 4). Notably, the effects of IL-1 are not restricted to activation of immune cells and include enhancing chemotaxis and stimulating migration of IL-1-responsive cells. Therefore, secretion of IL-1 by tumor cells might be one of the stimuli for the CD4+ and CD8+ T lymphocyte infiltration typical of NPC.

A role has been sought for IL-1 in malignancy using in vitro and in vivo systems. In vitro, IL-1α or IL-1β may be produced spontaneously from cultured tumor cell lines, and they appear to act directly as autocrine factors, promoting tumor cell growth (11, 12, 13, 14) or to function indirectly to enhance tumor growth by inducing the synthesis of other cytokines, receptors, and adhesion molecules. In vivo, Robertson and colleagues (3, 4) demonstrated that either pre-treatment with anti-IL-1 antibody or injection of a proinflammatory cytokine inhibitor could prevent carcinomas induced by 12-o-tetradecanoylphorbol-13-acetate in mice, strongly suggesting that the expression of IL-1 is involved in cancer formation. Also, the production of IL-1 from melanoma cell lines correlates with their ability to metastasize to the liver (11, 39). Thus, high levels of expression of IL-1α (71 and 53%) and IL-1β (71 and 71%) in NPC and NPC metastases biopsies (Table 3), respectively, may indicate that IL-1 is an important candidate for involvement in NPC tumorigenesis and/or metastasis.

IL-1α is produced continuously by human T-cell lymphotrophic virus type I-transformed cell lines, and the Tax protein of human T-cell lymphotrophic virus type I has been implicated in transactivating the promoter of the IL-1α gene (40). Several EBV viral products reportedly are expressed in NPC biopsies, and we wondered whether, in this tumor microenvironment, cytokine production by tumor cells or infiltrating lymphocytes might be initiated by EBV gene products. Some of the viral proteins expressed in NPC have been shown to influence cytokine expression (22, 23, 24). In this study, the pattern of IL-1 expression detected by RT-PCR correlated with the presence of EBV in the NPC biopsy (Fig. 1). This result may indicate that malignant, EBV-containing epithelial cells contribute to the induction and synthesis of IL-1. Our studies in the future will aim to identify which EBV-encoded protein(s) are involved in IL-1 production.

In summary, there is a complex interplay between EBV infection, cytokine production, and NPC formation. The results presented in this paper provide information about the major cellular compartments and profiles of cytokine expression in NPC biopsies, and the unique expression of IL-1α and IL-1β in these tumors. The expression of these cytokines probably also indicates that these T lymphocytes are activated and functional. However, the mechanisms of induction and significant biological effects of these cytokines remain to be investigated.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

      
1

This work was supported by the Department of Health Grant DOH 88-TD-1007, National Science Council Grant NSC 88-2314-B002-152, and Department of Health, Executive Yuan Grants DOH 84-HR-315 and DOH 85-HR-315.

            
3

The abbreviations used are: IL, interleukin; TNF-α, tumor necrosis factor-α; NPC, nasopharyngeal carcinoma; TIL, tumor-infiltrating lymphocyte; TGF-β, transforming growth factor-β; vIL-10, viral IL-10; IL-1 RI and RII, IL-1 receptor I and II, respectively; RT-PCR, reverse transcriptase-PCR; RT, reverse transcription; PBMC, peripheral blood mononuclear cell; PHA, phytohemagglutinin; DIG, digoxigenin; mAb, monoclonal antibody; NK, natural killer.

Fig. 1.

Detection of cytokine and EBV vIL-10 expression in primary NPC, NPC metastases, and nasopharyngeal control tissues by RT-PCR and Southern hybridization. Total RNA was extracted from each biopsy and subjected to RT-PCR. After electrophoresis, RT-PCR products were transferred to a membrane and hybridized with specific DIG-labeled oligonucleotides as described in “ Materials and Methods.” Details concerning the specimen source and NPC classification are given in Table 1. Details concerning primer and probe sequences are listed in Table 2. RNA extracted from 24-h PHA-stimulated PBMCs served as a positive control in all cases, except for detection of EBV vIL-10 expression, in which RNA extracted from EBV-positive P3HR-1 cells was used the template. The negative control used RNA extracted from 24-h PHA-stimulated PBMCs, but the reverse transcriptase was omitted. RNA quality was confirmed by amplification of a β-actin amplicon.

Fig. 1.

Detection of cytokine and EBV vIL-10 expression in primary NPC, NPC metastases, and nasopharyngeal control tissues by RT-PCR and Southern hybridization. Total RNA was extracted from each biopsy and subjected to RT-PCR. After electrophoresis, RT-PCR products were transferred to a membrane and hybridized with specific DIG-labeled oligonucleotides as described in “ Materials and Methods.” Details concerning the specimen source and NPC classification are given in Table 1. Details concerning primer and probe sequences are listed in Table 2. RNA extracted from 24-h PHA-stimulated PBMCs served as a positive control in all cases, except for detection of EBV vIL-10 expression, in which RNA extracted from EBV-positive P3HR-1 cells was used the template. The negative control used RNA extracted from 24-h PHA-stimulated PBMCs, but the reverse transcriptase was omitted. RNA quality was confirmed by amplification of a β-actin amplicon.

Close modal
Fig. 2.

Phenotypic analysis of cells in the nonepithelial compartment of NPC biopsies using an immunoflow cytometric assay. A, suspension cells isolated from the tumor lesion of NPC case 27, after depleting epithelial cells with Ber-EP4 mAb-coated beads, as described in “Materials and Methods,” were stained with fluorescence-labeled mAbs against CD45 (marker on all leukocytes) and CD14 (marker on monocytes; a); CD3 (marker on T lymphocytes) and CD56 plus CD16 (marker on NK cells; b); CD3 and CD19 (marker on B lymphocytes; c); CD4 (marker on a subset of T lymphocytes) and CD8 (marker on a subset of T lymphocytes; d); CD66b (marker on granuocytes; f); and irrelevant control antibodies (mouse IgG1 and IgG2a; e). B, nonepithelial cell populations from four NPC biopsies (NPC cases 25–28) were detected by immunoflow cytometric assay, as described in A. Columns, percentages of each cell type, on the basis of the total number of immunostaining-positive cells.

Fig. 2.

Phenotypic analysis of cells in the nonepithelial compartment of NPC biopsies using an immunoflow cytometric assay. A, suspension cells isolated from the tumor lesion of NPC case 27, after depleting epithelial cells with Ber-EP4 mAb-coated beads, as described in “Materials and Methods,” were stained with fluorescence-labeled mAbs against CD45 (marker on all leukocytes) and CD14 (marker on monocytes; a); CD3 (marker on T lymphocytes) and CD56 plus CD16 (marker on NK cells; b); CD3 and CD19 (marker on B lymphocytes; c); CD4 (marker on a subset of T lymphocytes) and CD8 (marker on a subset of T lymphocytes; d); CD66b (marker on granuocytes; f); and irrelevant control antibodies (mouse IgG1 and IgG2a; e). B, nonepithelial cell populations from four NPC biopsies (NPC cases 25–28) were detected by immunoflow cytometric assay, as described in A. Columns, percentages of each cell type, on the basis of the total number of immunostaining-positive cells.

Close modal
Fig. 3.

Detection of IL-1α and IL-1β expression in epithelial cells, CD4+ T cells, and CD8+ T cells from NPC biopsies using RT-PCR and Southern hybridization. RNA was prepared from CD4+ T cells, CD8+ T cells, and epithelial cells (epi) selected specifically from five fresh primary NPC cases (NPC cases 29–33) using paramagnetic beads and used as template for RT-PCR, as described in “Materials and Methods.” Lane +, RT-PCR products of IL-1α and IL-1β amplification of an RNA template extracted from PHA-stimulated PBMCs. Products of RT-PCR amplification of β-actin served as the RNA quality control.

Fig. 3.

Detection of IL-1α and IL-1β expression in epithelial cells, CD4+ T cells, and CD8+ T cells from NPC biopsies using RT-PCR and Southern hybridization. RNA was prepared from CD4+ T cells, CD8+ T cells, and epithelial cells (epi) selected specifically from five fresh primary NPC cases (NPC cases 29–33) using paramagnetic beads and used as template for RT-PCR, as described in “Materials and Methods.” Lane +, RT-PCR products of IL-1α and IL-1β amplification of an RNA template extracted from PHA-stimulated PBMCs. Products of RT-PCR amplification of β-actin served as the RNA quality control.

Close modal
Fig. 4.

Determination of the localization of IL-1α and IL-1β in NPC biopsies by immunohistochemical staining. Five-μm frozen sections of the NPC-30 biopsy specimen were stained with polyclonal antibodies against IL-1α (A) and IL-1β (B). Positive (dark brown) staining revealed that both IL-1α (A) and IL-1β (B) were distributed mainly in the cytoplasm, plasma membrane, and intercellular regions of tumor cells (TC; with large nucleoli). Both IL-α and IL-1β also were detected in some lymphocytes (arrows in A and B). Negative controls were carried out on parallel sections with the omission of the primary antibody (C).

Fig. 4.

Determination of the localization of IL-1α and IL-1β in NPC biopsies by immunohistochemical staining. Five-μm frozen sections of the NPC-30 biopsy specimen were stained with polyclonal antibodies against IL-1α (A) and IL-1β (B). Positive (dark brown) staining revealed that both IL-1α (A) and IL-1β (B) were distributed mainly in the cytoplasm, plasma membrane, and intercellular regions of tumor cells (TC; with large nucleoli). Both IL-α and IL-1β also were detected in some lymphocytes (arrows in A and B). Negative controls were carried out on parallel sections with the omission of the primary antibody (C).

Close modal
Table 1

Characteristics of study groups

SamplesNo. of cases
T classification of primary NPCa 24 
 T1 
 T2 14 
 T3 
 T4 
 Recurrence (R) 
Anatomical site of metastatic NPC 17 
 Neck soft tissue (ST) 
 Neck lymph node (LN) 
 Skin 
 Lung 
 Liver 
Nasopharyngeal tissuesb 21 
 Lymphoid hyperplasia (LH) 19 
 Adenoid 
SamplesNo. of cases
T classification of primary NPCa 24 
 T1 
 T2 14 
 T3 
 T4 
 Recurrence (R) 
Anatomical site of metastatic NPC 17 
 Neck soft tissue (ST) 
 Neck lymph node (LN) 
 Skin 
 Lung 
 Liver 
Nasopharyngeal tissuesb 21 
 Lymphoid hyperplasia (LH) 19 
 Adenoid 
a

Clinical definition of NPC types: T1, primary soft-tissue tumor only; T2, primary tumor extending into the nose, oropharynx, or pterygoid fossa; T3, tumor involved intratemporal fossa, cranial bone, or cranial nerve; T4, primary tumor extending into the orbital or cranial cavity (26). According to the WHO criteria for typing (27), 24 primary NPC were subdivided into differentiated nonkeratinizing (6 cases) and undifferentiated carcinoma (18 cases).

b

Nasopharyngeal tissues without evidence of cancer in pathological examination were used as controls.

Table 2

Nucleotide sequences used for PCR and Southern hybridization analysis

GenePrimer/probeSequence (5′→′)Length of product (bps)
IL-1α Sense ATGGCCAAAGTTCCAGACATGTTTG 808 
 Antisense GGTTTTCCAGTATCTGAAAGTCAGT  
 Probe ATTGAGGGCGTCATTCAGGATGAATTCGTA  
IL-1β Sense TACGAATCTCCGACCACCACTACAG 295 
 Antisense TGGAGGTGGAGAGCTTTCAGTTCATATG  
 Probe CAGACATCACCAAGCTTTTTTGCTG  
IL-2 Sense TACAGGATGCAACTCCTGTCTTGCATTGCA 395 
 Antisense GTTGCTGTCTCATCAGCATATTCACACATG  
 Probe CAGTGTCTAGAAGAAGAACTCAAACCTCTG  
IL-4 Sense TGCCTCCAAGAACACAACTG 224 
 Antisense AACGTACTCTGGTTGGCTTC  
 Probe TTGTGCCTGTGGAACTGCTGTG  
IL-5 Sense CACCAACTGTGCACTGAAGAAA 213 
 Antisense CCACTCGGTGTTCATTACACCA  
 Probe GGTACTGTGGAAAGACTATTC  
IL-6 Sense ATGAACTCCTTCTCCACAAGCGC 628 
 Antisense GAAGAGCCCTCAGGCTGGACTG  
 Probe CTCCTCATTGAATCCAGATTGGAAGCATCC  
IL-10 Sense CGCTTTCTAGCTGTTGAGCT 461 
 Antisense CACTGCAACTTCCATCTCCT  
 Probe CACCATGTTGACCAGGCTGGTT  
TNF-α Sense GAGTGACAAGCCTGTAGCCCATGTTGTAGCA 444 
 Antisense GCAATGATCCCAAAGTAGACCTGCCCAGACT  
 Probe ATCTCTCAGCTCCACGCCATTGGCCAGGAG  
TGF-β1 Sense GCCCTGGACACCAACTATTGCT 161 
 Antisense AGGCTCCAAATGTAGGGGCAGG  
 Probe TGCGGAAGTCAATGTACAGCTGCCGCACGC  
IFN-γ Sense GCAGAGCCAAATTGTCTCCT 290 
 Antisense ATGCTCTTCGACCTCGAAAC  
 Probe CTCCTTTTTCGCTTCCCTGTTTTAG  
IL-1 RI Sense CTTTGGTACAGGGATTCCTGCTATG 500 
 Antisense CAGAACCTTGTCTTTGCAGACTGTG  
 Probe CGATTCTGGCATTTTCTCATAGTCT  
IL-1 RII Sense AGTTTCTGCCTTCACCCTTCAG 555 
 Antisense TGTACGAGTAAGTGAGTGGTCC  
 Probe TTCACTCAGGTCAGGGCATACT  
vIL-10 Sense CGAAGGTTAGTGGTCACTCT 506 
 Antisense CACCTGGCTTTAATTGTCATG  
 Probe TACCTGGAGGAAGTCATGCC  
β-actin Sense TTCTACAATGAGCTGCGTGT 636 
 Antisense GCCAGACAGCACTGTGTTGG  
GenePrimer/probeSequence (5′→′)Length of product (bps)
IL-1α Sense ATGGCCAAAGTTCCAGACATGTTTG 808 
 Antisense GGTTTTCCAGTATCTGAAAGTCAGT  
 Probe ATTGAGGGCGTCATTCAGGATGAATTCGTA  
IL-1β Sense TACGAATCTCCGACCACCACTACAG 295 
 Antisense TGGAGGTGGAGAGCTTTCAGTTCATATG  
 Probe CAGACATCACCAAGCTTTTTTGCTG  
IL-2 Sense TACAGGATGCAACTCCTGTCTTGCATTGCA 395 
 Antisense GTTGCTGTCTCATCAGCATATTCACACATG  
 Probe CAGTGTCTAGAAGAAGAACTCAAACCTCTG  
IL-4 Sense TGCCTCCAAGAACACAACTG 224 
 Antisense AACGTACTCTGGTTGGCTTC  
 Probe TTGTGCCTGTGGAACTGCTGTG  
IL-5 Sense CACCAACTGTGCACTGAAGAAA 213 
 Antisense CCACTCGGTGTTCATTACACCA  
 Probe GGTACTGTGGAAAGACTATTC  
IL-6 Sense ATGAACTCCTTCTCCACAAGCGC 628 
 Antisense GAAGAGCCCTCAGGCTGGACTG  
 Probe CTCCTCATTGAATCCAGATTGGAAGCATCC  
IL-10 Sense CGCTTTCTAGCTGTTGAGCT 461 
 Antisense CACTGCAACTTCCATCTCCT  
 Probe CACCATGTTGACCAGGCTGGTT  
TNF-α Sense GAGTGACAAGCCTGTAGCCCATGTTGTAGCA 444 
 Antisense GCAATGATCCCAAAGTAGACCTGCCCAGACT  
 Probe ATCTCTCAGCTCCACGCCATTGGCCAGGAG  
TGF-β1 Sense GCCCTGGACACCAACTATTGCT 161 
 Antisense AGGCTCCAAATGTAGGGGCAGG  
 Probe TGCGGAAGTCAATGTACAGCTGCCGCACGC  
IFN-γ Sense GCAGAGCCAAATTGTCTCCT 290 
 Antisense ATGCTCTTCGACCTCGAAAC  
 Probe CTCCTTTTTCGCTTCCCTGTTTTAG  
IL-1 RI Sense CTTTGGTACAGGGATTCCTGCTATG 500 
 Antisense CAGAACCTTGTCTTTGCAGACTGTG  
 Probe CGATTCTGGCATTTTCTCATAGTCT  
IL-1 RII Sense AGTTTCTGCCTTCACCCTTCAG 555 
 Antisense TGTACGAGTAAGTGAGTGGTCC  
 Probe TTCACTCAGGTCAGGGCATACT  
vIL-10 Sense CGAAGGTTAGTGGTCACTCT 506 
 Antisense CACCTGGCTTTAATTGTCATG  
 Probe TACCTGGAGGAAGTCATGCC  
β-actin Sense TTCTACAATGAGCTGCGTGT 636 
 Antisense GCCAGACAGCACTGTGTTGG  
Table 3

Expression of cytokines and receptors in primary NPC, metastatic NPC, and control tissues

IFN-γIL-2IL-4IL-5IL-6IL-10TNF-αIL-1αIL-1βIL-1RIIL-1RIITGF-βvIL-10
Primary NPC 100a (24/24) 96 (23/24) 75 (18/24) 46 (11/24) 71 (17/24) 96 (23/24) 71 (17/24) 71 (17/24) 71 (17/24) 88 (21/24) 83 (20/24) 63 (15/24) 92 (22/24) 
Metastatic NPC f94 (16/17) 53 (9/17) 65 (11/17) 53 (9/17) 59 (10/17) 100 (17/17) 71 (12/17) 53 (9/17) 71 (12/17) 94 (16/17) 53 (9/17) 65 (11/17) 94 (16/17) 
Control tissues f95 (20/21) 95 (20/21) 90 (19/21) 67 (14/21) 57 (12/21) 100 (21/21) 76 (16/21) 5 (1/21) 0 (0/21) 86 (18/21) 95 (20/21) 57 (12/21) 0 (0/21) 
IFN-γIL-2IL-4IL-5IL-6IL-10TNF-αIL-1αIL-1βIL-1RIIL-1RIITGF-βvIL-10
Primary NPC 100a (24/24) 96 (23/24) 75 (18/24) 46 (11/24) 71 (17/24) 96 (23/24) 71 (17/24) 71 (17/24) 71 (17/24) 88 (21/24) 83 (20/24) 63 (15/24) 92 (22/24) 
Metastatic NPC f94 (16/17) 53 (9/17) 65 (11/17) 53 (9/17) 59 (10/17) 100 (17/17) 71 (12/17) 53 (9/17) 71 (12/17) 94 (16/17) 53 (9/17) 65 (11/17) 94 (16/17) 
Control tissues f95 (20/21) 95 (20/21) 90 (19/21) 67 (14/21) 57 (12/21) 100 (21/21) 76 (16/21) 5 (1/21) 0 (0/21) 86 (18/21) 95 (20/21) 57 (12/21) 0 (0/21) 
a

The percentage of cytokine expression was calculated by individual group of tissues, i.e., (no. of positive cases in RT-PCR)/(total no. of cases in each study group).

We thank Dr. Mei-Ying Liu for providing NPC RNA and Dr. Bor-Luen Chiang for technique assistance for immunoflow cytometry analysis. We are deeply indebted to Dr. Tim J. Harrison of the Royal Free and University College Medical School of University College London for valuable discussion and for critically reviewing the manuscript.

1
Thomas H., Balkwill F. R. Effects of interferons and other cytokines on tumors in animals: a review.
Pharmacol. Ther.
,
52
:
307
-330,  
1991
.
2
Nakamoto Y., Guidotti L. G., Kuhlen C. V., Fowler P., Chisari F. V. Immune pathogenesis of hepatocellular carcinoma.
J. Exp. Med.
,
188
:
341
-350,  
1998
.
3
Oberyszyn T. M., Sabourin C. L., Bijur G. N., Oberyszyn A. S., Boros L. G., Robertson F. M. Interleukin-1 alpha gene expression and localization of interleukin-1α protein during tumor promotion.
Mol. Carcinog.
,
7
:
238
-248,  
1993
.
4
Robertson F. M., Ross M. S., Tober K. L., Long B. W., Oberyszyn T. M. Inhibition of pro-inflammatory cytokine gene expression and papilloma growth during murine multistage carcinogenesis by pentoxifylline.
Carcinogenesis (Lond.)
,
17
:
1719
-1728,  
1996
.
5
Shanley T. P., Warner R. L., Ward P. A. The role of cytokines and adhesion molecules in the development of inflammatory injury.
Mol. Med. Today
,
1
:
40
-45,  
1995
.
6
Hsu M. M. Clinical and pathological characteristics of nasopharyngeal carcinoma.
Asian J. Surg.
,
16
:
280
-288,  
1993
.
7
Shanmugaratnam K., Chan S. H., de-The G., Goh J. E. M., Khor T. H., Simons M. J., Tye C. Y. Histopathology of nasopharyngeal carcinoma: correlations with epidemiology, survival rates and other biological characteristics.
Cancer (Phila.)
,
44
:
1029
-1044,  
1979
.
8
Ferradini L., Miescher S., Stoeck M., Busson P., Barras C., Cerf-Bensussan N., Lipinski M., von Fliedner V., Tursz T. Cytotoxic potential despite impaired activation pathways in T lymphocytes infiltrating nasopharyngeal carcinoma.
Int. J. Cancer
,
47
:
362
-370,  
1991
.
9
Busson P., Zhang Q., Guillon J. M., Christopher D., Gregory C. D., Young L. S., Clausse B., Lipinski M., Rickinson A. B., Tursz T. Elevated expression of ICAM1 (CD45) and minimal expression of LFA3 (CD58) in Epstein-Barr-virus-positive nasopharyngeal carcinoma cells.
Int. J. Cancer
,
50
:
863
-867,  
1992
.
10
Thomas J. A., Iliescu V., Crawford D. H., Ellouz R., Cammoun M., de-The G. Expression of HLA-DR antigens in nasopharyngeal carcinoma: an immunohistological analysis of the tumor cells and infiltrating lymphocytes.
Int. J. Cancer
,
33
:
813
-819,  
1984
.
11
Bani M. R., Garofalo A., Scanziani E., Giavazzi R. Effect of interleukin-1β on metastasis formation in different tumor systems.
J. Natl. Cancer Inst. (Bethesda)
,
83
:
119
-123,  
1991
.
12
Yamashita U., Shirakawa F., Nakamura H. Production of interleukin 1 by adult T cell leukemia (ATL) cell lines.
J. Immunol.
,
138
:
3284
-3289,  
1987
.
13
Ito R., Kitadai Y., Kyo E., Yokozaki H., Yasui W., Yamashita U., Nikai H., Tahara E. Interleukin 1α acts as an autocrine growth stimulator for human gastric carcinoma cells.
Cancer Res.
,
53
:
4102
-4106,  
1993
.
14
Li B. Y., Mohanraj D., Olson M. C., Moradi M., Twiggs L., Carson L. F., Ramakrishnan S. Human ovarian epithelial cancer cells cultured in vitro express both interleukin 1α and β genes.
Cancer Res.
,
52
:
2248
-2252,  
1992
.
15
Busson P., Braham K., Ganem G., Thomas F., Grausz D., Lipinski M., Wakasugi H., Tursz T. Epstein-Barr virus-containing epithelial cells from nasopharyngeal carcinoma produce interleukin 1α.
Proc. Natl. Acad. Sci. USA
,
84
:
6262
-6266,  
1987
.
16
Busson P., Ganem G., Flores P., Mugneret F., Clausse B., Caillou B., Braham K., Wakasugi H., Lipinski M., Tursz T. Establishment and characterization of three transplantable EBV-containing nasopharyngeal carcinomas.
Int. J. Cancer
,
42
:
599
-606,  
1988
.
17
Old L. J., Boyse E. A., Oettgen H. F., de Harven E., Geering G., Williamson B., Clifford P. Precipitating antibody in human serum to an antigen present in cultured Burkitt’s lymphoma cells.
Proc. Natl. Acad. Sci. USA
,
56
:
1699
-1704,  
1966
.
18
Zur Hausen H., Schulte-Holthausen H., Klein G., Henle W., Henle G., Clifford P., Santesson L. EBV DNA in biopsies of Burkitt tumors and anaplastic carcinomas of the nasopharynx.
Nature (Lond.)
,
228
:
1056
-1058,  
1970
.
19
Raab-Traub N., Flynn K. The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation.
Cell
,
47
:
883
-889,  
1986
.
20
Brooks L., Yao Q. Y., Rickinson A. B., Young L. S. Epstein-Barr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts.
J. Virol.
,
66
:
2689
-2697,  
1992
.
21
Cochet C., Martel-Renoir D., Grunewald V., Bosq J., Cochet G., Schwaab G., Bernaudin J. F., Joab I. Expression of the Epstein-Barr virus immediate early gene, BZLF1, in nasopharyngeal carcinoma tumor cells.
Virology
,
197
:
358
-365,  
1993
.
22
Nakagomi H., Dolcetti R., Bejarano M. T., Pisa P., Kiessling R., Masucci M. G. The Epstein-Barr virus latent membrane protein-1 (LMP1) induces interleukin-10 production in Burkitt lymphoma lines.
Int. J. Cancer
,
57
:
240
-244,  
1994
.
23
Elioponlos A. G., Stack M., Dawson C. W., Kaye K. M., Hodgkin L., Sihota S., Rowe M., Young L. S. Epstein-Barr virus-encoded LMP1 and CD40 mediate IL-6 production in epithelial cell via an NF-κB pathway involving TNF receptor-associated factors.
Oncogene
,
14
:
2899
-2916,  
1997
.
24
Cayrol C., Flemington E. K. Identification of cellular target genes of the Epstein-Barr virus transactivator Zta: activation of transforming growth factor βigh3 (TGF-βigh3) and TGF-β1.
J. Virol.
,
69
:
4206
-4212,  
1995
.
25
Moore K. W., Vieira P., Fiorentino D. F., Trounstine M. L., Khan T. A., Mosmann T. R. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRF1.
Science (Washington DC)
,
248
:
1230
-1234,  
1990
.
26
Peng J. C., Sheen T. S., Hsu M. M. Nasopharyngeal carcinoma with dermatomyositis: analysis of 12 cases..
Arch. Otolaryngol. Head Neck Surg.
,
121
:
1298
-1301,  
1995
.
27
Shanmugaratnam K., Sobin L. H. Epithelial tumors and precancerous lesions.
Histological typing of tumors of the upper respiratory tract and ear
,
:
32
-33, Springer-Verlag Berlin  
1991
.
28
Latza U., Niedobitek G., Schwarting R., Nekarda H., Stein H. Ber-EP4: new monoclonal antibody which distinguishes epithelia from mesothelia.
J. Clin. Pathol.
,
43
:
213
-219,  
1990
.
29
Miyazaki I., Cheung R. K., Dosch H. M. Viral interleukin 10 is critical for the induction of B cell growth transformation by Epstein-Barr virus.
J. Exp. Med.
,
178
:
439
-447,  
1993
.
30
Hsu M. M., Hsu H. C., Lui L. T. Local immune reaction in nasopharyngeal carcinoma, with special reference to its prognostic evaluation.
Head Neck
,
11
:
505
-510,  
1989
.
31
Zong Y. S., Lin H., Choy D. T. K., Sham J. S. T., Wei W., Chan K. H., Ng M. H. Nasopharyngeal carcinoma and lymphoinfiltration.
Oncology
,
48
:
290
-296,  
1991
.
32
Acres R. B., Larsen A., Gillis S., Conlon P. J. Production of IL-1α and IL-1β by clones of EBV transformed, human B cells.
Mol. Immunol.
,
24
:
479
-485,  
1987
.
33
Wakasugi H., Rimsky L., Mahe Y., Kamel A. M., Fradelizi D., Tursz T., Bertoglio J. Epstein-Barr virus-containing B-cell line produces an interleukin 1 that it use as a growth factor.
Proc. Natl. Acad. Sci. USA
,
84
:
804
-808,  
1987
.
34
Roberge C. J., Poubelle P. E., Beaulieu A. D., Heitz D., Gosselin J. The IL-1 and IL-1 receptor antagonist (IL-1Ra) response of human neutrophils to EBV stimulation: preponderance of IL-1Ra detection.
J. Immunol.
,
156
:
4884
-4891,  
1996
.
35
Tocci M. J., Schmidt J. A. Interleukin-1: structure and function Remick D. G. Friedland J. S. eds. .
Cytokines in Health and Disease
,
:
1
-27, Marcel Dekker New York  
1997
.
36
Dinarello C. A. Biologic basis for interleukin-1 in disease.
Blood
,
87
:
2095
-2147,  
1996
.
37
Blanto R., Kupper T. J., McDougall J. K., Dower S. Regulation of interleukin-1 and its receptor in human keratinocytes.
Proc. Natl. Acad. Sci. USA
,
86
:
1273
-1277,  
1989
.
38
Huber M., Beuscher H. U., Rohwer P., Kurrle R., Rollinghoff M., Lohoff M. Costimulation via TCR and IL-1 receptor reveals a novel IL-1α-mediated autocrine pathway of Th2 cell proliferation.
J. Immunol.
,
160
:
4242
-4247,  
1998
.
39
Anasagastic M. J., Olaso E., Calvo F., Mendoza L., Martin J. J., Bidaurrazaga J., Vidal-Vanaclocha F. Interleukin 1-dependent and -independent mouse melanoma metastases.
J. Natl. Cancer Inst. (Bethesda)
,
89
:
645
-651,  
1997
.
40
Mori N., Shirakawa F., Saito K., Murakami S., Oda S., Eto S. Transactivation of the interleukin-1α gene promoter by human T-cell leukemia virus type I Tax in T cells.
Blood
,
84
:
1688
-1689,  
1994
.