A novel metastasis-associated gene was identified with a differential display system in murine carcinoma cells showing a high rate of metastasis to the liver. A human homologue was also identified using a PCR-based strategy. The protein coded by this gene was named cystatin-like metastasis-associated protein (CMAP) and showed 22.1–28.1% homology to human family 2 cystatins. CMAP mRNA was selectively overexpressed in all murine liver metastatic tumors but not in any pulmonary metastatic tumors examined. Transfection of CMAP antisense DNA into highly metastatic liver cells greatly decreased their metastatic potential and CMAP expression, indicating that CMAP is involved in liver metastatic ability after intravasation of malignant cells. The human homologue of CMAP was found to be expressed in various human cancer cell lines established from malignant tumors. Our discovery of this novel liver metastasis-related gene indicates a new approach to the diagnosis and/or prevention of liver metastasis of human cancer.

To establish metastases, cells must complete the following sequential steps: neovascularization, migration with invasive destruction of the extracellular matrix components at the site of the primary lesion, intravasation, transportation through the channels with survival against host immune defenses, arrest in the capillary bed of a distant organs, extravasation, and growth with angiogenesis in the secondary lesion (1, 2, 3).

For cancer therapy, the regulation and control of malignant phenotypes are matters of great concern. In attempts to identify metastasis-related genes, down-regulated genes in highly metastatic tumors, e.g., NM23(4), Kiss-1(5), cystatin M(6), CC3(7), and up-regulated genes, e.g., mts1(8), stromelysin-3(9), and thymosin β15(10), have been identified by differential/subtractive hybridization or mRNA differential display.

For further studies on metastasis, animal models are required. Several models, such as experimental metastasis by i.v. injection, intrasplenic implantation, spontaneous metastasis by s.c. implantation, intrafootpad implantation, and orthotopic transplantation, have been developed (11). The IMC-HM murine carcinoma cell line showing high metastasis to the liver was isolated from nonmetastatic IMC-LM cells in our laboratory (12). IMC-HM cells metastasized spontaneously from a s.c. site mainly to the liver and then caused lethal multiple metastases in mice. In liver slices of the dead mice, diffusive infiltration of metastatic pleomorphic tumor cells was observed with focal necrosis histologically (12). The metastases were seen from an early stage of tumor growth at the primary site. Surgical removal of the primary lesion with the inguinal plexus 3 days after implantation (day 3) resulted in almost no life prolongation because latent micrometastases in target organs had already occurred (12). “Occult” tumor cells were seen microscopically in the metastatic lesions from day 10. Gross and histological examinations showed that IMC-HM cells injected i.v. into mice exhibited similar metastatic properties to those implanted s.c., suggesting that spontaneous metastases of the cells occurs via the blood circulation, not by dissemination or the lymph system in vivo.2 Although it involves ectopic transplantation, this liver metastasis system is a useful model of micrometastasis in the liver, differing from the predominantly pulmonary metastases of Lewis lung carcinoma (13).

Besides the lungs, the liver is a common site of hematogenous metastasis of various types of carcinomas. Because the metastatic behavior of these tumors, including extensive multiple metastases, resembles that of IMC-HM cells, we tried to identify a metastasis-associated factor(s) in this model. For this, we compared the transcriptional differences between IMC-HM and IMC-LM cells by mRNA differential display, because of the close genetic backgrounds of these two cell lines. Here, we report the identification and cloning of a novel cDNA for a CMAP,3 which is transcriptionally up-regulated in IMC-HM cells as well as other liver metastatic tumor cells, and its close correlation with the liver metastatic potential of the cells in vivo.

Mice.

Female CDF1 (BALB/c × DBA/2) mice were purchased from Charles River Japan (Kanagawa, Japan). All mice were used at 5–8 weeks old.

Cell Lines.

IMC murine carcinoma cells were kindly provided by Dr. M. Ishizuka of the Institute of Microbial Chemistry (Shizuoka, Japan). IMC-HM cells were isolated in our laboratory. After the isolation of IMC-HM cells, the original IMC cells were named IMC-LM cells to distinguish them from the highly metastatic variant. The cells were passaged weekly in the peritoneal cavity of female CDF1 mice and also maintained in culture in RPMI 1640 supplemented with 10% FCS and 20 μm 2-mercaptoethanol. Clonal lines of IMC-HM cells and IMC-LM cells, named IMC-HA1 and IMC-LE5 cells, respectively, were obtained by limited dilution, followed by random selection. These cell lines did not show any notable differences from the cells before cloning in their in vivo metastatic properties, morphology, growth rate, or mCMAP expression (data not shown). IMC-HA1 cells were entrusted for maintenance and provision to the Agency of Industrial Science and Technology (Tsukuba, Japan). The ascites form murine tumors, Ehrlich, Meth A, Sarcoma 180, MH134, M-5076, L5178Y, P388, and L1210 cells, were maintained in the abdominal cavity of mice. The cells were transferred to in vitro culture at least 2 weeks before isolation of total RNA. B-16-BL6 melanoma and colon 26 carcinoma cells were cultured in vitro under the same conditions as described above. LX-1 and KP-1N cells were kindly provided from Dr. M. Inaba of Cancer Institute, the Japanese Foundation for Cancer Research (Tokyo, Japan), and Dr. A. Kono of the National Kyushu Cancer Center (Fukuoka, Japan), respectively. Lu-135, SEKI, and PSN-1 cells were gifts from Drs. T. Terasaki and T. Sekiya, respectively, of the National Cancer Center Research Institute (Tokyo, Japan). PC-13 and MKN-45 cells were purchased from Immuno-Biological Laboratories Co. (Gunma, Japan). KU812 and T24 cells were obtained from the Riken Cell Bank (Ibaraki, Japan). All other human tumors were purchased from the American Type Culture Collection (Manassas, VA).

mRNA Differential Display.

mRNA differential display was performed using a Delta RNA Fingerprinting Kit (Clontech). Total RNA was prepared from IMC-HM and IMC-LM cells using ISOGEN (Nippongene). After DNase I treatment with the MessageClean Kit (GenHunter), total RNA (2 μg) was reverse-transcribed with 200 units of Superscript II (Life Technologies, Inc.) in the presence of 0.1 μm oligo(dT) anchor primer and then amplified by PCR using different arbitrary primer sets (Clontech) with 50 units/ml of LATaq (Takara). The cycling conditions were 5 min at 94°C, 5 min at 40°C, 5 min at 68°C (1 cycle), 2 min at 94°C, 5 min at 40°C, 5 min at 68°C (2 cycles), 1 min at 94°C, 1 min at 60°C, and 2 min at 68°C (25 cycles). Two independent reaction products from both IMC-HM and IMC-LM cells were separated in 6% polyacrylamide gel with glycerol-tolerant running buffer (United States Biochemical). Differentially expressed cDNA bands were directly excised from the gel and reamplified with the same primer sets in high-stringency conditions. After subcloning into pCR II vector (Invitrogen), the proper cDNAs were sequenced by a Dye Primer Cycle Sequencing Ready Reaction (Perkin-Elmer Corp.).

Northern Blot Analysis.

Poly(A) RNA was isolated from exponentially growing cells using a Messenger RNA Isolation Kit (Stratagene) or separated from total RNA using a mRNA Separator Kit (Clontech). Samples of 2 μg of poly(A) RNA were size-fractionated in denaturing formaldehyde-agarose gel (1.0%) and transferred to a Hybond-N+ membrane (Amersham) according to the manufacturer’s recommended protocol. Filters were prehybridized for 1 h at 42°C and then hybridized by addition of denatured probe labeled with [α-32P]dCTP (Amersham), using Megaprime DNA-labeling systems (Amersham). Blotted filters were washed to a final stringency of 0.2 × SSC-0.1% SDS at 55°C. Image analysis was performed with BAS2000 (Fuji).

Southern Blot Analysis.

Genomic DNA extracted from cells with a DNA Extraction Kit (Stratagene) was digested by EcoRI (Toyobo) and loaded onto 1.0% agarose gel for electrophoretic separation. After transfer to a Hybond-N+ membrane, hybridization was performed under the same conditions as for Northern analysis. Filters were washed to a final stringency of 0.1 × SSC-0.1% SDS at 68°C.

cDNA Library Screening.

An oligo(dT)-primed cDNA library was constructed using the ZAP Express Vector (Stratagene) with poly(A) RNA obtained from an IMC-HA1 clonal line. The library was screened using a 32-labeled cDNA fragment, as a probe. pBK-CMV phagemid vector with a positive insert clone was excised from the ZAP Express Vector in vivo in the presence of ExAssist helper phage. Nucleotide sequences were determined with an ABI PRISM 337 DNA Sequencer using the Dye Primer and/or Dye Terminator Cycle Sequencing Ready Reaction (Perkin-Elmer) according to the manufacturer’s recommended protocol.

RT-PCR Analysis.

Total RNAs were extracted using ISOGEN from exponentially growing cells cultured in vitro or from normal tissues freshly excised from 5-week-old female CDF1 mice. DNase I-treated total RNA (2 μg) was reverse-transcribed using 200 units of Superscript II with 18-mer oligo(dT) primer. Aliquots of a single-strand cDNA template were diluted sufficiently to exhibit linearity between the initial template concentration and the amount of the specific product in IMC-HA1 cells. After optimization of the amount of each product, the diluted template was amplified by PCR with several pairs of specific primers. A control RT-PCR run was performed by amplifying the G3PDH gene with a specific primer set (Clontech) under the same conditions. A program for RT-PCR in a thermal cycler (Perkin-Elmer 9600) was as follows: 2 min at 94°C (1 cycle), 1 min at 94°C, 2 min at 68°C (25–35 cycles), and 5 min at 72°C (1 cycle). For genes failed that were not amplified in these stringent conditions, the following low-stringency program was used: 1 min at 94°C (1 cycle), 30 s at 94°C, 30 s at 55°C, 1 min at 72°C (30 cycles), and 5 min at 72°C (1 cycle).

Sequence Determination of hCMAP.

Total RNA extracted from human spleen (OriGene) was reverse-transcribed, and the hCMAP cDNA was amplified with the primers hCMAP-1 and hCMAP-2 or hCMAP-7 and hCMAP-8 (see below). PCR was performed as follows: 2 min at 94°C (1 cycle), 30 s at 60°C, 90 s at 72°C (30 cycles), and 5 min at 72°C (1 cycle). The PCR product was directly sequenced by dye terminator cycle sequencing using primers, hCMAP-1 through hCMAP-8, shown in the 5′–3′ orientation: hCMAP-1, ACAGACACTGCCCCCACCTGC; hCMAP-2, AATTTTAGAAGCAAATGTGATC; hCMAP-3, ACATGTCGTTCGTGCAGTTGTTG; hCMAP-4, AATTGGCAGAACTACCTGCAAG; hCMAP-5, GGTCTTGCTGAAGAGGCGGGGG; hCMAP-6, CACTGTCCCTACCCGGGCAGCC; hCMAP-7, ATCTACCCAAGAAGGCTCGGCAC; and hCMAP-8, TCTGTTAGGAGGCGCTACCATGC.

Vector Construction of Antisense Nucleotide of mCMAP and Preparation of Transfectants.

mCMAP mRNA was amplified by RT-PCR under stringent conditions with the specific primer set retaining a NheI or KpnI recognition site, mCMAP-F1 (5′-AATTCGGTACCAGCTGAAGCTACCCCACCATGCCC-3′) and mCMAP-R1 (5′-AGTCGCTAGCAGAGGAGAACAGGCACCTCAAAAC-3′), to obtain a cDNA including the open reading frame of mCMAP with the short 5′-untranslated segment. The pBK-CMV vector was cut with NheI and KpnI restriction enzymes (Toyobo) to delete the lac promoter region and the spare multicloning sites. The PCR product was also excised with the same restriction enzymes and ligated into the linear vector using the ligation kit version II (Takara) in inverse orientation. After cloning using One Shot INVαF′ cells (Invitrogen), the vector with mCMAP cDNA in an antisense orientation was extracted using a QIAfilter (Qiagen), cleaved by ApaLI treatment, and introduced into IMC-HA1 cells by electroporation using a Gene Pulser II (Bio-Rad). Transfectants stably expressing the induced vector were selected by continuous neomycin treatment at 0.3 mg/ml for 2 weeks. The neomycin-resistant cells were cloned by the limited dilution technique with increase in neomycin concentration to 0.8 mg/ml. After ∼2 weeks, 35 clones were obtained by random selection. Suitable clones were selected by analysis of reduction in the amount of their mCMAP mRNA by RT-PCR.

Analysis of Metastatic Activity in Vivo.

Exponentially growing cells in culture or in freshly prepared ascites were harvested, washed, and resuspended in PBS. The cells were inoculated into the flanks of female CDF1 mice at 5 × 104 cells/mouse for studies on spontaneous metastasis or into a tail vein at 1 × 103 cells/mouse for studies on experimental metastasis. In studies on spontaneous metastasis, the local site tumor and a lymph node were excised 3 days later. The survival times of mice were recorded, or the mice were sacrificed on day 13–15 and their liver and spleen were removed and weighed. The livers or spleens that showed a medial mass were photographed immediately or after fixation with neutralized formalin. Tumor masses at implantation sites were also examined to determine generation times in vivo. Volumes of tumors were calculated by the following formula, V = (L × W2)/2, where L = length and W = width. Gross examinations, mainly of the liver, were performed on mice with tumors that died and on surviving mice that were sacrificed.

Identification and Cloning of mCMAP.

We compared the gene expression patterns of the nonmetastatic IMC-LM and liver-metastatic IMC-HM murine carcinoma cell lines. In the mRNA fingerprint patterns amplified with each primer set of 25- or 26-mer arbitrary primer (P primer) and 30-mer oligo(dT) anchor primer (T primer), 50–200 cDNA fragments were usually distinguishable on the gel. Several candidates have been obtained with 30 different primer sets so far. One of them is a cDNA fragment, 23-1, derived from IMC-HM cells (Fig. 1 A). Its band was extracted from the gel and reamplified with the same primer set. On subcloning, we obtained the clone 23-1#2 (656 bp).

A gene transcript hybridizing with 32P-labeled 23-1#2 was confirmed by Northern analysis (Fig. 1,B). A major 1.1-kb poly(A) RNA was detected in IMC-HA1 cells, a clonal line of IMC-HM cells, but not in IMC-LE5 cells, a clonal line of IMC-LM cells, although there was no difference in the reference gene for G3PDH in the two cell lines. Similar results were obtained with IMC-HM cells and IMC-LM cells (data not shown). We named the gene mCMAP because of its structural similarity with cystatin, described below. On Southern blot analysis, two EcoRI-digested genomic DNAs of ∼5.4 kb and 3.5 kb from the two cell lines hybridized with the same probe on Northern blot analysis (Fig. 1 C).

To elucidate the total sequence of mCMAP, we screened a cDNA library derived from IMC-HA1 cells, which was constructed with the ZAP Expression Vector by applying 32P-labeled 23-1#2. In this way, a full-length cDNA clone, pBK-CMV#9.31334, was isolated (GenBank accession no. AB015224). Search of the GenBank and EMBL nucleotide sequence data bases with FastA using GCG software (Genetics Computer Group Inc., University of Wisconsin, Madison, WI), indicated that mCMAP does not show obvious homology to previously identified genes without several ESTs. Namely, AA089339 (517 bp), AA089317 (428 bp), AA423624 (328 bp), and AA537189 (178 bp) derived from murine cDNA libraries showed homologies of 99.6, 99.5, 99.4, and 96.6% over the full-stretch sequences, respectively.

Distribution of mCMAP mRNA in Various Murine Tumors and Normal Tissues.

To elucidate the extents of mCMAP transcription in various murine tumors, we designed a primer set for its specific detection by the RT-PCR. When the transcribed cDNA was serially quartered, the PCR products of mCMAP and G3PDH in IMC-HA1 cells showed linearity at under 1:4 and 1:16 dilution, respectively (data not shown). The dilution of the initial template was fixed at 1:10 for mCMAP and 1:40 for G3PDH amplification.

Total RNAs extracted from various murine tumors were reverse-transcribed and then subjected to shuttle-PCR under fixed semiquantitative conditions for IMC-HA1 cells. As shown in Fig. 2 A, mCMAP mRNA was detected only in M-5076 reticulum cell sarcoma, L5178Y lymphoma, and P388 and L1210 leukemia. All these tumor cells are known to cause multiple metastases mainly in the liver on i.v. injection into mice at 1 × 105 cells/mouse. In contrast, IMC-LE5, Ehrlich, Meth A, Sarcoma 180, and MH134 in which mCMAP mRNA is not expressed, did not metastasize on i.v. inoculation, although they showed strong tumorigenicity on s.c. or i.p. implantation. Although B-16-BL6 murine melanoma and colon 26 carcinoma tumors are well known to cause pulmonary metastases, they did not cause liver metastases detectable on gross examination.

mCMAP mRNA expression in various normal tissues from female CDF1 mice was also analyzed. As shown in Fig. 2 B, the expression of mCMAP was only detected in “lymphoid organs,” such as thymus, spleen, and lymph nodes, although its expression was less than in IMC-HA1 cells. In other tissues, no mCMAP mRNA was detected. This unique distribution of mCMAP in lymphoid organs suggests its physiological association with the immune system.

Correlation between mCMAP Expression and Metastatic Activity in Experimental Metastases.

To determine whether mCMAP is actually involved in metastasis in vivo, we prepared cells with stably reduced mCMAP expression by transfection of the antisense DNA into IMC-HA1 cells. Several clones, 57C4, 53A9, and 53E9, showed reduced mCMAP mRNA expressions of ∼49, 32, and 16%, respectively, of that of control IMC-HA1 cells (Fig. 3 A). These transfectants showed no gross alterations except in mCMAP expression and neomycin sensitivity during in vitro cultivation.

All these transfectants, including a vector control, clone 18B5, showed almost the same tumorigenicity at an inguinal site (Fig. 3,B). When IMC-HA1 cells were inoculated i.v. into mice at 1 × 103 cells/mouse, they caused liver metastases, and the mice died about 2 weeks after cell inoculation (data not shown). Then, we examined the metastatic activities of the transfectants. On day 13 after i.v. injection of the transfectants, the mice were sacrificed, and their livers and spleens were weighed (14). Clone 18B5 caused no apparent difference from IMC-HA1 in the mean weights or appearances of the liver or spleen (Fig. 3, C–E). In contrast, clones 57C4, 53A9, and 53E9, showed significantly lower metastatic activity than IMC-HA1 or 18B5 cells. The liver and spleen weights of mice were almost the same as that of mice with the nonmetastatic clone, IMC-LE5 cells (P < 0.0001 for each). Under similar conditions, the survival period of mice with the transfectants were significantly longer than that of mice with IMC-HA1 or vector control cells. In particular, one of five mice injected with clone 53E9 survived until day 60 (Table 1). There was a good inverse correlation between the extent of mCMAP expression and the survival period of mice (Table 1). Similar results were obtained in both spontaneous metastasis studies with and without tylectomy of the primary lesion (data not shown).

Sequence Determination of hCMAP.

The human homologue of CMAP (hCMAP) was identified by a PCR-based strategy. Two human ESTs, N56875 (414 bp) and N47763 (428 bp), which showed 72.0 and 75.7% homology to mCMAP, respectively, were identified in the nucleotide sequence database of a human EST project of Merck Research Laboratories. These ESTs possessed 34 bp of overlapping region, indicating that they are of the same origin (Fig. 4,A). A hybrid cDNA based on these ESTs showed high homology to mCMAP, especially around the open reading frames, indicating that this hybrid gene is a human homologue of CMAP (Fig. 4 B).

To refine the incomplete sequence of the hybrid, we designed several primers using the regions of both termini and amplified them by RT-PCR with human spleen total RNA as a template source. A 800-bp product was directly sequenced by dye terminator cycle sequencing. In this way, we determined the sequence of hCMAP (Genbank accession no. AB015225) encoding 167 amino acids. The homology between murine and human CMAP was 54.0% for the sequences of nucleotide bases and 62.3% for their complete amino acid sequences.

Protein Sequence Alignment of CMAP with Human Family 2 Cystatins.

The structure of CMAP resembles that of human family 2 cystatins classified in the cystatin superfamily, which are endogenous inhibitors of papain-like thiol proteinases, such as cathepsins (15). Human CMAP shows low homology with family 1 cystatins, stefin A or B: 15.3% on full-stretch comparison with both (data not shown). Human CMAP shows homolagies with cystatin M (also called cystatin E; Ref. 16), C, D, SN, SA, and S, and chicken cystatin in the full sequences of 22.1, 28.1, 22.5, 25.5, 25.5, 26.2, and 25.9%, respectively. hCMAP and mCMAP were aligned with human family 2 cystatins and chicken cystatin (Fig. 5). hCMAP and mCMAP showed hydrophobicity from Arg25 to Thr40 or from Leu15 to Thr36 on Kite-Doolittle analysis, respectively (data not shown), although all family 2 cystatins are practically or theoretically cleaved of the hydrophobic signal segment between 20 and 29 residues (Fig. 5). hCMAP or mCMAP have second Met at position 23 or 24 (Fig. 5, underlined sequence), respectively. The entire sequence pf CMAP may be produced as a membrane-associated protein. In contrast, if the translation is started from the second Met, the product may be a secretory protein with a putative cleavage site same as family 2 cystatins (Fig. 5). This important issue remains to be elucidated. Chicken cystatin has been extensively analyzed and shows 41.7% homology with human cystatin C. Data from x-ray diffraction and NMR spectroscopy of chicken cystatin (17, 18) reveal that the evolutionarily conserved four Cys residues at positions 121, 132, 146, and 166 in CMAP may form two disulfide bridges. In addition, three underlined segments indicated in Fig. 5, the NH2-terminal region including Gly59, Gln103-X-Val105-X-Gly107 and Val153-Phe154-Trp155, which are also present in CMAP, may be essential for interaction with the substrate (19). These sequences are highly conserved in family 2 cystatins (Fig. 5). Obvious differences between CMAP and cystatins are the Lys57 and Lys106 residues in the underlined segments, Cys residues without the consensus cystin bridges (Fig. 5, boxed sequence), and Asn residues (Fig. 5, boldface italicized sequence). No family 2 cystatin contains any basic amino acid residues in the three underlined segments, suggesting that the binding specificity of CMAP to its unknown target is different from that of cystatins. Human family 2 cystatins contain no Cys residue except signal sequences and the four consensus Cys residues near the C-OOH terminus (Cys18 in cystatin M and Cys6 in cystatin S and SA). In contrast, mCMAP has Cys residues at positions 7, 9, 19, 33, 34, 48, and 85 and hCMAP has Cys residues at positions 33, 34, 48 and 85, although it is unclear whether these Cys residues form an additional disulfide bridges. This unique NH2-terminal region might result in a different specificity of the physiological role from that of cystatins. The Asn residues at positions 84 and 124 in human and at position 84 in murine CMAP are putative glycosylation sites according to analysis with GCG software, although cystatins do not contain any putative glycosylation site except Asn137 in cystatin M.

hCMAP Expression in Tissue Culture Cell Lines.

To evaluate the expression of hCMAP, over 50 human tissue culture cell lines were subjected to RT-PCR. We found that not all tumors but some malignant cell lines, such as HL-60 acute promyelocytic leukemia; COLO 201 colorectal adenocarcinoma; PSN-1 pancreatic carcinoma; T98G glioblastoma; G361, A375, and WM-266-4 malignant melanoma; and LX-1 lung carcinoma, showed much stronger expression than normal spleen (Fig. 6). Other tumors expressed little or no hCMAP except two of three osteosarcoma cell lines, Saos-2 and U-2 OS, which showed moderate expression. Unexpectedly, few leukemias or lymphomas were high producers of hCMAP. The mammary carcinomas established from brain metastasis or pleural effusion showed almost no expression. In contrast, a high proportion of malignant melanomas were hCMAP positive. Important information was obtained from two melanoma cell lines, WM-115 and WM-266-4, derived from the primary tumor and metastatic site of a malignant melanoma of the same patient. WM-266-4 showed a much stronger signal than WM-115. Although exact metastatic lesions are not shown in the literature, hCMAP expression is up-regulated in metastatic sites rather than primary lesions in the same patient. In addition, LX-1 was also established from metastatic site. Moreover, the donor of PSN-1 was deceased by extreme liver metastasis. Pancreatic or lung cancer sometimes metastasizes to the liver. However, colon cancer is known to be the most common “seed” for liver as the “soil.” Of colorectal tumor cell lines, COLO 201 (Duke’s type D) showed a much stronger signal than DLD-1 or COLO 320DM (Duke’s type C) and LS 180 (Duke’s type B). These observations suggest that hCMAP expression may be also correlated with certain stage in progression of malignancy of some human cancers.

Here, we showed that a novel gene named CMAP is involved in liver-selective metastasis in a murine system. CMAP is not one of the metastasis-related genes previously isolated and has homology with cystatins, inhibitors of cysteine proteinases, despite their antimetastatic profiles (6, 20, 21). Because proteinases are, in general, up-regulated and/or abnormally activated in metastatic tumor cells (9, 22, 23), our observation is not consistent with the current concept of the mechanism of metastasis. Thus, our findings seem to indicate a new aspect of the molecular mechanism of metastasis.

The expression of hCMAP was also found in some malignant human cancer cells, although studies were performed with tumor cell lines (Fig. 6). For more exact information on the relation of hCMAP expression and malignant progression including metastasis, analysis of surgical or biopsy specimens may be needed. However, preliminary studies on human cancer cell lines suggested that CMAP may be also related to malignancy of some human cancers. Therefore, further investigations on the molecular mechanisms on the involvement of CMAP in liver metastasis are important. Such studies may lead to a new approach for diagnosis and prevention of liver metastasis in humans. The following are important aspects for future studies on CMAP.

We analyzed the expressions of >20 metastasis-related genes in IMC-HA1 and IMC-LE5 cells by RT-PCR. Most of them, e.g., NM23(4), calcyclin(24), and the CD44 splicing variant(25), showed almost no transcriptional differences. In contrast, mts1(8) and fibronectin(26) were reasonably up- (∼10-fold) and down- (>100-fold) regulated in IMC-HA1 cells.2 These results suggest that multiple gene alterations are required to achieve linked sequential steps in metastasis. The population of mCMAP mRNA showed the most extreme up-regulation (>100-fold) in IMC-HA1 cells compared with that in IMC-LE5 cells thus examined. All the murine tumors expressing mCMAP mRNA metastasized to the liver by i.v. inoculation and induced multiple metastases and death (data not shown). In contrast, mCMAP-negative tumors, including pulmonary metastatic carcinomas, did not metastasize to the liver. Unlike mCMAP expression, mts1 expression does not seem to be correlated with liver metastasis (data not shown). A previous report supports the observation that mts1 was poorly expressed in a spontaneous liver metastatic tumor, despite its high expression in lung or lymphnodus metastatic carcinomas (8). These results suggest that mCMAP is a possible mediator of liver metastases.

The data shown in Fig. 3 and Table 1 suggest that CMAP is mainly involved in hematogenous liver metastasis after intravasation of the tumor cells. Several possible roles of CMAP in metastasis are conceivable. First, CMAP may protect producer cells themselves from excess proteolysis or from the attack of exogenous proteinases. In contrast, CMAP may act as a positive modulator of proteinases during extravasation and infiltration into target organs by antagonizing to cystatins using the structural resemblance. Second, CMAP may act in adapting the microenvironment in metastatic lesions. There are several reports that endogenous proteinase inhibitors exert various biological activities other than as antiproteolytic functions, such as mitogenic activity (27, 28, 29, 30), chemotatic activity (31), or differentiation-inducing activity (32). Another possibility is as follows: there are several reports suggesting that factors involved in programmed cell death, such as p53(33), CC3(7), and DAP kinase (34), may be metastasis suppressors of several tumor cell lines. Possibly, CMAP may be involved in promoting survival. There is a report that the cysteine proteinase cathepsin B may be involved in apoptosis in mammary tissue (35). Furthermore, the aspartic protease, cathepsin D (36), and several ICE-like cysteine peptidases (37) are considered to play roles in programmed cell death, although cathepsins and caspases are categorized as different types (15). The actual target of CMAP in liver metastasis remains to be elucidated.

Recent discoveries of several metastasis suppressors were important not only for specifying endogenous metastatic suppressors but also for indicating diversity of metastasis. There are also positive regulators of metastasis, which might be a good target for actual therapy for prevention of metastasis. The data shown in Fig. 3 and Table 1 indicate that mCMAP expression is involved in hematogenous liver metastasis. Therefore, suppression of mCMAP transcription or inhibition of biological property of protein coding would be new approaches to antiliver metastatic therapy. Thus, biochemical characterization of CMAP and the molecular mechanisms underlying transcriptional activation of CMAP are important issues to be elucidated. We are now working on preparation of the recombinant protein, its biochemical characterization and the structural analysis of the genomic DNA.

After preparation of this manuscript, we learned that Halfon et al.(38) reported isolation of the same gene from human dendritic cells and mouse T helper 2 cells. Their sequences (leukocystatin) were found to be identical to our hCMAP and mCMAP, although their mouse gene cDNA sequence is not complete. They also reported that the expression is selective to hematopoietic cells (38).

Fig. 1.

Identification and cloning of mCMAP selectively overexpressed in IMC-HA1, a clonal line of IMC-HM cells. A, signal pattern in an mRNA differential display made by amplification with a pair of primers, P2 (5′-ATTAACCCTCACTAAATGCTGGAGG-3′) and T3 (5′-CATTATGCTGAGTGATATCTTTTTTTTTAG-3′). Arrow, cDNA selectively amplified in IMC-HM cells, 23-1. B, Northern blot analysis with 2 μg of poly(A) RNA from both IMC-HA1 and IMC-LE5 cells probed with 32P-labeled 23-1#2, a clone of 23-1. The expression of mCMAP was confirmed as a 1.1-kb single band. The membrane was rehybridized with a G3PDH probe as a control. C, genomic Southern blot analysis with 10 μg of EcoRI-digested genomic DNA from both cell lines probed with 32P-labeled 23-1#2.

Fig. 1.

Identification and cloning of mCMAP selectively overexpressed in IMC-HA1, a clonal line of IMC-HM cells. A, signal pattern in an mRNA differential display made by amplification with a pair of primers, P2 (5′-ATTAACCCTCACTAAATGCTGGAGG-3′) and T3 (5′-CATTATGCTGAGTGATATCTTTTTTTTTAG-3′). Arrow, cDNA selectively amplified in IMC-HM cells, 23-1. B, Northern blot analysis with 2 μg of poly(A) RNA from both IMC-HA1 and IMC-LE5 cells probed with 32P-labeled 23-1#2, a clone of 23-1. The expression of mCMAP was confirmed as a 1.1-kb single band. The membrane was rehybridized with a G3PDH probe as a control. C, genomic Southern blot analysis with 10 μg of EcoRI-digested genomic DNA from both cell lines probed with 32P-labeled 23-1#2.

Close modal
Fig. 2.

Expression pattern of CMAP-specific mRNA. A, RT-PCR detection of mCMAP in various murine tumor cell lines. Primers (9-4F2, 5′-CTGAAGCTACCCCACCATGCCCTGG-3′; and 23-1#2F2, 5′-GACTGTATCTGCTTTGCTCTGCAC-3′) were used for specified amplification of mCMAP. Control amplification was performed with a G3PDH-specific primer set. B, distribution of mCMAP in various normal mouse tissues. Fifteen normal murine tissues were excised from two to three normal female CDF1 mice (5 weeks old) and homogenized in 10 volumes of ISOGEN in a polytron, then total RNA was extracted. RT-PCR was performed under semiquantitative conditions for IMC-HA1.

Fig. 2.

Expression pattern of CMAP-specific mRNA. A, RT-PCR detection of mCMAP in various murine tumor cell lines. Primers (9-4F2, 5′-CTGAAGCTACCCCACCATGCCCTGG-3′; and 23-1#2F2, 5′-GACTGTATCTGCTTTGCTCTGCAC-3′) were used for specified amplification of mCMAP. Control amplification was performed with a G3PDH-specific primer set. B, distribution of mCMAP in various normal mouse tissues. Fifteen normal murine tissues were excised from two to three normal female CDF1 mice (5 weeks old) and homogenized in 10 volumes of ISOGEN in a polytron, then total RNA was extracted. RT-PCR was performed under semiquantitative conditions for IMC-HA1.

Close modal
Fig. 3.

Correlation between the extent of mCMAP mRNA and the metastatic activity of IMC-HA1 cells in vivo. A, reduction of murine mCMAP mRNA expression in clones derived from IMC-HA1 cells by stable induction of an antisense cDNA. The amounts of mCMAP mRNA in each clone observed by Northern blot analysis (inset) were adjusted to that of G3PDH and are indicated in the columns as percentages of that of IMC-HA1. B, tumorigenicities of IMC-HA1 cells (▪); vector control 18B5 (⋄); transfectant clones 57C4 (○), 53A9 (▵), 53E9 (□); and IMC-LE5 (♦) cells at inguinal sites in CDF1 mice. C, liver shown as medial mass from groups of mice inoculated i.v. with transfectants. D and E, mean liver and spleen masses of mice bearing transfectants. Bars, SDs of means for five mice.

Fig. 3.

Correlation between the extent of mCMAP mRNA and the metastatic activity of IMC-HA1 cells in vivo. A, reduction of murine mCMAP mRNA expression in clones derived from IMC-HA1 cells by stable induction of an antisense cDNA. The amounts of mCMAP mRNA in each clone observed by Northern blot analysis (inset) were adjusted to that of G3PDH and are indicated in the columns as percentages of that of IMC-HA1. B, tumorigenicities of IMC-HA1 cells (▪); vector control 18B5 (⋄); transfectant clones 57C4 (○), 53A9 (▵), 53E9 (□); and IMC-LE5 (♦) cells at inguinal sites in CDF1 mice. C, liver shown as medial mass from groups of mice inoculated i.v. with transfectants. D and E, mean liver and spleen masses of mice bearing transfectants. Bars, SDs of means for five mice.

Close modal
Fig. 4.

Sequence determination of hCMAP. A, identification of hCMAP using the sequence similarities of two human ESTs, N47763 and N56875. Open reading frames are indicated (▪). For details see text. B, comparison of sequences of hCMAP and mCMAP cDNA. The sequence relationship between hCMAP and mCMAP cDNAs was calculated by the Compare program in GCG software.

Fig. 4.

Sequence determination of hCMAP. A, identification of hCMAP using the sequence similarities of two human ESTs, N47763 and N56875. Open reading frames are indicated (▪). For details see text. B, comparison of sequences of hCMAP and mCMAP cDNA. The sequence relationship between hCMAP and mCMAP cDNAs was calculated by the Compare program in GCG software.

Close modal
Fig. 5.

Comparison of amino acid sequence of CMAP with family 2 cystatins. The alignments of protein sequences of hCMAP and mCMAP, human family 2 cystatins, and chicken cystatin, and the distances of the entries were calculated by GCG software (Genetics Computer Group Inc.) or Lasergene software (DNASTAR Inc.). Conservative residues that match the consensus exactly are shaded. Two possible cystine bridges are shown by thin lines, and three segments that may be necessary for interaction with substrates are indicated by thick lines. All Cys residues are boxed, and putative glycosylation sites (Asn residues) are indicated with boldface italics. Second Met at position 24 (mCMAP) or 23 (hCMAP) are underlined. Vertical bars, putative or practical cleavage sites. The theoretical cleavage site of cystatin M was proposed between Ala21 and Leu22(6) or between Ala29 and Arg30(16). Sequences were retrieved from GenBank by using the following accession numbers: cystatin M (U62800), cystatin C (A33400), cystatin D (A47142), cystatin SN (A29632), cystatin SA (B29632), cystatin S (S17667), and chicken cystatin (A34456).

Fig. 5.

Comparison of amino acid sequence of CMAP with family 2 cystatins. The alignments of protein sequences of hCMAP and mCMAP, human family 2 cystatins, and chicken cystatin, and the distances of the entries were calculated by GCG software (Genetics Computer Group Inc.) or Lasergene software (DNASTAR Inc.). Conservative residues that match the consensus exactly are shaded. Two possible cystine bridges are shown by thin lines, and three segments that may be necessary for interaction with substrates are indicated by thick lines. All Cys residues are boxed, and putative glycosylation sites (Asn residues) are indicated with boldface italics. Second Met at position 24 (mCMAP) or 23 (hCMAP) are underlined. Vertical bars, putative or practical cleavage sites. The theoretical cleavage site of cystatin M was proposed between Ala21 and Leu22(6) or between Ala29 and Arg30(16). Sequences were retrieved from GenBank by using the following accession numbers: cystatin M (U62800), cystatin C (A33400), cystatin D (A47142), cystatin SN (A29632), cystatin SA (B29632), cystatin S (S17667), and chicken cystatin (A34456).

Close modal
Fig. 6.

hCMAP expression in various human cancer cell lines shown by RT-PCR. Total RNAs derived from 57 human tissue culture cells and human spleen were reverse-transcribed, and then hCMAP was amplified with a pair of primers, rH-hCMAP-M (5′-CACCGTCGACGGCCCTTCCCCAGATACTTG-3′) and rH-hCMAP-MF-R (5′-GAGGGGATCCTCAGTGACAACGGAGAACAGGCAC-3′).

Fig. 6.

hCMAP expression in various human cancer cell lines shown by RT-PCR. Total RNAs derived from 57 human tissue culture cells and human spleen were reverse-transcribed, and then hCMAP was amplified with a pair of primers, rH-hCMAP-M (5′-CACCGTCGACGGCCCTTCCCCAGATACTTG-3′) and rH-hCMAP-MF-R (5′-GAGGGGATCCTCAGTGACAACGGAGAACAGGCAC-3′).

Close modal

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

2

Unpublished data.

3

The abbreviations used are: CMAP, cystatin-like metastasis-associated protein; mCMAP, murine CMAP; hCMAP, human CMAP; RT-PCR, reverse transcription-PCR; EST, expressed sequence tag.

Table 1

Extension of survival of mice bearing clonal lines expressing reduced levels of mCMAP mRNA in vivo

Cells were inoculated i.v. into female CDF1 mice at 1 × 103 cells/mouse on day 0.
Cell linemCMAP mRNA (%)aSurvival (days)S/TdM/Te
Mean ± SDP              bT/C%c
IMC-HA1 100 14.0 ± 0.7  100 0/5 5/5 
 18B5 101 13.6 ± 0.5 0.8278 97 0/5 5/5 
 57C4 49 19.2 ± 1.5 0.0086 137 0/5 5/5 
 53A9 32 21.4 ± 2.6 0.0004f 153 0/5 5/5 
 53E9 16 >36.0 ± 20.7 <0.0001f >257 1/5 4/5 
IMC-LE5 <5 >60.0 ± 0.0 <0.0001f >429 5/5 0/5 
Cells were inoculated i.v. into female CDF1 mice at 1 × 103 cells/mouse on day 0.
Cell linemCMAP mRNA (%)aSurvival (days)S/TdM/Te
Mean ± SDP              bT/C%c
IMC-HA1 100 14.0 ± 0.7  100 0/5 5/5 
 18B5 101 13.6 ± 0.5 0.8278 97 0/5 5/5 
 57C4 49 19.2 ± 1.5 0.0086 137 0/5 5/5 
 53A9 32 21.4 ± 2.6 0.0004f 153 0/5 5/5 
 53E9 16 >36.0 ± 20.7 <0.0001f >257 1/5 4/5 
IMC-LE5 <5 >60.0 ± 0.0 <0.0001f >429 5/5 0/5 
a

Values were calculated as radio intensities of mCMAP to that of G3PDH on Northern analysis.

b

Statistical analysis was performed by the Fisher’s protected least significant difference test.

c

Values are indicated as percentages of the mean survival days of mice bearing IMC-HA1 cells.

d

No. of survivors on day 60/no. of mice tested.

e

No. of mice with liver metastasis/no. of mice tested.

f

Significant difference, P < 0.001.

We thank M. Sasaki, H. Matsumoto, M. Kobayashi, and N. Sugimoto for their histological experiments and M. Ohta, Y. Kobayashi, A. Inomaki, and E. Asano for DNA sequencing in our institute.

1
Nicolson G. L. Cancer metastasis: tumor cell and host organ properties important in metastasis to specific secondary sites.
Biochim. Biophys. Acta
,
948
:
175
-224,  
1988
.
2
Liotta L. A., Steeg P. S., Stetler-Stevenson W. G. Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation.
Cell
,
64
:
327
-336,  
1991
.
3
Fidler I. J., Ellis L. M. The implications of angiogenesis for the biology and therapy of cancer metastasis.
Cell
,
79
:
185
-188,  
1994
.
4
Steeg P. S., Bevilacqua G., Kopper L., Thorgeirsson U. P., Talmadge J. E., Liotta L. A., Sobel M. E. Evidence for a novel gene associated with low tumor metastatic potential.
J. Natl. Cancer Inst. (Bethesda)
,
80
:
200
-204,  
1988
.
5
Lee J-H., Miele M. E., Hicks D. J., Phillips K. K., Trent J. M., Weissman B. E., Welch D. R. KiSS-1, a novel human malignant melanoma metastasis-suppressor gene.
J. Natl. Cancer Inst. (Bethesda)
,
88
:
1731
-1737,  
1996
.
6
Sotiropoulou G., Anisowicz A., Sager R. Identification, cloning, and characterization of cystatin M, a novel cysteine proteinase inhibitor, down-regulated in breast cancer.
J. Biol. Chem.
,
272
:
903
-910,  
1997
.
7
Shtivelman E. A link between metastasis and resistance to apoptosis of variant small cell lung carcinoma.
Oncogene
,
14
:
2167
-2173,  
1997
.
8
Ebralidze A., Tulchinsky E., Grigorian M., Afanasyeva A., Senin V., Revazova E., Lukanidin E. Isolation and characterization of a gene specifically expressed in different metastatic cells and whose deduced gene product has a high degree of homology to a Ca2+-binding protein family.
Genes Dev.
,
3
:
1086
-1093,  
1989
.
9
Basset P., Bellocq J. P., Wolf C., Stoll I., Hutin P., Limacher J. M., Podhajcer O. L., Chanard M. P., Rio M. C., Chambon P. A novel metalloproteinase gene specifically expressed in stromal cells of breast carcinomas.
Nature (Lond.)
,
348
:
699
-704,  
1990
.
10
Bao L., Loda M., Janmey P. A., Stewart R., Anand-Apte B., Zetter B. R. Thymosin β15: a novel regulator of tumor cell motility upregulated in metastatic prostate cancer.
Nat. Med.
,
2
:
1322
-1328,  
1996
.
11
Fidler I. J. Orthotopic implantation of human colon carcinomas into nude mice provides a valuable model for the biology and therapy of metastasis.
Cancer Metastasis Rev.
,
10
:
229
-243,  
1991
.
12
Arakawa H., Matsumoto H., Morita M., Sasaki M., Taguchi K., Okura A., Nishimura S. Antimetastatic effect of a novel indolocarbazole (NB-506) on IMC-HM murine tumor cells metastasized to the liver.
Jpn. J. Cancer Res.
,
87
:
518
-523,  
1996
.
13
Holmgren L., O’Reilly M. S., Folkman J. Dormancy of micrometastases: balanced proliferation and apoptosis in the presence of angiogenesis suppression.
Nat. Med.
,
1
:
149
-153,  
1995
.
14
Watanabe Y., Okura A., Naito K., Kobayashi M. Murine liver metastasis model using L5178Y-ML lymphoma and the effect of antitumor agents on the metastasis.
Jpn. J. Cancer Res.
,
79
:
1208
-1216,  
1988
.
15
Barrett, A. J., and Rawlings, N. D. Families and clans of cysteine peptidases. In: J. H. McKerrow and M. N. G. James (eds.), Perspectives in Drug Discovery and Design, Vol. 6, Cysteine proteases: Evolution, Function, and Inhibitor Design, pp. 1–11. Leiden, the Netherlands: ESCOM Science Publishers B. V., 1996.
16
Ni J., Abrahamson M., Zhang M., Fernandez M. A., Grubb A., Su J., Yu G-L., Li Y., Parmelee D., Xing L., Coleman T. A., Gentz S., Thotakura R., Nguyen N., Hesselberg M., Gentz R. Cystatin E is a novel human cysteine proteinase inhibitor with structural resemblance to family 2 cystatins.
J. Biol. Chem.
,
272
:
10853
-10858,  
1997
.
17
Dieckmann T., Mitschang L., Hofmann M., Kos J., Turk V., Auerswald E. A., Jaenicke R., Oschkinat H. The structures of native phosphorylated chicken cystatin and of a recombinant unphosphorylated variant in solution.
J. Mol. Biol.
,
234
:
1048
-1059,  
1993
.
18
Engh R. A., Dieckmann T., Bode W., Auerswald E. A., Turk V., Huber R., Oschkinat H. Conformational variability of chicken cystatin. Comparison of structures determined by X-ray diffraction and NMR spectroscopy.
J. Mol. Biol.
,
234
:
1060
-1069,  
1993
.
19
Hall A., Håkansson K., Mason R. W., Grubb A., Abrahamson M. Structural basis of the biological specificity of cystatin C.
J. Biol. Chem.
,
270
:
5115
-5121,  
1995
.
20
Sloane B. F. Cathepsin B and cystatins: evidence for a role in cancer progression.
Semin. Cancer Biol.
,
1
:
137
-152,  
1990
.
21
Shiraishi T., Mori M., Tanaka S., Sugimachi K., Akiyoshi T. Identification of cystatin B in human esophageal carcinoma, using differential displays in which the gene expression is related to lymph-node metastasis.
Int. J. Cancer
,
79
:
175
-178,  
1998
.
22
Elliott E., and Sloane B. F. The cysteine protease cathepsin B in cancer. In: J. H. McKerrow and M. N. G. James (eds.), Perspectives in Drug Discovery and Design, Vol. 6, Cysteine Proteases Evolution, Function, and Inhibitor Design, pp. 12–32, Leiden, the Netherlands: ESCOM Science Publishers B. V., 1996.
23
Stetler-Stevenson W. G., Liotta L. A., Kleiner D. E., Jr. Extracellular matrix 6: role of matrix metalloproteinases in tumor invasion and metastasis.
FASEB J.
,
7
:
1434
-1441,  
1993
.
24
Weterman M. A. J., Stoopen G. M., van Muijen G. N. P., Kuznicki J., Ruiter D. J., Bloemers H. P. J. Expression of calcyclin in human melanoma cell lines correlates with metastatic behavior in nude mice.
Cancer Res.
,
52
:
1291
-1296,  
1992
.
25
Günthert U., Hofmann M., Rudy W., Reber S., Zöller M., Haußmann I., Matzku S., Wenzel A., Ponta H., Herrich P. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells.
Cell
,
65
:
13
-24,  
1991
.
26
Schalken J. A., Ebeling S. B., Isaacs J. T., Treiger B., Bussimakers M. J. G., de Jong M. E. M., Van de Ven W. J. M. Down modulation of fibronectin messenger RNA in metastasizing rat prostatic cancer cells revealed by differential hybridization analysis.
Cancer Res.
,
48
:
2042
-2046,  
1988
.
27
Saitoh T., Sundsmo M., Roch J-M., Kimura N., Cole G., Schubert D., Oltersdorf T., Schenk D. B. Secreted form of amiloid β protein precursor is involved in the growth regulation of fibroblasts.
Cell
,
58
:
615
-622,  
1989
.
28
McKeehan W. L., Sakagami Y., Hoshi H., McKeehan K. A. Two apparent human endothelial cell growth factors from human hepatoma cells are tumor-associated proteinase inhibitors.
J. Biol. Chem.
,
261
:
5378
-5383,  
1986
.
29
Perry J. K., Scott G. K., Tse C. A. Modulation of proliferation of cultured human cells by urinary trypsin inhibitor.
Biochim. Biophys. Acta
,
1221
:
145
-152,  
1994
.
30
Hayakawa T., Yamashita K., Tanzawa K., Uchijima E., Iwata K. Growth-promoting activity of tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) for a wide range of cells.
FEBS Lett.
,
298
:
29
-32,  
1992
.
31
Banda M. J., Rice A. G., Griffin G. L., Senior R. M. α1-Proteinase inhibitor is a neutrophil chemoattractant after proteolitic inactivation by macrophage elastase.
J. Biol. Chem.
,
263
:
4481
-4484,  
1988
.
32
Monard D. Cell-derived proteinases and protease inhibitors as regulators of neurite outgrowth.
Trends Neurosci.
,
11
:
541
-544,  
1988
.
33
Nikiforov M. A., Hagen K., Ossovskaya V. S., Connor T. M. F., Lowe S. W., Deichman G. I., Gudkov A. V. p53 modulation of anchorage independent growth and experimental metastasis.
Oncogene
,
13
:
1709
-1719,  
1996
.
34
Inbal B., Cohen O., Polak-Charcon S., Kopolovic J., Vadai E., Eisenbach L., Kimchi A. DAP kinase links the control of apoptosis to metastasis.
Nature (Lond.)
,
390
:
180
-184,  
1997
.
35
Guenette R. S., Mooibroek M., Wang K., Wang P., Tenniswood M. Cathepsin B, a cysteine proteinase implicated in metastatic progression, is expressed during regression of the rat prostate and mammary glands.
Eur. J. Biochem.
,
226
:
311
-321,  
1994
.
36
Deiss L. P., Galinka H., Berissi H., Cohen O., Kimchi A. Cathepsin D protease mediates programmed cell death induced by interferon-γ, Fas/APO-1 and TNF-α.
EMBO J.
,
15
:
3861
-3870,  
1996
.
37
Salvesen G. S., Dixit V. M. Caspases: intracellular signaling by proteolysis.
Cell
,
91
:
443
-446,  
1997
.
38
Halfon S., Ford J., Foster J., Dowling L., Lucian L., Sterling M., Xu Y., Weiss M., Ikeda M., Liggett D., Helms A., Caux C., Lebecque S., Hannum C., Menon S., McClanahan T., Gorman D., Zurawski G. Leukocystatin, a new class II cystatin expressed selectively by hematopoietic cells.
J. Biol. Chem.
,
273
:
16400
-16408,  
1998
.