Stem cell antigen-1 (Sca-1, Ly6A) is a glycerophosphatidylinositol (GPI)-anchored protein that was identified as a murine marker of bone marrow stem cells. Although Sca-1 is widely used to enrich for stem and progenitor cells in various tissues, little is known about its function and associated signaling pathways in normal and malignant cells. Here, we report that the absence of Sca-1 in the mammary gland resulted in higher levels of PPARγ and PTEN, and a reduction of pSer84PPARγ, pERK1/2, and PPARδ. This phenotype correlated with markedly increased sensitivity of Sca-1 null mice to PPARγ agonist GW7845 and insensitivity to PPARδ agonist GW501516. Reduction of Sca-1 expression in mammary tumor cells by RNA interference resulted in a phenotype similar to the Sca-1 deficient mammary gland, as evidenced by increased PPARγ expression and transcriptional activity, resulting in part from a lesser susceptibility to proteasomal degradation. These data implicate Sca-1 as a negative regulator of the tumor suppressor effects of PPARγ. Cancer Prev Res; 5(1); 51–60. ©2011 AACR.

Stem cell antigen-1 (Sca-1, Ly6A) is a glycerophosphatidylinositol (GPI)-anchored protein that was first identified as a murine marker of bone marrow stem cells (1, 2), and has been used subsequently to enrich for stem and progenitor cells from a variety of tissues (3–10). In the mammary gland, Sca-1–expressing epithelial cells have the capacity to reconstitute the mammary gland in the cleared fat pad (5, 11) and to generate alveolar and ductal structures (12). These findings are consistent with enhanced fluorescence in the alveolar end buds (13) in heterozygous Sca-1+/EGFP mice (14), where the stem cell niche is believed to reside (15, 16). Even though, these studies suggest that Sca-1–expressing cells behave like stem and progenitor cells, it is unclear whether Sca-1 is a bona fide stem cell marker or serves as a growth modifier through its ability to prime multipotent cell populations (17, 18). In support of the latter possibility, Sca-1 expression is increased in mammary tumors arising in MMTV-Wnt1 (19) and MMTV-erbB2 (20) transgenic mice, and serves as a tumor-initiating factor in murine mammary tumor cells by suppressing TGF-β signaling (21).

PPARs are ligand-activated nuclear receptors that regulate a plethora of signaling pathways controlling fatty acid β-oxidation, glucose utilization, cholesterol transport, adipocyte differentiation, cell proliferation, and survival (22–28). In the context of mammary tumorigenesis, PPARγ agonists inhibit carcinogen-induced preneoplastic mammary lesions (29) and delay mammary tumor development (30–32), whereas the opposite phenotype results from PPARγ haploinsufficiency (33), expression of dominant-negative Pax8PPARγ (34) and by treatment with PPARδ agonists (35, 36). PPARδ is also an etiologic factor in gastric carcinogenesis (37) and colon tumorigenesis (38, 39), although interpretation of the role of PPARδ in the latter process is dependent on the derivation of the knockout model (40).

The objectives of the present study were to determine if Sca-1 deficiency affected mammary gland development and tumorigenesis in response to the potent and highly selective PPARγ agonist GW7845 (35). Here, we report that Sca-1 deficiency reduced the proliferation of mammary epithelium and markedly enhanced the chemopreventive effects of GW7845. This outcome correlated with increased PPARγ and PTEN expression, and a reduction in the ratio of pSer84PPARγ/PPARγ, as well as the levels of PPARδ and pERK1/2 in the mammary gland and tumors of Sca-1–deficient animals. Reduction of Sca-1 in mammary tumor cells by RNA interference produced a similar PPARγ phenotype, and further showed reduced proteasomal turnover and increased the transcriptional activity of PPARγ. These results suggest that Sca-1 attenuates the tumor suppressor activity of PPARγ through inhibition of posttranslational processes that modulate its activity.

Mice

Sca-1 null (KO) mice were bred from heterozygous Sca-1 mice kindly provided by Dr. William L. Stanford, University of Toronto (41). Mice were screened by PCR, and Sca-1 deficiency in the mammary gland was confirmed by fluorescence-activated cell sorting (FACS) and Western blotting.

Mammary carcinogenesis

Five week-old wild-type (WT) C57BL/6 mice and Sca-1 KO mice of the same background were treated with medroxyprogesterone (MP) and 7,12dimethylbenz(a)anthracene (DMBA) as previously described (30, 35). Briefly, mice were injected subcutaneously with 15 mg MP suspension (Depo-Provera), followed by 4 weekly doses of 1 mg DMBA/0.1 mL cottonseed oil administered by gavage (8, 21). All animals were fed diets of Purina rodent chow 5001 supplemented with either 0.005% (w/w) GW7845 (provided by Dr. Brad Henke, GlaxoSmithKline) or 0.005% GW501516 (provided by the Chemoprevention Branch, NCI) beginning 1 day after the last dose of DMBA.

Antibodies

The source, use, and dilutions of antibodies were the following: FITC-mouse anti-Sca-1 (553335, BD Biosciences, FACS, 1:200), rat anti-Sca-1 (553333, BD Biosciences, Western blotting, 1:1,000), mouse anti-PPARγ (sc-7273, Santa Cruz Biotechnology, Western blotting, 1:300), mouse anti-pSer84PPARγ (sc-28001-R, Santa Cruz Biotechnology, Western blotting, 1:1,000), rabbit anti-PPARδ (48-6600, Zymed Laboratories, Western blotting, 1:1,000), mouse anti-PTEN (7974, Santa Cruz Biotechnology, Western blotting, 1:1,000), pERK1/2 (4376S, Cell Signaling, Western blotting, 1:1,000), ERK1/2 (9102, Cell Signaling, Western blotting, 1:1,000), anti-pRB (9308, Cell Signaling, IHC, 1:100), anti-Ki-67 (M7249, Dako, IHC, 1:50), and mouse anti-β-actin (A-5441, Sigma-Aldrich, Western blotting, 1:5,000).

Cell culture

Cell line 34T was generated from a mammary adenocarcinoma induced by MP/DMBA in heterozygous Sca-1+/EGFP mice (34). Briefly, tissue was excised and minced into 1 mm pieces under sterile conditions, and digested in Dulbecco's Modified Eagle's Media (DMEM)/F12 medium supplemented with 5% FBS, 100 U/mL collagenase I, 100 U/mL hyaluronidase, 100 U/mL penicillin, 100 U/mL streptomycin, 10 μg/mL gentamicin, and 2.5 μg/mL amphotericin B. Cell lines were maintained in DMEM medium supplemented with 5% FBS (34). 34T cells and 34T cells in which Sca-1 was reduced by transduction with a lentivirus-expressed as Sca-1 shRNA (D8 cells) were generated as previously described (21).

Western blotting

Western blotting was carried out as previously described (34). Briefly, either the cell pellet at 4°C or tissue was frozen in liquid nitrogen and pulverized in a mortar and pestle, were mixed with lysis buffer containing: 0.1% SDS, 0.5% NP-40, phenylmethylsulfonyl fluoride, 1 mmol/L sodium vanadate, 50 mmol/L sodium fluoride, 10 mmol/L β-glycerophosphate, 5 mmol/L sodium pyrophosphate, and protease inhibitor cocktail (Roche Diagnostics). Following incubation on ice for 30 minutes, lysates were cleared by centrifugation for 15 minutes at 13,000 × g at 4°C. Protein concentrations were determined by the Coomassie Plus Protein Assay (Pierce), and 50 μg of lysate was separated in a 4% to 12% NuPAGE Bis-Tris gel (Invitrogen). After wet transfer, membranes were blocked for one hour at room temperature in 5% nonfat dry milk in TBS (pH 7.4) containing 0.1% Tween 20. Primary antibody was incubated overnight at 4°C. Secondary antibody was incubated for one hour at room temperature, and proteins were visualized with either SuperSignal West Pico or SuperSignal West Dura (Pierce).

Immunohistochemistry

Immunohistochemical analysis was carried out as previously described (30, 34, 35).

FACS

Single-cell suspensions of primary mammary epithelial cell cultures were prepared from WT and Sca-1 KO mice as previously described (34). Briefly, cells were detached from the flask with 0.05% trypsin, filtered through a 45 μm cell strainer, washed twice with 1× PBS and blocked for 15 minutes on ice with 1× PBS supplemented with 3% FBS. Cells were washed twice with 1× PBS, fixed with 1% paraformaldehyde in PBS and stored in the dark at 4°C until sorting. Cells (5 × 106/mL) were incubated for one hour at room temperature with a 1:400 dilution of either fluorescein isothiocyanate (FITC)–Sca-1 (clone E13-161.7, BD Biosciences) or a conjugated IgG of the same isotype as a negative control. Sorting was carried out on a FACSAria flow cytometer (Becton Dickinson) and analyzed by FACExpress Denovo software by the Flow Cytometry/Cell Sorting Shared Resource, LCCC.

Quantitative real-time PCR

Total RNA was extracted using the RNAeasy Mini Kit (Qiagen) according to the manufacturer's protocol. One microgram of RNA was reverse transcribed in a total volume of 20 μL using the Cloned AMV First-Strand cDNA Synthesis kit (Invitrogen). PCR was carried out in triplicate in an ABI 7900 instrument (Applied Biosystems) using SYBRGreen detection (Applied Biosystems) according to the manufacturer's protocol. qRT-PCR primers were designed using the Integrated DNA Technologies primer design tool (42). Efficiencies of all primer sets were validated using a standard curve of 5 serial cDNA dilutions in water in duplicate. Primers were acceptable if the deviation from the slope of the standard curve was less than 0.3, and if the melting curve showed only one product. The expression of each target gene was normalized to the expression of GAPDH, and the relative quantification method was applied using SDS2.3 software (Applied Biosystems). Primers were the following:

PTEN: forward, TGTAAAGCTGGAAAGGGACG, reverse, CCTCTGACTGGGAATTGTGAC

FABP3: forward, TCATCCATGTGCAGAAGTGG, reverse, CTTCTCATAAGTCCGAGTGCTC.

Gene microarray analysis

Total RNA was extracted from tumors of WT and Sca-1 KO mice using an RNeasy Mini Kit (Qiagen) following the manufacturer's protocol. cRNA synthesis was carried out using the Affymetrix (Santa Clara) protocol with minor modifications as described (30). Biotin-labeled cRNA was fragmented for 35 minutes at 94°C and hybridized overnight to an Affymetrix mouse 430A 2.0 GeneChip representing approximately 14,000 annotated mouse genes by the Macromolecular Analysis Shared Resource, Lombardi Comprehensive Cancer Center, Georgetown University. Hybridization signals were detected with an Agilent Gene Array scanner, and grid alignment and raw data generation done with Affymetrix GeneChip Operating software 1.1. Gene expression data with a signal 300 or above and with ≥2.5-fold change are listed in Supplementary Table S1. Gene ontology analysis categorizing sets of 4 of more genes at P < 0.05 was conducted with Pathway Studio 7.1 (Aridane Genomics, Inc.; Supplementary Table S2). Array data have been deposited in the GEO database under accession no. GSE31954.

Statistical analysis

The significance (P < 0.05) of data presented as the mean ± SEM was determined using the 2-tailed Student t test. Differences between groups of 2 or more variables were determined by the 2-tailed Fisher Exact test, and survival curves were analyzed by the Pearson log-rank test.

The Sca-1–deficient mammary gland

Sca-1 KO mice were bred from heterozygous mice and confirmed to have loss of Sca-1 by FACS analysis (Fig. 1A). The effect of Sca-1 deficiency on mammary gland development was initially measured in whole mounts. Sca-1 KO mice exhibited a reduction in ductal invasion of the fat pad at 7 weeks of age (Ctl; Fig. 1B), and responded less vigorously to MP treatment in comparison to WT mice (MP; Fig. 1B). The phenotype of the Sca-1–deficient gland was further assessed by determining expression of the antiproliferative marker p21Cip1 and proliferative marker phosphoRB (pRB). Sca-1 KO mice expressed increased p21Cip1 (Fig. 1C) and reduced pRB (Fig. 1C), suggesting that the ductal epithelium was less poised to respond to a stimulus. This was confirmed, in part, by the reduced expression of the proliferative marker Ki-67 in Sca-1 KO mice in response to MP treatment (Fig. 1D), although there was no significant difference in Ki-67 between untreated WT and Sca- KO mice. This suggests that p21Cip1 and pRB are sensitive predictors of the proliferative potential of the tissue.

Figure 1.

A, phenotype of Sca-1 KO mice. FACS analysis indicates the absence of Sca-1. B, ductulogenesis is diminished in Sca-1 KO mice. Whole mounts of the mammary gland of 7-week-old WT (i) and KO (ii) indicate a lesser degree of duct elongation in KO mice (0.6 cm) versus WT mice (1.0 cm). Treatment of 6-week-old WT (i and iii) and KO (ii and iv) mice with 15 mg medroxyprogesterone (MP) resulted in less proliferation in KO mice after 7 days. The line indicates the extent of ductal invasion. Inset indicates 5× magnification. Bar graph indicates the degree of ductal extension into the fat pad. The difference in ductal invasion between WT and KO mice differed significantly (P < 0.01, N = 5) by the 2-sided Student t test. C, the Sca-1 KO mammary gland exhibits a lower proliferative potential. KO mice exhibit increased expression of the antiproliferative marker, p21Cip1, and less expression of the proliferative marker, pRB, than WT mice. Magnification 400×. D, the Sca-1 KO mammary gland exhibits an impaired proliferative response to MP. Animals were treated as in B and proliferation was monitored after 7 days by Ki-67 labeling. Sca-1 KO mice showed less Ki-67 labeling after MP treatment. Magnification 400×. Bar graph indicates the number of Ki-67–positive cells per duct based on a total of 40 to 50 ducts. Although, there was no significant difference in Ki-67 expression between control WT and KO mice (P > 0.05), their response to MP differed significantly (P < 0.001, N = 16) by the 2-sided Student t test.

Figure 1.

A, phenotype of Sca-1 KO mice. FACS analysis indicates the absence of Sca-1. B, ductulogenesis is diminished in Sca-1 KO mice. Whole mounts of the mammary gland of 7-week-old WT (i) and KO (ii) indicate a lesser degree of duct elongation in KO mice (0.6 cm) versus WT mice (1.0 cm). Treatment of 6-week-old WT (i and iii) and KO (ii and iv) mice with 15 mg medroxyprogesterone (MP) resulted in less proliferation in KO mice after 7 days. The line indicates the extent of ductal invasion. Inset indicates 5× magnification. Bar graph indicates the degree of ductal extension into the fat pad. The difference in ductal invasion between WT and KO mice differed significantly (P < 0.01, N = 5) by the 2-sided Student t test. C, the Sca-1 KO mammary gland exhibits a lower proliferative potential. KO mice exhibit increased expression of the antiproliferative marker, p21Cip1, and less expression of the proliferative marker, pRB, than WT mice. Magnification 400×. D, the Sca-1 KO mammary gland exhibits an impaired proliferative response to MP. Animals were treated as in B and proliferation was monitored after 7 days by Ki-67 labeling. Sca-1 KO mice showed less Ki-67 labeling after MP treatment. Magnification 400×. Bar graph indicates the number of Ki-67–positive cells per duct based on a total of 40 to 50 ducts. Although, there was no significant difference in Ki-67 expression between control WT and KO mice (P > 0.05), their response to MP differed significantly (P < 0.001, N = 16) by the 2-sided Student t test.

Close modal

Sca-1 deficiency enhances PPARγ expression in the mammary gland

To further characterize the mammary gland of Sca-1 KO mice, tissue lysates were probed by Western blotting for PPARγ, pSer84PPARγ, PPARδ, PTEN, pERK1/2, and ERK1/2 (Fig. 2A). Sca-1–deficient tissue expressed a 3-fold higher level of PPARγ than WT tissue (Fig. 2B), as well as a reduction in the ratio of pSer84PPARγ/PPARγ (Fig. 2C). These changes were accompanied by a marked reduction in PPARδ (Fig. 2D), a 50% reduction in the percentage of pERK1/2/ERK (Fig. 2E), and an increase in PTEN expression (Fig. 2A). These results are consistent with reduced proteasome-dependent turnover of hypophosphorylated Ser84PPARγ (43).

Figure 2.

Sca-1 deficiency increases PPARγ, and reduces pSer84PPARγ, PPARδ, and pERK. A, mammary gland lysates from 2 WT and 2 KO mice were probed by Western blotting for pSer84PPARγ, PPARγ, pERK1/2, ERK1/2, PPARδ, PTEN, and β-actin. B, bar graph of PPARγ (PPARg) levels shown in A. C, bar graph of the ratio of pSer84PPARγ/PPARγ (pPPARg/PPARg) shown in A. D, bar graph of PPARδ (PPARd) levels shown in A. E, bar graph of the ratio of pERK1/2/ERK1/2 shown in A. All values were normalized to actin.

Figure 2.

Sca-1 deficiency increases PPARγ, and reduces pSer84PPARγ, PPARδ, and pERK. A, mammary gland lysates from 2 WT and 2 KO mice were probed by Western blotting for pSer84PPARγ, PPARγ, pERK1/2, ERK1/2, PPARδ, PTEN, and β-actin. B, bar graph of PPARγ (PPARg) levels shown in A. C, bar graph of the ratio of pSer84PPARγ/PPARγ (pPPARg/PPARg) shown in A. D, bar graph of PPARδ (PPARd) levels shown in A. E, bar graph of the ratio of pERK1/2/ERK1/2 shown in A. All values were normalized to actin.

Close modal

Sca-1 KO mice are sensitized to the chemopreventive effects of PPARγ agonist GW7845

Because Sca-1 KO mice expressed a significantly higher ratio of PPARγ/PPARδ, mammary carcinogenesis (30) was evaluated in animals administered diets supplemented with either PPARγ agonist GW7845 or PPARδ agonist GW501516 beginning 1 day after administration of the last dose of DMBA (35; Fig. 3). Tumorigenesis developed more slowly in Sca-1 KO mice than in WT mice, and KO mice treated with GW7845 exhibited increased survival and an 80% reduction in tumor formation in comparison with WT mice (Fig. 3A and B). There was no significant delay in tumor formation in WT mice treated with GW7845 (Fig. 3A and B). In contrast, GW501516 produced an increased rate of tumorigenesis in WT mice, whereas, Sca-1 KO mice were unaffected by this treatment (Fig. 3C and D). Sca-1 KO mice tended to present with a higher percentage of adenocarcinomas and a lower percentage of squamous cell carcinomas than WT mice (30), although it did not reach statistical significance (Table 1). Analysis of the adenocarcinomas from WT and KO mice (Fig. 4A) generally phenocopied the changes found in the mammary gland (Fig. 2A), as shown by the increase in PPARγ levels (Fig. 4B) and reduction in the ratio of pSer84PPARγ/PPARγ (Fig. 4C), as well as decreased expression of PPARδ (Fig. 4D). Although the percentage of pERK1/2/ERK was reduced in tumors from Sca-1 KO mice (Fig. 4E), it did not approach the changes observed in the mammary gland.

Figure 3.

Sca-1 deficiency enhances the chemopreventive effect of a PPARγ agonist, and attenuates the tumor promoting action of a PPARδ agonist. A, survival curve following treatment with MP/DMBA and maintenance on a diet supplemented with 0.005% GW7845. Only GW7845-treated KO mice exhibited a significant reduction in tumorigenesis (P = 0.001 by the log-rank test), which developed more slowly in KO mice (P = 0.033). The number (N) of mice per group was: WT (N = 10), WT + GW7845 (N = 8), KO (N = 19), KO + GW7845 (N = 9). B, cumulative tumor incidence in GW7845-treated mice. Animals were treated as in A. KO mice treated with GW7845 exhibited a significant reduction in tumorigenesis versus control KO mice (P = 0.001 by the log-rank test). C, survival curve following treatment with MP/DMBA and maintenance on a diet supplemented with GW501516. Carcinogenesis was induced as in A, except that animals were administered a diet supplemented with 0.005% GW501516. Only WT mice treated with GW501516 exhibited a significant increase in tumorigenesis (P = 0.03 by the log-rank test), which developed more slowly in KO mice versus WT mice (P = 0.009). The number (N) of mice per group was: WT (N = 10), WT + GW501516 (N = 5), KO (N = 10), KO + GW501516 (N = 6). D, cumulative tumor incidence in GW501516-treated mice. Animals were treated as in C. Only WT mice treated with GW501516 exhibited a significant increase in tumorigenesis (P = 0.03) by the log-rank test.

Figure 3.

Sca-1 deficiency enhances the chemopreventive effect of a PPARγ agonist, and attenuates the tumor promoting action of a PPARδ agonist. A, survival curve following treatment with MP/DMBA and maintenance on a diet supplemented with 0.005% GW7845. Only GW7845-treated KO mice exhibited a significant reduction in tumorigenesis (P = 0.001 by the log-rank test), which developed more slowly in KO mice (P = 0.033). The number (N) of mice per group was: WT (N = 10), WT + GW7845 (N = 8), KO (N = 19), KO + GW7845 (N = 9). B, cumulative tumor incidence in GW7845-treated mice. Animals were treated as in A. KO mice treated with GW7845 exhibited a significant reduction in tumorigenesis versus control KO mice (P = 0.001 by the log-rank test). C, survival curve following treatment with MP/DMBA and maintenance on a diet supplemented with GW501516. Carcinogenesis was induced as in A, except that animals were administered a diet supplemented with 0.005% GW501516. Only WT mice treated with GW501516 exhibited a significant increase in tumorigenesis (P = 0.03 by the log-rank test), which developed more slowly in KO mice versus WT mice (P = 0.009). The number (N) of mice per group was: WT (N = 10), WT + GW501516 (N = 5), KO (N = 10), KO + GW501516 (N = 6). D, cumulative tumor incidence in GW501516-treated mice. Animals were treated as in C. Only WT mice treated with GW501516 exhibited a significant increase in tumorigenesis (P = 0.03) by the log-rank test.

Close modal
Figure 4.

Sca-1 deficient adenocarcinomas express increased PPARγ, and reduced pSer84PPARγ, PPARδ, and pERK. A lysates from adenocarcinomas induced in 2 WT and 2 KO mice by MP/DMBA were probed by Western blotting for pSer84PPARγ, PPARγ, pERK1/2, ERK1/2, PPARδ, PTEN, and β-actin. B bar graph of PPARγ levels shown in A. C, bar graph of the ratio of pSer84PPARγ/PPARγ shown in A. D, bar graph of PPARδ levels shown in A. E, bar graph of the ratio of pERK1/2/ERK1/2 tumors shown in A. All values were normalized to actin.

Figure 4.

Sca-1 deficient adenocarcinomas express increased PPARγ, and reduced pSer84PPARγ, PPARδ, and pERK. A lysates from adenocarcinomas induced in 2 WT and 2 KO mice by MP/DMBA were probed by Western blotting for pSer84PPARγ, PPARγ, pERK1/2, ERK1/2, PPARδ, PTEN, and β-actin. B bar graph of PPARγ levels shown in A. C, bar graph of the ratio of pSer84PPARγ/PPARγ shown in A. D, bar graph of PPARδ levels shown in A. E, bar graph of the ratio of pERK1/2/ERK1/2 tumors shown in A. All values were normalized to actin.

Close modal
Table 1.

Tumor histopathology. WT C57BL/6 and Sca-1 KO mice were the control groups fed standard rodent chowa

Tumor histologyWTSca-1 KO
Adenocarcinoma 6 (43%) 14 (56%) 
Adenosquamous/squamous 4 (28.5%) 2 (8%) 
Myoepithelial 4 (28.5%) 9 (36%) 
Tumor histologyWTSca-1 KO
Adenocarcinoma 6 (43%) 14 (56%) 
Adenosquamous/squamous 4 (28.5%) 2 (8%) 
Myoepithelial 4 (28.5%) 9 (36%) 

NOTE: The number of tumors and the percentage of each type is indicated. There was no significant difference in the percentage of each histotype.

aAs in Fig. 3.

Adenocarcinomas from WT and KO mice were also assessed for changes in gene expression. Tumors from KO mice expressed ≥2.5-fold changes in 182 genes (Supplementary Table S1), of which 108 genes exhibited increased expression and 74 genes reduced expression. Reduced gene expression in tumors from KO mice was associated predominantly with proteolytic and developmental processes, whereas increased gene expression was associated with the cell cycle, mitosis, and cell division (Supplementary Table S2).

Sca-1 negatively regulates PPARγ expression by reducing proteasomal turnover

The mechanism by which Sca-1 deficiency increased PPARγ expression was further examined in mammary tumor cell line 34T using RNA interference. Cells were transduced with a lentivirus expressing either an EGFP shRNA as a control or a Sca-1 shRNA (D8 cells) to reduce Sca-1 expression (ref. 21; Fig. 5A). Reduction of Sca-1 increased PPARγ 2-fold and reduced the ratio of pSer84PPARγ/PPARγ by 70% (Fig. 5B). These changes were accompanied by a 50% reduction in the ratio of pERK1/2/ERK (Fig. 5B), and an increase in PTEN expression (Fig. 5A). Treatment of cells with GW7845 further enhanced PPARγ levels in both cell lines (Fig. 5C), which was consistent with ligand-induced stability and/or autoactivation. To determine if increased PPARγ expression was due to reduced turnover, cells were treated with the proteasome inhibitor lactacystin (Fig. 5D). Lactacystin increased PPARγ levels to a greater extent in 34T cells than in D8 cells (Fig. 5D), and correlated with the reduced ratio of pSer84PPARγ/PPARγ in these cells. Higher expression of PPARγ in D8 cells correlated with the increased expression of 2 PPARγ-dependent genes, PTEN and FABP3, which was consistent with the higher ratio of the activated hypophosphorylated species of Ser84PPARγ in these cells (ref. 44–46; Fig. 5E). Overall, these results suggest that Sca-1 deficiency in the mammary gland increases PPARγ expression and activity through a combination of effects resulting from ligand stabilization, decreased ERK1/2-dependent phosphorylation and reduced susceptibility to proteasomal degradation.

Figure 5.

Reduction of Sca-1 increases PPARγ expression. A, 34T mammary tumor cells were transduced with either a GFP shRNA (34T) or a Sca-1 shRNA (D8) and probed by Western blotting for expression of Sca-1, pSer84PPARγ, PPARγ, pERK1/2, ERK1/2, PTEN, and β-actin. Reduction of Sca-1 increased PPARγ and reduced the percentage of pSer84PPARγ and pERK. B, bar graphs of the Western blots shown in A. C, GW7845 increases PPARγ expression. 34T and D8 cells in A were treated overnight with 0.1 μmol/L GW7845. Bar graph indicates that GW7845 enhanced PPARγ levels to a greater extent in D8 cells than in 34T cells. D, effect of proteasome inhibition on pSer84PPARγ and PPARγ expression. 34T and D8 cells were treated overnight with 1 μmol/L lactacystin. Bar graph indicates that PPARγ expression is increased to a greater extent in 34T cells than in D8 cells. E, reduction of Sca-1 increases PTEN and FABP3 mRNA expression. 34T and D8 cells were analyzed for PTEN and FABP3 mRNA levels by qRT-PCR and all values were normalized to actin. There was a significant difference between 34T and D8 cells in PTEN mRNA levels (P < 0.01, N = 3) and FABP3 mRNA levels (P < 0.001, N = 3) by the 2-sided Student t test. F, schematic of the regulation of PPARγ by Sca-1. Sca-1 is envisioned to suppress PTEN in part through ERK-mediated inhibition of PPARγ. Phosphatidylinositol 3-kinase (PI3K)-dependent Ras/ERK signaling results in increased inhibition of PPARγ by ERK-mediated phosphorylation on Ser84, which in turn reduces PTEN transcription. The opposite effect occurs during Sca-1 deficiency, which results in reduced progenitor cell expansion, delayed tumorigenesis and increased sensitivity to PPARγ agonists.

Figure 5.

Reduction of Sca-1 increases PPARγ expression. A, 34T mammary tumor cells were transduced with either a GFP shRNA (34T) or a Sca-1 shRNA (D8) and probed by Western blotting for expression of Sca-1, pSer84PPARγ, PPARγ, pERK1/2, ERK1/2, PTEN, and β-actin. Reduction of Sca-1 increased PPARγ and reduced the percentage of pSer84PPARγ and pERK. B, bar graphs of the Western blots shown in A. C, GW7845 increases PPARγ expression. 34T and D8 cells in A were treated overnight with 0.1 μmol/L GW7845. Bar graph indicates that GW7845 enhanced PPARγ levels to a greater extent in D8 cells than in 34T cells. D, effect of proteasome inhibition on pSer84PPARγ and PPARγ expression. 34T and D8 cells were treated overnight with 1 μmol/L lactacystin. Bar graph indicates that PPARγ expression is increased to a greater extent in 34T cells than in D8 cells. E, reduction of Sca-1 increases PTEN and FABP3 mRNA expression. 34T and D8 cells were analyzed for PTEN and FABP3 mRNA levels by qRT-PCR and all values were normalized to actin. There was a significant difference between 34T and D8 cells in PTEN mRNA levels (P < 0.01, N = 3) and FABP3 mRNA levels (P < 0.001, N = 3) by the 2-sided Student t test. F, schematic of the regulation of PPARγ by Sca-1. Sca-1 is envisioned to suppress PTEN in part through ERK-mediated inhibition of PPARγ. Phosphatidylinositol 3-kinase (PI3K)-dependent Ras/ERK signaling results in increased inhibition of PPARγ by ERK-mediated phosphorylation on Ser84, which in turn reduces PTEN transcription. The opposite effect occurs during Sca-1 deficiency, which results in reduced progenitor cell expansion, delayed tumorigenesis and increased sensitivity to PPARγ agonists.

Close modal

Although Sca-1 is commonly used as a marker of stem and early progenitor cells in the mammary gland and other organs, its function in normal and malignant tissues has remained largely undefined. In the present study, Sca-1 deficiency enhanced the chemopreventive action of PPARγ agonist GW7845, and negated the tumor-promoting action of PPARδ agonist GW501516. These opposing actions have been previously described in WT FVB mice (35), but the almost complete protection against tumorigenesis by GW7845 in Sca-1 KO mice is most remarkable. The enhanced chemopreventive effect of GW7845 was associated with increased PPARγ and a reduced ratio of pSer84PPARγ/PPARγ, and correlated with increased expression of the PPARγ-driven gene, PTEN (47). However, the latter finding could also be explained by alterations in posttranslational processes. We have found no evidence by gene profiling of either the KO mammary gland (unpublished results) or tumors from KO mice (Supplementary Tables S1 and S2) for enhanced PTEN mRNA expression. The Sca-1 “knockdown” phenotype in mammary tumor cell line D8 correlated with increased tumor suppressor signaling, in part through TGFβ ligand GDF10 and possibly increased PTEN levels (21). In the present study, D8 cells also expressed moderately higher PPARγ levels and a lower relative percentage of pSer84PPARγ and pERK1/2, which are consistent with the phenotype of the KO mammary gland. Because ERK-dependent phosphorylation at Ser84PPARγ has been reported to inhibit transcriptional activity (44–46) and promote proteasomal degradation (43), our data suggest that PPARγ is regulated through a posttranslational rather than by a transcriptional mechanism (47). One explanation for this effect is that ERK1/2 is activated downstream of Ras signaling by dominant-negative regulation of PPARγ (34), an alteration that may set into motion repression of PPARγ signaling and negate some of the effects of PPARγ agonists, whereas, the opposite occurs in KO mice. A second level of regulation may also result from changes in the ratio of PPARγ to PPARδ as was evident in both the KO mammary gland and tumors. Increased expression of PPARδ leads to inhibition of PPARγ target genes, and has been postulated to serve as a “gateway receptor” that can modulate PPARγ-mediated processes, such as adipogenesis (48). These opposing actions of PPARγ and PPARδ agree with their opposite functions in mammary tumorigenesis (25, 34, 35). Because there are more than 1,000 genes in the human genome containing PPAR response elements, which encompass 25 biological processes, including mitogen-activated protein kinase signaling (49), the mechanism by which PPAR signaling ultimately affects tumorigenesis is likely to occur directly, as well as through modulation of ancillary processes, such as angiogenesis, inflammation, and immune function (25, 50).

In addition to the negative regulation of the tumor suppressors PPARγ and PTEN in Sca-1 KO mice, Sca-1 was recently shown to block TGF-β signaling through a unique GDF10/Smad3 signaling pathway (21). It is interesting that PPARγ also regulates the tumor suppressor gene RASSF5 (51), a suppressor of the ERK pathway (52), which could additionally contribute to the antiproliferative effects of Sca-1 deficiency. Overall, these actions may account for the association of Sca-1 with metastasis (53–55), mammary tumor–initiating cell capacity in MMTV-Wnt1 and MMTV-ErbB2 mice (19, 20), and BCR-ABL–induced chronic myeloid leukemia (56), as well as radiation resistance (57, 58). Although, the Sca-1/Ly6A gene is missing in the human genome (59), there are Ly6 family members that may serve a similar purpose in breast cancer. In this context, the 8q24.3 amplicon identified in breast cancer includes the Ly6 locus (60), Ly6D is a marker of basal-type breast cancer (61) and micrometastases in head and neck cancer (62), and Ly6K is a marker of breast (63) and head and neck cancer (64). However, a comprehensive analysis of Ly6 gene expression and their function in breast and other cancers has not been reported.

Another intriguing finding was that Sca-1 deficient mammary gland exhibited a reduced basal proliferative state as determined by p21Cip1, pRB and Ki-67 expression, as well as a reduced response to progestin stimulation (Fig. 1). This phenotype likely contributed to the delay in tumor formation following carcinogenesis, and to the enhanced response to GW7845. However, Sca-1 deficiency did not alter lactation and involution in multiparous animals (results not shown), suggesting that Sca-1 likely functions in a developmentally and physiologically stochastic manner. This agrees with its role in modulating the proliferation of multipotent hematopoietic cells (17), and the tumorigenicity of mammary tumor cells (21). Thus, Sca-1 may act as a rheostat of proliferation under specific conditions and cooperate with other signaling pathways. In this regard, Sca-1 KO mice were deficient in the stem and progenitor cell marker, Musashi1 (65), suggesting a link to the Notch and Wnt pathways under its control in mammary epithelial (66) and breast cancer cells (67). Thus, Sca-1 seems to be a master modulator of tumor suppressor function that ultimately impinges on tumorigenesis and the action of chemopreventive agents.

The content does not necessarily represent the official views of the National Cancer Institute or the NIH. No potential conflicts of interest were disclosed.

This investigation was conducted using the Animal Research, Flow Cytometry, Genomics and Epigenomics, and Microscopy and Imaging Shared Resources.

The work was supported by NIH grant 1NO1 CN43302-WA19 (R.I. Glazer). This study was supported by Award P30CA051008 from the National Cancer Institute, NIH, and by Grant 1G20RR025828-01 from the NIH for Rodent Barrier Facility Equipment.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Sharom
FJ
,
Lehto
MT
. 
Glycosylphosphatidylinositol-anchored proteins: structure, function, and cleavage by phosphatidylinositol-specific phospholipase C
.
Biochem Cell Biol
2002
;
80
:
535
49
.
2.
van de Rijn
M
,
Heimfeld
S
,
Spangrude
GJ
,
Weissman
IL
. 
Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6 antigen family
.
Proc Natl Acad Sci U S A
1989
;
86
:
4634
8
.
3.
Linke
A
,
Muller
P
,
Nurzynska
D
,
Casarsa
C
,
Torella
D
,
Nascimbene
A
, et al
Stem cells in the dog heart are self-renewing, clonogenic, and multipotent and regenerate infarcted myocardium, improving cardiac function
.
Proc Natl Acad Sci U S A
2005
;
102
:
8966
71
.
4.
Mitchell
PO
,
Mills
T
,
O'Connor
RS
,
Graubert
T
,
Dzierzak
E
,
Pavlath
GK
. 
Sca-1 negatively regulates proliferation and differentiation of muscle cells
.
Dev Biol
2005
;
283
:
240
52
.
5.
Welm
BE
,
Tepera
SB
,
Venezia
T
,
Graubert
TA
,
Rosen
JM
,
Goodell
MA
. 
Sca-1(pos) cells in the mouse mammary gland represent an enriched progenitor cell population
.
Dev Biol
2002
;
245
:
42
56
.
6.
Chen
HC
,
Frissora
F
,
Durbin
JE
,
Muthusamy
N
. 
Activation induced differential regulation of stem cell antigen-1 (Ly-6A/E) expression in murine B cells
.
Cell Immunol
2003
;
225
:
42
52
.
7.
Li
Y
,
Rosen
JM
. 
Stem/progenitor cells in mouse mammary gland development and breast cancer
.
J Mammary Gland Biol Neoplasia
2005
;
10
:
17
24
.
8.
Luna
G
,
Paez
J
,
Cardier
JE
. 
Expression of the hematopoietic stem cell antigen Sca-1 (LY-6A/E) in liver sinusoidal endothelial cells: possible function of Sca-1 in endothelial cells
.
Stem Cells Dev
2004
;
13
:
528
35
.
9.
Burger
PE
,
Xiong
X
,
Coetzee
S
,
Salm
SN
,
Moscatelli
D
,
Goto
K
, et al
Sca-1 expression identifies stem cells in the proximal region of prostatic ducts with high capacity to reconstitute prostatic tissue
.
Proc Natl Acad Sci U S A
2005
;
102
:
7180
5
.
10.
Tateishi
K
,
Ashihara
E
,
Takehara
N
,
Nomura
T
,
Honsho
S
,
Nakagami
T
, et al
Clonally amplified cardiac stem cells are regulated by Sca-1 signaling for efficient cardiovascular regeneration
.
J Cell Sci
2007
;
120
:
1791
800
.
11.
Welm
B
,
Behbod
F
,
Goodell
MA
,
Rosen
JM
. 
Isolation and characterization of functional mammary gland stem cells
.
Cell Prolif
2003
;
36
Suppl 1
:
17
32
.
12.
Deugnier
MA
,
Faraldo
MM
,
Teuliere
J
,
Thiery
JP
,
Medina
D
,
Glukhova
MA
. 
Isolation of mouse mammary epithelial progenitor cells with basal characteristics from the Comma-Dbeta cell line
.
Dev Biol
2006
;
293
:
414
25
.
13.
Woodward
WA
,
Chen
MS
,
Behbod
F
,
Rosen
JM
. 
On mammary stem cells
.
J Cell Sci
2005
;
118
:
3585
94
.
14.
Hanson
P
,
Mathews
V
,
Marrus
SH
,
Graubert
TA
. 
Enhanced green fluorescent protein targeted to the Sca-1 (Ly-6A) locus in transgenic mice results in efficient marking of hematopoietic stem cells in vivo
.
Exp Hematol
2003
;
31
:
159
67
.
15.
Chepko
G
,
Smith
GH
. 
Mammary epithelial stem cells: our current understanding
.
J Mammary Gland Biol Neoplasia
1999
;
4
:
35
52
.
16.
Smalley
M
,
Ashworth
A
. 
Stem cells and breast cancer: a field in transit
.
Nat Rev Cancer
2003
;
3
:
832
44
.
17.
Chang
HH
,
Hemberg
M
,
Barahona
M
,
Ingber
DE
,
Huang
S
. 
Transcriptome-wide noise controls lineage choice in mammalian progenitor cells
.
Nature
2008
;
453
:
544
7
.
18.
Stingl
J
,
Eirew
P
,
Ricketson
I
,
Shackleton
M
,
Vaillant
F
,
Choi
D
, et al
Purification and unique properties of mammary epithelial stem cells
.
Nature
2006
;
439
:
993
7
.
19.
Li
Y
,
Welm
B
,
Podsypanina
K
,
Huang
S
,
Chamorro
M
,
Zhang
X
, et al
Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells
.
Proc Natl Acad Sci U S A
2003
;
100
:
15853
8
.
20.
Grange
C
,
Lanzardo
S
,
Cavallo
F
,
Camussi
G
,
Bussolati
B
. 
Sca-1 identifies the tumor-initiating cells in mammary tumors of BALB-neuT transgenic mice
.
Neoplasia
2008
;
10
:
1433
43
.
21.
Upadhyay
G
,
Yin
Y
,
Yuan
H
,
Li
X
,
Derynck
R
,
Glazer
RI
. 
Stem cell antigen-1 enhances tumorigenicity by disruption of growth differentiation factor-10 (GDF10)-dependent TGF-{beta} signaling
.
Proc Natl Acad Sci U S A
2011
;
108
:
7820
5
.
22.
Berger
JP
,
Akiyama
TE
,
Meinke
PT
. 
PPARs: therapeutic targets for metabolic disease
.
Trends Pharmacol Sci
2005
;
26
:
244
51
.
23.
Evans
RM
,
Barish
GD
,
Wang
YX
. 
PPARs and the complex journey to obesity
.
Nat Med
2004
;
10
:
355
61
.
24.
Lehrke
M
,
Lazar
MA
. 
The many faces of PPARgamma
.
Cell
2005
;
123
:
993
9
.
25.
Glazer
RI
,
Yuan
H
,
Xie
Z
,
Yin
Y
. 
PPARgamma and PPARdelta as modulators of neoplasia and cell fate
.
PPAR Res
2008
;
2008
:
247379
.
26.
Kopelovich
L
,
Fay
JR
,
Glazer
RI
,
Crowell
JA
. 
Peroxisome proliferator-activated receptor modulators as potential chemopreventive agents
.
Mol Cancer Ther
2002
;
1
:
357
63
.
27.
Stoll
BA
. 
Linkage between retinoid and fatty acid receptors: implications for breast cancer prevention
.
Eur J Cancer Prev
2002
;
11
:
319
25
.
28.
Rosen
ED
,
Spiegelman
BM
. 
PPARgamma: a nuclear regulator of metabolism, differentiation, and cell growth
.
J Biol Chem
2001
;
276
:
37731
4
.
29.
Mehta
RG
,
Williamson
E
,
Patel
MK
,
Koeffler
HP
. 
A ligand of peroxisome proliferator-activated receptor gamma, retinoids, and prevention of preneoplastic mammary lesions
.
J Natl Cancer Inst
2000
;
92
:
418
23
.
30.
Yin
Y
,
Bai
R
,
Russell
RG
,
Beildeck
ME
,
Xie
Z
,
Kopelovich
L
, et al
Characterization of medroxyprogesterone and DMBA-induced multilineage mammary tumors by gene expression profiling
.
Mol Carcinog
2005
;
44
:
42
50
.
31.
Pighetti
GM
,
Novosad
W
,
Nicholson
C
,
Hitt
DC
,
Hansens
C
,
Hollingsworth
AB
, et al
Therapeutic treatment of DMBA-induced mammary tumors with PPAR ligands
.
Anticancer Res
2001
;
21
:
825
9
.
32.
Suh
N
,
Wang
Y
,
Williams
CR
,
Risingsong
R
,
Gilmer
T
,
Willson
TM
, et al
A new ligand for the peroxisome proliferator-activated receptor-gamma (PPAR-gamma), GW7845, inhibits rat mammary carcinogenesis
.
Cancer Res
1999
;
59
:
5671
3
.
33.
Nicol
CJ
,
Yoon
M
,
Ward
JM
,
Yamashita
M
,
Fukamachi
K
,
Peters
JM
, et al
PPARgamma influences susceptibility to DMBA-induced mammary, ovarian and skin carcinogenesis
.
Carcinogenesis
2004
;
25
:
1747
55
.
34.
Yin
Y
,
Yuan
H
,
Zeng
X
,
Kopelovich
L
,
Glazer
RI
. 
Inhibition of peroxisome proliferator-activated receptor gamma increases estrogen receptor-dependent tumor specification
.
Cancer Res
2009
;
69
:
687
94
.
35.
Yin
Y
,
Russell
RG
,
Dettin
LE
,
Bai
R
,
Wei
ZL
,
Kozikowski
AP
, et al
Peroxisome proliferator-activated receptor delta and gamma agonists differentially alter tumor differentiation and progression during mammary carcinogenesis
.
Cancer Res
2005
;
65
:
3950
7
.
36.
Ghosh
M
,
Ai
Y
,
Narko
K
,
Wang
Z
,
Peters
JM
,
Hla
T
. 
PPARdelta is pro-tumorigenic in a mouse model of COX-2-induced mammary cancer
.
Prostaglandins Other Lipid Mediat
2009
;
88
:
97
100
.
37.
Pollock
CB
,
Rodriguez
O
,
Martin
PL
,
Albanese
C
,
Li
X
,
Kopelovich
L
, et al
Induction of metastatic gastric cancer by peroxisome proliferator-activated receptor-delta activation
.
PPAR Res
2010
;
2010
:
571783
.
38.
Park
BH
,
Vogelstein
B
,
Kinzler
KW
. 
Genetic disruption of PPARdelta decreases the tumorigenicity of human colon cancer cells
.
Proc Natl Acad Sci U S A
2001
;
98
:
2598
603
.
39.
Zuo
X
,
Peng
Z
,
Moussalli
MJ
,
Morris
JS
,
Broaddus
RR
,
Fischer
SM
, et al
Targeted genetic disruption of peroxisome proliferator-activated receptor-delta and colonic tumorigenesis
.
J Natl Cancer Inst
2009
;
101
:
762
7
.
40.
Peters
JM
,
Hollingshead
HE
,
Gonzalez
FJ
. 
Role of peroxisome-proliferator-activated receptor beta/delta (PPARbeta/delta) in gastrointestinal tract function and disease
.
Clin Sci (Lond)
2008
;
115
:
107
27
.
41.
Stanford
WL
,
Haque
S
,
Alexander
R
,
Liu
X
,
Latour
AM
,
Snodgrass
HR
, et al
Altered proliferative response by T lymphocytes of Ly-6A (Sca-1) null mice
.
J Exp Med
1997
;
186
:
705
17
.
43.
Floyd
ZE
,
Stephens
JM
. 
Interferon-gamma-mediated activation and ubiquitin-proteasome-dependent degradation of PPARgamma in adipocytes
.
J Biol Chem
2002
;
277
:
4062
8
.
44.
Adams
M
,
Reginato
MJ
,
Shao
D
,
Lazar
MA
,
Chatterjee
VK
. 
Transcriptional activation by peroxisome proliferator-activated receptor gamma is inhibited by phosphorylation at a consensus mitogen- activated protein kinase site
.
J Biol Chem
1997
;
272
:
5128
32
.
45.
Hu
E
,
Kim
JB
,
Sarraf
P
,
Spiegelman
BM
. 
Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPARgamma
.
Science
1996
;
274
:
2100
3
.
46.
Shao
D
,
Rangwala
SM
,
Bailey
ST
,
Krakow
SL
,
Reginato
MJ
,
Lazar
MA
. 
Interdomain communication regulating ligand binding by PPAR-gamma
.
Nature
1998
;
396
:
377
80
.
47.
Patel
L
,
Pass
I
,
Coxon
P
,
Downes
CP
,
Smith
SA
,
Macphee
CH
. 
Tumor suppressor and anti-inflammatory actions of PPARgamma agonists are mediated via upregulation of PTEN
.
Curr Biol
2001
;
11
:
764
8
.
48.
Shi
Y
,
Hon
M
,
Evans
RM
. 
The peroxisome proliferator-activated receptor delta, an integrator of transcriptional repression and nuclear receptor signaling
.
Proc Natl Acad Sci U S A
2002
;
99
:
2613
8
.
49.
Lemay
DG
,
Hwang
DH
. 
Genome-wide identification of peroxisome proliferator response elements using integrated computational genomics
.
J Lipid Res
2006
;
47
:
1583
7
.
50.
Shearer
BG
,
Hoekstra
WJ
. 
Recent advances in peroxisome proliferator-activated receptor science
.
Curr Med Chem
2003
;
10
:
267
80
.
51.
Foukakis
T
,
Au
AY
,
Wallin
G
,
Geli
J
,
Forsberg
L
,
Clifton-Bligh
R
, et al
The Ras effector NORE1A is suppressed in follicular thyroid carcinomas with a PAX8-PPARgamma fusion
.
J Clin Endocrinol Metab
2006
;
91
:
1143
9
.
52.
Moshnikova
A
,
Frye
J
,
Shay
JW
,
Minna
JD
,
Khokhlatchev
AV
. 
The growth and tumor suppressor NORE1A is a cytoskeletal protein that suppresses growth by inhibition of the ERK pathway
.
J Biol Chem
2006
;
281
:
8143
52
.
53.
Cohn
MA
,
Kramerov
D
,
Hulgaard
EF
,
Lukanidin
EM
. 
The differentiation antigen Ly-6E.1 is expressed in mouse metastatic tumor cell lines
.
FEBS Lett
1997
;
403
:
181
5
.
54.
Treister
A
,
Sagi-Assif
O
,
Meer
M
,
Smorodinsky
NI
,
Anavi
R
,
Golan
I
, et al
Expression of Ly-6, a marker for highly malignant murine tumor cells, is regulated by growth conditions and stress
.
Int J Cancer
1998
;
77
:
306
13
.
55.
Xin
L
,
Lawson
DA
,
Witte
ON
. 
The Sca-1 cell surface marker enriches for a prostate-regenerating cell subpopulation that can initiate prostate tumorigenesis
.
Proc Natl Acad Sci U S A
2005
;
102
:
6942
7
.
56.
Perez-Caro
M
,
Cobaleda
C
,
Gonzalez-Herrero
I
,
Vicente-Duenas
C
,
Bermejo-Rodriguez
C
,
Sanchez-Beato
M
, et al
Cancer induction by restriction of oncogene expression to the stem cell compartment
.
Embo J
2009
;
28
:
8
20
.
57.
Chen
MS
,
Woodward
WA
,
Behbod
F
,
Peddibhotla
S
,
Alfaro
MP
,
Buchholz
TA
, et al
Wnt/beta-catenin mediates radiation resistance of Sca1+ progenitors in an immortalized mammary gland cell line
.
J Cell Sci
2007
;
120
:
468
77
.
58.
Woodward
WA
,
Chen
MS
,
Behbod
F
,
Alfaro
MP
,
Buchholz
TA
,
Rosen
JM
. 
WNT/beta-catenin mediates radiation resistance of mouse mammary progenitor cells
.
Proc Natl Acad Sci U S A
2007
;
104
:
618
23
.
59.
Holmes
C
,
Stanford
WL
. 
Concise review: stem cell antigen-1: expression, function, and enigma
.
Stem Cells
2007
;
25
:
1339
47
.
60.
Naylor
TL
,
Greshock
J
,
Wang
Y
,
Colligon
T
,
Yu
QC
,
Clemmer
V
, et al
High resolution genomic analysis of sporadic breast cancer using array-based comparative genomic hybridization
.
Breast Cancer Res
2005
;
7
:
R1186
98
.
61.
Herschkowitz
JI
,
Simin
K
,
Weigman
VJ
,
Mikaelian
I
,
Usary
J
,
Hu
Z
, et al
Identification of conserved gene expression features between murine mammary carcinoma models and human breast tumors
.
Genome Biol
2007
;
8
:
R76
.
62.
Colnot
DR
,
Nieuwenhuis
EJ
,
Kuik
DJ
,
Leemans
CR
,
Dijkstra
J
,
Snow
GB
, et al
Clinical significance of micrometastatic cells detected by E48 (Ly-6D) reverse transcription-polymerase chain reaction in bone marrow of head and neck cancer patients
.
Clin Cancer Res
2004
;
10
:
7827
33
.
63.
Lee
JW
,
Lee
YS
,
Yoo
KH
,
Lee
KH
,
Park
K
,
Ahn
T
, et al
LY-6K gene: a novel molecular marker for human breast cancer
.
Oncol Rep
2006
;
16
:
1211
4
.
64.
de Nooij-van Dalen
AG
,
van Dongen
GA
,
Smeets
SJ
,
Nieuwenhuis
EJ
,
Stigter-van Walsum
M
,
Snow
GB
, et al
Characterization of the human Ly-6 antigens, the newly annotated member Ly-6K included, as molecular markers for head-and-neck squamous cell carcinoma
.
Int J Cancer
2003
;
103
:
768
74
.
65.
Okano
H
,
Kawahara
H
,
Toriya
M
,
Nakao
K
,
Shibata
S
,
Imai
T
. 
Function of RNA-binding protein Musashi-1 in stem cells
.
Exp Cell Res
2005
;
306
:
349
56
.
66.
Wang
XY
,
Yin
Y
,
Yuan
H
,
Sakamaki
T
,
Okano
H
,
Glazer
RI
. 
Musashi1 modulates mammary progenitor cell expansion through proliferin-mediated activation of the Wnt and Notch pathways
.
Mol Cell Biol
2008
;
28
:
3589
99
.
67.
Wang
XY
,
Penalva
LO
,
Yuan
H
,
Linnoila
RI
,
Lu
J
,
Okano
H
, et al
Musashi1 regulates breast tumor cell proliferation and is a prognostic indicator of poor survival
.
Mol Cancer
2010
;
9
:
221
32
.