Inhibition of Intestinal Polyp Formation by Pitavastatin, a HMG-CoA Reductase Inhibitor

Epidemiological studies have suggested that mortality and morbidity of colon cancer are increasing in developed countries (1, 2). Thus, it is very important to establish effective methods to prevent colon cancer development. Consumption of a high-fat diet is a considerable risk factor of colon cancer with clear link with hyperlipidemia. Hyperlipidemia has also been indicated to be positively associated with colon carcinogenesis (3, 4). We have reported Apc deficient, Min and Apc¹³⁰⁹ mice, which developed a large number of intestinal polyps showed the hyperlipidemic state (5–7). Interestingly, improvement of hyperlipidemic state by peroxisome proliferator-activated receptor (PPAR) α and γ agonists and a selective LPL-inducing agent, NO-1886, which does not possess PPARs agonistic activity, suppressed intestinal polyp formation in Min mice. Thus, it is conceivable that drugs, which effectively improve hyperlipidemia, could also prevent colon cancer development.

Statins, 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors, are commonly used for the treatment of hypercholesterolemia (8, 9). Among statins, pravastatin, lovastatin, and simvastatin are so called the first-generation statins (10, 11), and fluvastatin is the second-generation statin (12). Recently, the third-generation statins, such as atorvastatin and rosuvastatin, were developed (13, 14), which strongly suppress serum LDL-cholesterol levels compared with the former generation statins. The Molecular Epidemiology of Colorectal Cancer (MECC) study has indicated that use of statins for 5 years or longer significantly reduced the risk of colorectal cancer by 47% (15). Meanwhile, some epidemiological studies using the first-generation statins, lovastatin and pravastatin (16, 17), are not fully consistent with above data. One of the reasons might be the suboptimal administration of the drug, in which efficacy of statins could not be shown, and another reason might be the difference of statin generation. Thus, epidemiological and/or experimental data on third-generation statins are desired to evaluate its chemopreventive effects on colon cancer.

Previous animal studies have shown that pravastatin and atorvastatin suppressed 1,2-dimethylhydrazine (DMH) or azoxymethane (AOM)-induced colon cancer development in mice and rats, respectively (18, 19). Recent animal studies have shown that 100-ppm atorvastatin reduced the incidnce of small intestinal polyp (adenoma) in Min mice to about 70% of the control group (20). Meanwhile, 10-ppm pitavastatin, a novel third-generation lipophilic statin (21), reduced the incidence of colon adenoma or adenocarcinoma induced by AOM/dextran sodium sulfate treatment in ICR mice to about 78% of the control group (22). These results implied that pitavastatin may have a potent effect against colon tumor formation in rodent.

Pitavastatin may also have several clinical advantages over other statins. Similar serum triglyceride (TG) levels could be achieved by doses of pitavastatin (2 mg/d) lower than those of atorvastatin or rosuvastatin (10 mg/d). Lowering potentiality of pitavastatin on serum LDL-cholesterol is greater than that of pravastatin and is similar to atorvastatin (23, 24). As pitavastatin is hardly metabolized by cytochrome P450 compared with other statins, pitavastatin has advantage of not having unexpected interactions with other drugs.

In addition to the main function of statins, which is inhibition of the synthesis of mevalonate, statin also suppresses inflammation. Statins concomitantly suppress geranylgeranylation of protein, such as the small GTP-binding proteins RhoA, Ras, Cdc42, and Rac (25,26), which activate intracellular signaling molecules. Thus, pleiotropic action of pitavastatin could be involved in the suppression of cancer development.

In this study, we clarified the suppressive effect of pitavastatin on intestinal polyp development in Min mice. The mechanism involved in the suppressive effect of pitavastatin treatment on intestinal polyp formation in Min mice was also examined and further discussed.

Male C57BL/6J-Apc^Min/+ mice (Min mice) were purchased from The Jackson Laboratory at 6 weeks of age and genotyped as previously reported (27). Heterozygotes of the Min strain and wild-type (C57BL/6J) mice were acclimated to laboratory conditions for 1 week. Four or five mice were housed per plastic cage with sterilized softwood chips as bedding in a barrier-sustained animal room at 24 ± 2°C and 55% humidity on a 12-hour light/dark cycle. The pitavastatin, (+)-monocalcium bis{(3R,5S,6E)-7-[2-cyclopropyl-4-(4-fluorophenyl)-3-quinolyl]-3,5-dihydroxy-6-heptenoate} (C₅₀H₄₆CaF₂N₂O₈, MW 880.98), was kindly provided by Kowa Pharmaceutical Co., Ltd. Pitavastatin was well mixed at the concentrations of 20 and 40 ppm in AIN-76A powdered basal diet (CLEA).

To investigate the effects of pitavastatin on intestinal polyp formation, male Min mice at 6 weeks of age were given 0, 20, 40 ppm of pitavastatin in the diet for 14 weeks. Min mice were divided into groups of 20. With 20 ppm of pitavastatin, 4 mice died during the experiment. Food and water were available ad libitum. The animals were observed daily for health appearance and mortality. Body weights and food consumption were measured weekly. Animals were anesthetized with ether and sacrificed, and blood samples were collected from the caudal vena cava. Serum levels of TG and total cholesterol were measured as reported previously (6). The experiments were carried out according to the “Guidelines for Animal Experiments in the National Cancer Center” and were approved by the Institutional Ethics Review Committee for Animal Experimentation in the National Cancer Center.

The intestinal tract was removed and separated into the small intestine, cecum, and colon. The small intestine was divided into the proximal segment (4 cm in length), and then the proximal (middle) and distal halves of the remainder. Polyps in the proximal segments were counted and all polyps were picked up under a stereoscopic microscope and the remaining intestinal mucosa (nonpolyp part) was removed by scraping, and then both stored at −80°C for the further real-time PCR analysis. Other segments were opened longitudinally and fixed flat between sheets of filter paper in 10% buffered formalin. The numbers and sizes of polyps and their distributions in the intestine were assessed with a stereoscopic microscope (6). A part of liver, femoral muscle, visceral fat, and right kidney were kept in 10% buffered formalin, and residues of liver, femoral muscle, visceral fat, and left kidney were frozen by liquid nitrogen and then stored at −80°C.

Serum samples from 20-week-old male Min mice with or without pitavastatin were measured for serum concentrations of adiponectin (R&D Systems), leptin (B-Bridge International, inc.), Pai-1 (Innovative) by an enzyme immunoassay and IL-1β, IL-6, MCP-1, TNFα, VEGF were determined by using Procarta Cytokine Assay mouse (Affymetrix, inc.) according to the manufacturer's protocol.

The middle segments of the small intestines were fixed, embedded, and sectioned as Swiss rolls for further immunohistochemical examination with the avidin–biotin complex immunoperoxidase technique. Polyclonal goat anti-COX-2 and anti-MCP-1 antibody (Santa Cruz Biotechnology), polyclonal rabbit anti-Pai-1 antibody (Santa Cruz Biotechnology), polyclonal rabbit anti-PPARγ antibody (Cell Signaling), monoclonal mouse anti-iNOS antibody, and anti-nitrotyrosin antibody (Santa Cruz Biotechnology) were used at 100x dilution. Polyclonal rabbit anti-8-nitroguanosine antibody (Cosmo Bio Co., Ltd.) and polyclonal goat anti-IL-6 antibody (Santa Cruz Biotechnology) were used at 50x dilution. As the secondary antibody, biotinylated anti-goat, -rabbit, and -mouse IgG (Vector Laboratories) were employed at 200x dilution. Staining was done using avidin biotin reagents (Vectastain ABC reagents; Vector Laboratories), 3,3′-diaminobenzidine and hydrogen peroxide, and the sections were counterstained with hematoxylin to facilitate orientation. As a negative control, consecutive sections were immunostained without exposure to the primary antibody.

Polyps and nonpolyp parts from proximal segments of small intestine of Min mice were rapidly deep-frozen in liquid nitrogen and stored at −80°C. Total RNA was isolated from tissues by using Isogen (Nippon Gene), treated with DNase (Invitrogen) and 3-μg aliquots in a final volume of 20 μL were used for synthesis of cDNA using an Omniscript RT Kit (Qiagen) and an oligo (dT) primer. Real-time PCR was carried out using a DNA Engine Opticon 2 (MJ Japan) with SYBR Green Real-time PCR Master Mix (Toyobo) according to the manufacturer's instructions. Primers for mouse adiponectin (5′primer-AGGATGCTACTGTTGCAAGCTCTC, 3′primer-CAGTCAGTTGGTATCATGGTAGAG), COX-2 (5′primer- AGAAGGAAATGGCTGCAGAA, 3′primer-GCTCGGCTTCCAGTATTGAG), iNOS (5′primer-CCGGCAAACCCAAGGTCTACGTT, 3′primer-CACATCCCGAGCCATGCGCACATCT), IL-6 (5′primer-ACAACCACGGCCTTCCCTACTT, 3′primer-CACGATTTCCCAGAGAACATGTG), MCP-1 (5′primer-CCACTCACCTGCTGCTACTCAT, 3′primer- TGGTGATCCTCTTGTAGCTCTCC), Pai-1 (5′primer-GACACCCTCAGCATGTTCATC, 3′primer- GACTGTACAAATCACGTTGGGA), and GAPDH (5′primer-TTGTCTCCTGCGACTTCA, 3′primer-CACCACCCTGTTGCTGTA) were employed (28–31). To assess the specificity of each primer set, amplicons generated from the PCR reaction were analyzed for melting curves and also by electrophoresis in 2% agarose gels. Standard curves for absolute quantification were obtained with plasmids containing the various amplicons. From each plasmid a 10-fold dilution series was measured in duplicate. Quantification and generation of standard curves was carried out using a DNA Engine Opticon 2 (MJ Japan).

Nuclear extracts containing PPARγ from nonpolyp parts of intestinal mucosa and liver (50 mg each) of mice with or without 40-ppm pitavastatin treatment were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagents (PIERCE Biotechnology). PPARγ activation by pitavastatin treatment was assayed using an ELISA-based transactivation TransAM PPARγ kit (Active Motif) following the manufacturer's protocol.

All the results are expressed as mean ± standard errors (SE) values, with statistical analysis using Dunnett's test and PPARγ activity in intestinal nonpolyp parts and liver were performed with Student's t-test. Differences were considered to be statistically significant at P < 0.05.

Treatment with pitavastatin at doses of 20 and 40 ppm for 14 weeks did not affect body weights or health appearance of Min mice throughout the experimental period. Average daily food intake did not differ among the groups, being 2.39 ± 0.37 (mean ± SE), 2.49 ± 0.39, and 2.47 ± 0.25 g per mouse per day for the 0, 20, and 40-ppm groups of Min mice, respectively. No changes were observed in the liver, heart, kidney, and thymus weights that might have been attributable to toxicity.

Table 1 summarizes data on the number and distribution of intestinal polyps in the untreated and pitavastatin-treated groups. Almost all polyps developed in the small intestine, with only a few in the colon as reported previously (6). The treatment with pitavastatin at a dose of 40 ppm significantly reduced the total number of polyps to 65.8% (P < 0.05) of the value in the untreated group. Strong suppression of intestinal polyp development was observed at the distal parts of small intestine, with 41% reduction (P < 0.01) at 40 ppm. The maximum number of polyps was observed in the range of size from 0.5 mm to 2.5 mm in diameter. Treatment with 40-ppm pitavastatin significantly reduced the numbers of polyps ranging from 1.5 mm to 2.0 mm (P < 0.05 vs. 0 ppm; Fig. 1A). Small-size polyps (<2.0 mm) were mainly distributed in distal parts of the small intestine (Fig. 1B). The group treated with 40-ppm pitavastatin significantly reduced the number of small-size polyps (21.6 ± 1.9/mouse, P < 0.01) in distal part compared with the untreated group (33.9 ± 2.4/mouse; Fig. 1B). The number of large-size polyps (≥2.0 mm) in distal parts of the untreated group was 11.9 ± 3.5/mouse, and the number in 40-ppm pitavastatin–treated group was decreased to 5.4 ± 1.6/mouse (P < 0.05; Fig. 1C).

Consistent with our previous reports (5–7), Min mice fed with the basal diet at 20 weeks of age were in the hypertriglyceridemic state, with a TG level of 285.3 ± 64.3 mg/dL (mean ± SE). On the other hand, the TG level in wild-type mice was 32.7 ± 4.2 mg/dL. Treatment with 20 and 40-ppm pitavastatin slightly decreased serum levels of TG to 277.4 ± 68.1 mg/dL and 242.8 ± 49.9 mg/dL, respectively. However, these changes were not statistically significant. The level of total cholesterol had tendency to decrease to approximately 8%–9% of untreated group level and it did not seem to be influenced by dosage.

Serum concentrations of adiponectin, IL-1β, IL-6, leptin, MCP-1, TNFα, Pai-1, and VEGF were also measured to evaluate systemic effects of pitavastatin. Among the adipocytokines, IL-6, leptin, and MCP-1 were reduced significantly from 4.5 to 1.1 pg/mL, 2.5 to 1.4 ng/mL, and 12.1 to 7.7 pg/mL, respectively (Table 2).

To clarify the mechanisms of suppression on the development of intestinal polyps by pitavastatin treatment, mRNA expressions of COX-2, iNOS, and several adipocytokines in intestinal polyps and nonpolyp parts were investigated. Real-time PCR revealed that treatment with 20 and 40-ppm pitavastatin for 14 weeks effectively suppressed COX-2, iNOS, IL-6, MCP-1, and Pai-1 mRNA levels in intestinal nonpolyp parts of Min mice (Fig. 2A and C). Treatment with 20-ppm pitavastatin reduced COX-2, iNOS, IL-6, MCP-1, and Pai-1 mRNA levels to 15% (P < 0.05), 36% (P < 0.05), 36% (P < 0.05), 27%, and 73% of the untreated value, respectively, and 40 -ppm pitavastatin significantly reduced to 9% (P < 0.01), 22% (P < 0.01), 23% (P < 0.01), 15% (P < 0.05), and 18% (P < 0.05), respectively. Another adipocytokine, adiponectin, sustained basal mRNA level of wild-type in intestinal nonpolyp parts (data not shown). As shown in Figure 2B, mRNA expression levels of COX-2 were higher in polyp than in nonpolyp parts. Treatment with 20 and 40-ppm pitavastatin slightly suppressed mRNA levels of COX-2 in the polyps, but significantly suppressed its mRNA levels in nonpolyp parts.Meanwhile, treatment with 20 ppm of pitavastatin significantly suppressed iNOS mRNA levels in nonpolyp parts, and 40-ppm pitavastatin significantly suppressed both polyp and nonpolyp parts (Fig. 2C).

To evaluate the effects of iNOS overexpression as a nitrative stress in intestinal polyp in Min mice, localization of iNOS and the resultant nitration reaction were examined by immunohistochemistry using an anti-nitrotyrosin antibody and anti-8-nitroguanosine antibody. Nitrotyrosin was observed mainly in the stroma cells and 8-nitroguanosine was observed mainly in the cytoplasm of epithelial cells. Both nitrotyrosin and 8-nitroguanosine were weakly suppressed by 40-ppm pitavastatin treatment (Fig. 3A–F). In addition, localization and expression of COX-2 (Fig. 3G and H), IL-6, MCP-1, Pai-1, and PPARγ in the intestinal polyps were examined by immunohistochemistry. COX-2 was observed mainly in the stroma cells and IL-6, MCP-1, Pai-1, and PPARγ were observed mainly in the cytoplasm of epithelial cells without being affected by 40 ppm-pitavastatin treatment (Supplemental Fig. 1).

Statins are reported to suppress some inflammatory adipocytokines through the PPARγ activation (32). Thus, we further evaluated the effect of pitavastatin on PPARγ activation in nonpolyp parts of the small intestine and liver of Min mice. Treatment with pitavastatin increased PPARγ-DNA binding activity in the intestinal nonpolyp parts and the liver at the dose of 40 ppm (Fig. 4A and B).

In this study, it was showed that the treatment with pitavastatin suppressed intestinal polyp formation in Min mice with slight reduction of serum levels of total cholesterol and TG. The antiinflammatory effects were also observed in pitavastatin-treated Min mice, such as down regulation of COX-2, iNOS, and some adipocytokines including proinflammatory cytokines (IL-6, MCP-1, and Pai-1)mRNA levels. Moreover, guanosine nitration induced by reactive nitrogen oxides could be an important mediator of nitrative stress in the pathogenesis of intestinal polyp development in Min mice, and was reduced by pitavastatin treatment.

To date, lipid-lowering effects of statins have not been investigated in Apc-deficient mice model, which feature a hyperlipidemic state. Thus, we examined the effect of pitavastatin on serum lipid levels in Min mice and obtained a result of slight reduction. This result is similar to those shown in other rodent hyperlipidemic models. It has been shown that cholesterol synthesis enzymes were remarkably induced by feedback regulation in rodents (33), and a de novo cholesterol synthesis experiment by injection of ¹⁴C-acetic acid showed that pitavastatin potently inhibits de novo cholesterol synthesis, without affecting serum lipids levels (34, 35). Taking these into consideration, HMG-CoA reductase activity might be inhibited by pitavastatin treatment in this study.

It has been reported that certain statins are able to exert antiinflammatory activities. Simvastatin inhibits proinflammatory gene expression by blocking nuclear factor kappa B (NFκB) signaling in intestinal epithelial cells, and attenuates dextran sodium sulfate-induced acute murine colitis (36). It has also been reported that pitavastatin inhibits NFκB activation and decreases IL-6 in human mammary carcinoma cells (37). Moreover, pitavastatin suppressed colitis-related colon carcinogenesis through modulation of mucosal inflammation with reduced nitrotyrosine-positivity (22). In this study, we have shown that clear downregulation of mRNA expression levels of COX-2, iNOS, and some adipocytokines (IL-6, MCP-1, and Pai-1) in the nonpolyp parts of the intestine by pitavastatin treatment, and significant reduction of iNOS mRNA level was observed in the polyp parts. These expression level changes of COX-2, iNOS, and adipocytokines, especially iNOS, could be associated with intestinal polyp development in Min mice. Indeed, it has been reported that iNOS inhibition, Pai-1 inhibition, COX-2 inhibition, and IL-6 knock out suppressed intestinal polyp development in Min mice (31, 38, 39, 40). It has also been reported that 100-ppm atorvastatin treatment in Min mice slightly, but not significantly, reduced the activity and expression levels of COX-2 in the intestinal polyp (20). Expression of COX-2 was higher in polyp tissue than in nonpolyp parts, which may result in more resistance to pitavastatin's effects. INOS-dependent NO overproduction resulted in a nitration reaction, which takes place not only in tyrosine moieties of proteins but also in the nucleotide base guanosine, including RNA (41), and may account for the NO-induced cytotoxicity.

To further investigate the mechanisms of suppression of these proinflammatory genes by pitavastatin treatment, we focused on the levels of serum adipocytokines, including leptin, and activity of PPARγ, a member of the nuclear receptor superfamily. PPARγ, activated by statins (32), suppresses proinflammation gene expression (42). This study showed that pitavastatin treatment decreased serum leptin levels and increased PPARγ activity in the intestinal mucosa and the liver. It has been shown that simvastatin suppressed leptin expression in 3T3-L1 cells (43). Moreover, leptin induces iNOS and NO production (44), suggesting the interactions between leptin and NO. PPARγ activity induced by 40-ppm pitavastatin treatment might not be adequate to explain the reduction of adipocytokine levels by the same dose of pitavastatin treatment. As mentioned previously, NFκB signaling or other signaling may be additionally playing a role in the suppression of proinflammatory genes by pitavastatin treatment. In our previous study, a PPARγ ligand, pioglitazone, and an antiinflammatory drug, indomethacin, reduced intestinal polyps in Min mice (6, 45). Thus, it is assumed that PPAR activation and antiinflammatory activities of pitavastatin contribute, to some extent, to reduction of the development of intestinal polyps.

To explain the specific effect of pitavastatin on suppression of polyp development of the distal part in the small intestine, we investigated the expression levels of COX-2, IL-6, MCP-1, Pai-1, and PPARγ in the immunohistological study of distal and middle parts of the small intestine. However, the data did not show clear difference between the parts (data not shown). Further investigation is needed to clarify the differences between the distal and middle parts.

In conclusion, pitavastatin has potential benefit for suppression of intestinal polyp development. Thus, pitavastatin might be a candidate for chemopreventive agent for human colon cancer.

This work was supported by Grants-in-Aid for Cancer Research, for the Third-Term Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health, Labour, and Welfare of Japan, and also from the Yakult Bio-science Foundation. S.T. is presently the recipient of a Research Resident Fellowship from the Foundation for Promotion of Cancer Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.