Fluvastatin Inhibits HMG-CoA Reductase and Prevents Non–Small Cell Lung Carcinogenesis

Lung cancer is the leading cause of cancer-related death worldwide. Non–small cell lung cancer (NSCLC) is the major type of lung cancer and the overall 5-year survival rate in patients diagnosed from 2008 to 2014 was only 19% (1). Current strategies in the treatment of NSCLC include surgery, radiation therapy, chemotherapy, and immunotherapy and now multiple targeted therapies are approved for use against NSCLC. These treatments demonstrated effectiveness in first- and second-line therapies (2, 3). However, promising agents for NSCLC prevention were still limited. Therefore, identification of novel preventive targets and novel effective preventive agents is still urgently needed for clinical applications.

3-Hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase (HMGCR) is the rate-limiting enzyme for cholesterol synthesis in the conversion of HMG-CoA to mevalonate (4, 5). Recently, an increasing number of reports demonstrated the oncogenic roles of HMGCR in several cancer types, including breast (6–8), colorectal (9), gastric (10), and ovarian (11). However, the function of HMGCR in lung tumorigenesis is still not well addressed and thus, merits further study. Statins are HMGCR inhibitors used to decrease serum cholesterol levels aimed at reducing the incidence of cardiovascular and cerebrovascular disorders (4). Several bench study and clinical trial results suggested that statins might be potential agents for cancer prevention or treatment (6, 8, 12–14). Fluvastatin is the first entirely synthetic HMGCR inhibitor and has been reported to reduce cancer development and metastasis (15–17). A recent study revealed that fluvastatin effectively prevented lung adenocarcinoma bone metastasis in a nude mouse model (18). The Braf/MEK/ERK1/2 and phosphatidylinositol 3-kinase (PI3-K)/Akt signaling cascades are known to mediate cell proliferation and apoptosis, and have been implicated in the development of many types of cancer, including lung cancer (19–23). It is well reported that cholesterol activates Braf/MEK/ERK1/2 and AKT pathways (24–27). Inhibition of the activation of these signaling pathways holds promise for the management of lung cancer.

Tobacco smoking and second-hand smoke exposure are responsible for the majority of lung cancer cases (28). 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) has a significant association with lung cancer. Experimentally, lung tumors can be readily induced in A/J mice by NNK (29). Activation of the MAPK and PI3-K/Akt pathways is known to play a key role in malignant transformation in the NNK-induced lung carcinogenesis mouse model (30, 31). Patient-derived xenograft (PDX) models are based on the transfer of primary tumors directly from the human patient into an immunodeficient mouse to mimic the development of human tumors in mouse models (32). For preclinical studies, these mouse models offer tools for developing agents for cancer prevention or treatment.

In this study, we investigated the oncogenic function of HMGCR in vitro and in vivo. Then we examined the effect of fluvastatin, an HMGCR inhibitor, on lung tumorigenesis. In addition, we investigated the mechanism of action for HMGCR and its inhibitor, fluvastatin, in lung tumorigenesis. Subsequently, we examined the anticancer effects of fluvastatin by using NNK-induced lung tumorigenesis and lung PDX mouse models. Our findings suggested that fluvastatin might be a potential drug for lung cancer prevention.

Cell culture media, gentamicin, penicillin, and l-glutamine were all obtained from Invitrogen. FBS was from Gemini Bio-Products. Tris, NaCl, and SDS for molecular biology and buffer preparation were purchased from Sigma-Aldrich. The HMGCR plasmid (catalog no. 86085) was obtained from Addgene. The Mock plasmid (pCMV-SPORT6) was obtained from DF/HCC DNA Resource Core (Harvard Medical School, Boston, MA). Antibodies to detect HMGCR (sc-271595), β-actin (sc-47778), Braf (sc-166), GAPDH (sc-25778), caspase 3 (sc-7272), and Bcl-2 (sc-7382) were from Santa Cruz Biotechnology, Inc. p-Braf (catalog no. 2696), p-MEK (catalog no. 9121), MEK (catalog no. 9122), p-ERK1/2 (catalog no. 9101), ERK1/2 (catalog no. 9102), p-Akt (catalog no. 9271), Akt (catalog no. 9272), cleaved-caspase-3 (catalog no. 9661), PARP (catalog no. 9542), cleaved-PARP (catalog no. 9541), and Bax (catalog no. 2772) antibodies were purchased from Cell Signaling Technology. Fluvastatin sodium salt hydrate was purchased from TCI America, lovastatin, simvastatin, and atorvastatin were purchased from Cayman Chemical, and NNK (sc-209854) was obtained from Santa Cruz Biotechnology.

All cells were purchased from ATCC. The cells were routinely screened to confirm Mycoplasma-negative status and to verify the identity of the cells by short tandem repeat profiling before being frozen. Each vial was thawed and maintained for a maximum of 2 months. Enough frozen vials of each cell line were available to ensure that all cell-based experiments were conducted on cells that had been tested and were in culture for 8 weeks or less. Cells were cultured at 37°C in a 5% CO₂ humidified incubator following the ATCC protocols. MRC5 human normal lung fibroblasts were grown in Eagle minimum essential medium with 10% FBS and 1% antibiotics (Gen DEPOT). A549 human lung cancer cells were cultured with F-12K medium containing 10% FBS and 1% antibiotics. NL20 cells were cultured with F12K with 1.5 g/L sodium bicarbonate, 2.7 g/L glucose, 2.0 mmol/L l-glutamine, 0.1 mmol/L nonessential amino acids, 0.005 mg/mL insulin, 10 ng/mL EGF, 0.001 mg/mL transferrin, 500 ng/mL hydrocortisone, and 4% FBS. All other human lung cancer cells were grown in RPMI1640 medium supplemented with 10% FBS and 1% antibiotics. HEK293T cells (stably expressing the SV40 large T antigen in HER293 cells) were purchased from the ATCC and cultured in DMEM (Corning) supplemented with 10% FBS (Corning) and 1% penicillin–streptomycin.

To generate knockdown HMGCR cells, the lentiviral expression vector of HMGCR (shHMGCR) or pLKO.1-puro nontarget shRNA control plasmid DNA (shCon) and packaging vectors (pMD2.0G and psPAX) were transfected into HEK293T cells using the iMfectin Poly DNA Transfection Reagent (GenDEPOT) following the manufacturer's suggested protocols. The lentivirus plasmids for shHMGCR (#1, TRCN0000046448; CCGGGC AGTGATAAAGGAGGCATTTCTCGAGAAATGCCTCCTTT ATCACTGCTTTTTG; and #2, TRCN0000046450; CCG GGCTATGATTGAGGTCAACATT CTCGAGAATGTTGAC CTCAATCATAGCTTTTTG) were purchased from University of Minnesota Genomics Center (University of Minnesota, Minneapolis, MN). The transfection mix in 10% FBS/DMEM without antibiotics was incubated with cells for 12 hours, and then 10 mL of fresh medium with antibiotics (penicillin/streptomycin) were added. Viral supernatant fractions were collected at 48 hours and filtered through a 0.45-μm syringe filter followed by infection into the appropriate cells together with 8 μg/mL polybrene (Millipore). After overnight infection, the medium was replaced with fresh complete growth medium containing the appropriate concentration of 1.5 μg/mL puromycin and cells were incubated for an additional 24 hours. The selected cells were used for experiments.

Cells (8 × 10³/well) were seeded into 6-well plates with 0.3% Basal Medium Eagle agar containing 10% FBS and different concentrations of fluvastatin and then cultured for 1–2 weeks. Colonies were scored under a microscope using the Image-Pro PLUS (v6.) computer software program (Media Cybernetics).

MRC5 normal lung cells (1 × 10⁴ cells/well) were seeded into 96-well plates for determining cytotoxicity of fluvastatin. After an overnight incubation, cells were treated with different concentrations (5, 10, 20, or 40 μmol/L) of fluvastatin or DMSO vehicle control and incubated for 24 or 48 hours. Then, 20 μL of the CellTiter 96 Aqueous One Solution (Promega) was added to each well and cells were then incubated for an additional 1 hour at 37°C. Absorbance was measured at an optical density of 492 nm using the Thermo Multiskan Plate-Reader (Thermo Fisher Scientific).

Cell proliferation was determined by a crystal violet staining assay. Cells (3 × 10⁴/well) were seeded into 24-well plates. After an overnight incubation, cells were treated with different concentrations of fluvastatin and incubated for 3 days. Then, each well was washed three times with PBS and stained with 0.2% (w/v) crystal violet in 2% (v/v) ethanol. After 10 minutes, cells were washed three times with distilled water, and the remaining dye was dissolved in 0.5% (w/v) SDS in 50% (v/v) ethanol. Absorbance was measured at an optical density of 540 nm using the Thermo Multiskan plate-reader.

For analysis of apoptosis, H441 and A549 lung cancer cells (2.5 × 10⁵/well) expressing shCon or shHMGCR were seeded into 60-mm dishes overnight and then treated with fluvastatin for 48 hours. Cells were trypsinized and washed twice with cold PBS and then resuspended with PBS and incubated for 5 minutes at room temperature with annexin V-FITC plus propidium iodide. Cells were analyzed using a FACSCalibur Flow Cytometer (BD BioSciences).

Equal amounts of protein were determined using a Protein Assay Kit (Bio-Rad Laboratories). Lysates were resolved by SDS-PAGE and then transferred onto polyvinylidene difluoride membranes (EMD Millipore) and blocked with 5% nonfat milk for 1 hour at room temperature. Blots were probed with appropriate primary antibodies (1:1,000) overnight at 4°C and followed by incubation with a horseradish peroxidase–conjugated secondary antibody (1:5,000) for hybridization. Protein bands were visualized with a chemiluminescence reagent (GE Healthcare Biosciences).

Human lung tissue samples were obtained from the Affiliated Cancer Hospital of Zhengzhou University. The samples are archived pathology samples, and demographics and baseline characteristics are shown in Supplementary Table S1. HMGCR (sc-271595) antibody was diluted into 10% goat serum (1:50). A Vectastain Elite ABC Kit obtained from Vector Laboratories was used for IHC staining according to the protocol recommended by the manufacturer. Mouse lung tissues were embedded in paraffin for examination. Sections were stained with hematoxylin and eosin (H & E) and analyzed by IHC. Briefly, all specimens were deparaffinized and rehydrated. To expose antigens, samples were unmasked by submerging each into boiling sodium citrate buffer (10 mmol/L, pH 6.0) for 10 minutes, and then treated with 3% H₂O₂ for 10 minutes. Each slide was blocked with 10% goat serum albumin in 1 × PBS in a humidified chamber for 1 hour at room temperature. Then, slides were incubated with proliferating cell nuclear antigen (PCNA; 1:3,000) and other primary antibodies (1:50) at 4°C in a humidified chamber overnight. The slides were washed and hybridized with a secondary antibody from Vector Laboratories (anti-rabbit 1:150 or anti-mouse 1:150) for 1 hour at room temperature. Slides were stained using the Vectastain Elite ABC kit. After developing with 3,3′-diaminobenzidine, the sections were counterstained with hematoxylin and observed in the microscope, and then the integrated optical density (IOD) value was analyzed from three different field of tumor tissues using the Image-Pro PLUS (v.6) computer software program (Media Cybernetics, Inc.) following the manufacturer's protocol.

Athymic nude mice (6–7 weeks, female) were obtained from Charles River Laboratories and maintained under specific pathogen-free conditions. Mice were divided into three groups (n = 8 mice in each group) and shCon or shHMGCR H441 lung cancer cells (2 × 10⁶/0.1 mL) were injected subcutaneously into the right flank of each mouse. Body weights and tumor measurements were performed once a week and tumor volume was calculated on the basis of the formula: length × width × width × 0.52. At the end of the experiment, mice were euthanized, and tumors were harvested and fixed in formalin for further analysis. All animal studies were performed following the guidelines approved by the University of Minnesota Institutional Animal Care and Use Committee (protocol ID: 1803-35739A). The tumor tissues were fixed and embedded in paraffin for histologic analysis and IHC staining. The IOD value was analyzed from three different fields of each tumor tissue using the Image-Pro PLUS (v.6) computer software program following the manufacturer's protocol. Eight mice and 24 pictures were subjected to analysis per group.

A/J mice (6–8 weeks, male) were obtained from Jackson Laboratory. All animal procedures were performed following guidelines approved by the University of Minnesota Institutional Animal Care and Use Committee (protocol ID: 1709-35106A). Mice were housed in climate-controlled quarters with a 12-hour light/12-hour dark cycle and allowed full access to food and water. After being acclimated for 1 week, mice were randomized into four groups of 14 mice each. The body weights of the mice were measured weekly. For the tumorigenesis studies, mice in the negative control group were given PBS, all other mice received a single dose of NNK in PBS (100 μL) at 100 mg/kg of body weight by intraperitoneal injection once a week for 3 weeks. From the week following the last dose of NNK, the mice were administered vehicle only or 15 mg/kg or 75 mg/kg fluvastatin (dissolved in a 5% PGE400 + 5% Tween80 solution + 2.5% DMSO) by oral gavage every day for 27 weeks. At the end of treatment, mice were euthanized and the tissues were fixed and embedded in paraffin for histologic analysis and IHC staining.

Mass spectrometry analysis was performed using a SCIEX TripleTOF5600 coupled with a DuoSpray ion source. The fluvastatin and simvastatin (internal standard) in mouse plasma samples were directly infused into the ion source at a flow rate of 5 μL/mL and acquired 30 scan from m/z 100 to m/z 1,000 in positive product ion mode. The quantification was performed with manual transitions of m/z 412.2→224.1 for fluvastatin and m/z 436.3→285.2 for simvastatin. Compound-dependent parameters for manual transition were set as follow: DP, 130 and CE, 10→30 for fluvastatin; DP, 100 and CE, 5→20 for simvastatin. The main working parameters for mass spectrometry analysis were set as follows: gas1, 20 psi; gas2, 20 psi, curtain gas3, 30 psi, ion source temperature, 500; ionspray voltage, 5.5 kV.

The levels of fluvastatin and simvastatin in plasma were determined using peak intensity of transition ions in SCIEX AnalystTF software.

The lung tumor (adenocarcinoma, grade 2; stage I) was obtained from the patient of Henan Cancer Hospital. The lung tumor tissue fragments (2–3 mm) were implanted into SCID mice. This study followed a protocol that was approved by the Zhengzhou University Institutional Animal Care and Use Committee. After tumor implantation, when the tumors reached around 100 mm³, mice were randomly divided into four groups (n = 8 mice per group). The groups were: (i) vehicle (5% PGE400 + 5% Tween80 solution + 2.5% DMSO) control; (ii) 3 mg/kg fluvastatin; (iii) 15 mg/kg fluvastatin; and (iv) 75 mg/kg fluvastatin. Mice were administered drug or vehicle by oral gavage daily. Body weight and tumor volume were measured once a week and tumor volume was calculated on the basis of the formula: length × width × width × 0.52. At the end of the experiment, mice were euthanized prior to removal of tumors for further analysis.

All quantitative data are expressed as mean values ± SD or SE of at least three independent experiments or samples. Significant differences were determined by one-way ANOVA (Dunnett test). The data fits normal distribution and was determined by using Kolmogorov–Smirnov test. A probability value of P < 0.05 was used as the criterion for statistical significance.

NSCLC is the most common type of all lung cancers and numerous oncogenes are associated with this disease. Initially, we determined the protein expression level of HMGCR in human lung cancer tissues and lung cancer cell lines. Results indicated that increased expression of HMGCR occurred both in NSCLC tissues and several human NSCLC cell lines compared with normal tissues or normal NL20 and MRC5 lung cells (Fig. 1A and B).

To investigate the function of HMGCR in lung cancer, we generated stable knockdown of HMGCR in H441 and A549 lung cancer cells and measured anchorage-independent growth. Results showed that knocking down HMGCR expression suppressed anchorage-independent growth of H441 and A549 lung cancer cells (Fig. 1C). The MAPK and Akt signaling cascades are well-known survival pathways involved in the regulation of cell growth, tumorigenesis, and apoptosis. Our results showed that knocking down HMGCR expression inhibited phosphorylation of Braf/MEK/ERK1/2 and Akt in both H441 and A549 lung cancer cells (Fig. 1D).

Annexin-V FITC staining was used to determine whether HMGCR functions in the induction of apoptosis in lung cancer cells. The data showed that knocking down HMGCR induced apoptosis in H441 and A549 lung cancer cells (Supplementary Fig. S1A and S1B). Western blotting was used to examine changes in apoptosis-related protein expression. Results showed a substantial reduction in the antiapoptotic protein, Bcl-2, and marked increases in the proapoptotic proteins BAX, cleaved caspase 3, and cleaved PARP (Supplementary Fig. S1C).

To further study the function of HMGCR, we performed an in vivo xenograft mouse model experiment. Athymic nude mice were injected with H441 cells expressing control (shCon) or knockdown of HMGCR. Results showed that knockdown of HMGCR significantly suppressed tumor size and weight in the H441 cell xenograft mouse model (Fig. 2A–C). The tumor volume in control group was from 82.1 ± 1.6 mm³ at day 7 to 673.3 ± 138.6 mm³ at day 42, while the tumor volume in HMGCR-knockdown group was from 78.7 ± 1.3 mm³ and 84.7 ± 2.5 mm³ at day 7 to 100.5 ± 12.0 mm³ and 129.5 ± 22.7 mm³ at day 42, respectively. IHC data showed that the proliferation-associated protein, PCNA, and the apoptosis-associated protein Bcl-2 were substantially inhibited in cells expressing shHMGCR compared with shCon. In addition, the expression level of p-ERK1/2 and p-Akt was also decreased in the shHMGCR groups compared with the control (shCon) group (Fig. 2D). These results suggest that attenuated expression of HMGCR significantly reduces the tumorigenic properties of lung cancer and that targeting HMGCR might hold promise for lung cancer treatment.

On the basis of the previous results, we determined whether the drug fluvastatin, which is known to inhibit HMGCR, has any effect on human lung cancer cell growth. To determine whether fluvastatin exerted any cytotoxic effects against normal lung cells, normal MRC5 cells initially were treated with different concentrations of fluvastatin for 24, 48 or 72 hours. The results showed that fluvastatin had no cytotoxicity at concentrations less than 40 μmol/L (Supplementary Fig. S2). Then, we examined the effects of fluvastatin on H441 and A549 lung cancer cell growth and the results showed that fluvastatin effectively inhibited H441 and A549 lung cancer cell growth in a dose-dependent manner (Supplementary Fig. S2B and S2C). Fluvastatin also significantly enhanced apoptosis in H441 lung cancer cells and increased the level of cleaved-PARP, cleaved caspase 3, and Bax, and decreased the expression of Bcl-2 (Supplementary Fig. S2D and S2E). Furthermore, the level of phosphorylated Braf, MEK, ERK1/2, and Akt was markedly suppressed in a dose-dependent manner with fluvastatin treatment (Supplementary Fig. S2F). Then we used lovastatin, simvastatin, and atorvastatin to make sure that the effect was more generalizable. The results showed that lovastatin, simvastatin, and atorvastatin inhibited H441 and A549 lung cancer cells growth. Meanwhile, they also suppressed the activation of ERK1/2 and Akt (Supplementary Fig. S3). On the basis of these results and compared with the results from Supplementary Fig. S2, fluvastatin is the most efficient statin inhibiting lung cancer cells' growth without toxicity. In addition, we overexpressed HMGCR in normal lung cells NL20. The results showed that HMGCR overexpression enhanced NL20 cells growth. Importantly, fluvastatin suppressed the growth of HMGCR-overexpressed NL20 cells in a dose-dependent manner (Supplementary Fig. S4). Then, we evaluated the effects of fluvastatin on lung tumorigenesis in NNK-induced lung cancer and PDX mouse models.

To further investigate the chemopreventive effect of fluvastatin on lung cancer development, we conducted an in vivo experiment using an NNK-induced mouse lung tumorigenesis model. Groups included a control vehicle group (no NNK treatment) and three groups in which NNK was used to induce lung cancer. Two groups were treated with fluvastatin (15 or 75 mg/kg body weight) and one group was untreated. Our results clearly showed that administration of fluvastatin at either 15 or 75 mg/kg of body weight dose dependently decreased NNK-induced tumor number in lungs compared with the untreated group (Fig. 3A and B). The fluvastatin decreased the tumor number by 31.9% and 53.5%, respectively, in a dose-dependent manner. In addition, no significant changes were observed in the weight of mouse liver or spleen between the NNK groups treated with fluvastatin (Fig. 3C and D). However, we found that NNK treatment decreased liver weight compared with vehicle-treated group (Fig. 3D) and high dose fluvastatin treatment decreased the mouse body weight (Supplementary Fig. S5). Then, mass spectrometry analysis was conducted to detect the fluvastatin in mouse plasma. We found 8.13 ± 2.40 and 13.22 ± 2.10 μmol/L fluvastatin in NNK + low fluvastatin treatment group and NNK + high fluvastatin treatment group, respectively (Supplementary Figs. S6 and S7). Importantly, IHC analysis showed that the expression levels of PCNA, Bcl-2, p-ERK1/2, and p-Akt were substantially reduced in both fluvastatin-treated groups compared with the vehicle group with NNK treatment (Fig. 3E). These data provided evidence showing that fluvastatin exerts a preventive effect against NNK-induced mouse lung carcinogenesis by targeting HMGCR.

In preclinical studies, PDX mouse models offer a tool to examine the function of anticancer agents for patients with cancer. We conducted PDX experiments with lung tumor tissues collected from a patient with lung cancer to investigate the effectiveness of fluvastatin in preventing tumor growth. The results showed that fluvastatin at 75 mg/kg, but not at 3 or 15 mg/kg of body weight, significantly inhibited PDX tumor growth compared with the vehicle-treated group (Fig. 4A–C). In addition, fluvastatin did not significantly change the body weight under the experimental conditions. (Fig. 4D). Importantly, treatment with fluvastatin at 75 mg/kg of body weight substantially suppressed PCNA, HMGCR, p-ERK1/2, and p-Akt expression (Fig. 4E). Overall, these results illustrated that fluvastatin is a promising potential anticancer agent against lung tumorigenesis.

Lung cancer is the leading cause of cancer-related death worldwide. In 2019, an estimated 228,150 new cases of lung and bronchial cancer will be diagnosed and 142,670 deaths will occur in the United State (1). The promising agents for preventing lung cancer are needed for clinical applications. In this study, we first demonstrated the oncogenic function of HMGCR in NSCLC. We then conducted experiments to examine fluvastatin, the known HMGCR inhibitor, could be a potential preventive drug which affects NSCLC development.

A number of reports have supported an oncogenic role of HMGCR in several cancer types. HMGCR enhanced the transformation of normal breast cells and contributed to MCF-7 cell growth, which was associated with the short survival of some patients with breast cancer (33). In addition, targeting HMGCR in colorectal and ovarian cancers reduced tumorigenesis and metastasis in cell- and animal-based studies (11, 34). Recently, targeting HMGCR was reported to effectively prevent lung adenocarcinoma bone metastasis in a nude mouse model (18). Our study clearly demonstrated that HMGCR is not only highly expressed in lung adenocarcinoma but also plays an important role in lung NSCLC cell growth and apoptosis (Figs. 1 and 2; Supplementary Fig. S1), which further highlighted the functions of HMGCR in the progression of malignancies. Intriguingly, our results showed that HMGCR mediates lung adenocarcinoma tumorigenesis through the activation of Braf/MEK/ERK1/2 and Akt (Fig. 1). HMGCR might perform its carcinogenic function by promoting the synthesis of lipid isoprene intermediates, including farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP; ref. 35). Typically, FPP drives activation of the Ras GTPase family, whereas GGPP activates the Rho/Rac family by prenylation and anchors them to the cell membrane (36). The Ras GTPase family and Rho/Rac family are known to be responsible for many signaling processes. Activated Ras recruits serine/threonine kinases of the RAF family to the plasma membrane and constitutively triggers the Braf/MEK/ERK1/2 (37) and PI3-K pathways (38). The Rho/Rac family also interacts with the ERK1/2 and Akt signaling pathways to promote cancer cell growth (39, 40). Overall, these findings indicate that HMGCR is a candidate target for lung cancer treatment and prevention.

Fluvastatin, a member of the group of drugs known as HMGCR inhibitors, is generally used in the treatment of patients with hypercholesterolemia (41). Notably, fluvastatin reduced development and metastasis of several cancers, including breast (15), renal (16), and ovarian (17). The epidemiologic study demonstrated the beneficial effects of long-standing statin use on lowering risk for lung cancer (42). Our results clearly showed that fluvastatin inhibited lung cancer cell growth and induced apoptosis of lung cancer cells. In addition, lovastatin, simvastatin, and atorvastatin also inhibited lung cancer cells growth, but the inhibitory efficiency was less than fluvastatin (Supplementary Figs. S2 and S3). The NNK-induced lung cancer mouse model and lung cancer PDX mouse model offer opportunities for testing the anticancer effects of fluvastatin. Importantly, fluvastatin prevented NNK-induced lung adenocarcinoma development; and a significant inhibitory effect was also observed in the lung cancer PDX mouse model (Figs. 3 and 4). On the basis of our results, we believe that fluvastatin inhibition of HMGCR is a potential target for NSCLC therapy and prevention. However, the side effects of fluvastatin need to be considered for its widespread use. Our animal study also showed fluvastatin reduced the mice body weight (Supplementary Fig. S5). It is known that fluvastatin might bring muscular side effects (43). Thus, we recommend that people with unexplained muscle pain or weakness who are taking statins should be referred to the appropriate physician and that intense exercise should be avoided until the cause of the muscle symptoms is determined. Although fluvastatin has these side effects, it is still one of the efficient drugs used to treat hypercholesterolemia and to prevent cardiovascular disease. Our findings suggested that fluvastatin might be a potential drug for lung cancer prevention, providing hope for clinical translation. In conclusion, we suggest that HMGCR is a potential target for prevention of NSCLC, acting by inhibiting cell growth and inducing apoptosis by reducing the activation of the Braf/MEK/ERK1/2 and Akt pathways. Furthermore, we demonstrated that fluvastatin inhibits NSCLC development in vitro and in vivo. These findings provide hope for rapid clinical translation.

No potential conflicts of interest were disclosed.

Conception and design: T. Zhang, Q. Wang, Z. Dong

Development of methodology: T. Zhang

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): T. Zhang, Q. Wang, K. Wang, X. Li, K. Liu, X. Chang

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): T. Zhang, R. Bai, Q. Wang, K. Wang, J. Ryu, X. Chang, A.M. Bode, Q. Xia, Y. Song

Writing, review, and/or revision of the manuscript: T. Zhang, R. Bai, Q. Wang, J. Ryu, A.M. Bode, Z. Dong

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): T. Zhang, R. Bai, K. Wang, T. Wang, W. Ma, Q. Xia, Z. Dong

Study supervision: Q. Xia, Y. Song, Z. Dong

The authors thank Todd Schuster for supporting the experiments, Tara Adams for supporting animal experiments, and Becky Earl for assistance in submitting our article (The Hormel Institute, University of Minnesota, Minneapolis, MN). This work was supported by the Hormel Foundation (to Z. Dong).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.