Despite the great success of chimeric antigen receptor T (CAR-T)–cell therapy in the treatment of hematologic malignancies, CAR-T–cell therapy is limited in solid tumors, including hepatocellular carcinoma (HCC). NK group 2 member D (NKG2D) ligands (NKG2DL) are generally absent on the surface of normal cells but are overexpressed on malignant cells, offering good targets for CAR-T therapy. Indeed, analysis of The Cancer Genome Atlas and HCC tumor samples showed that the expression of most NKG2DLs was elevated in tumors compared with normal tissues. Thus, we designed a novel NKG2D-based CAR comprising the extracellular domain of human NKG2D, 4-1BB, and CD3ζ signaling domains (BBz). NKG2D-BBz CAR-T cells efficiently killed the HCC cell lines SMMC-7721 and MHCC97H in vitro, which express high levels of NKG2DLs, whereas they less efficiently killed NKG2DL-silenced SMMC-7721 cells or NKG2DL-negative Hep3B cells. Overexpression of MICA or ULBP2 in Hep3B improved the killing capacity of NKG2D-BBz CAR-T cells. T cells expressing the NKG2D-BBz CAR effectively eradicated SMMC-7721 HCC xenografts. Collectively, these results suggested that NKG2D-BBz CAR-T cells could potently eliminate NKG2DL-high HCC cells both in vitro and in vivo, thereby providing a promising therapeutic intervention for patients with NKG2DL-positive HCC.

Liver cancer is the sixth most common cancer type and the fourth most common cause of cancer-related deaths worldwide (1) Hepatocellular carcinoma (HCC) accounts for more than 75% to 85% of all liver cancer cases (1). In developed countries, approximately 40% of patients with HCC are diagnosed at an early stage due to health surveillance programs (2, 3). According to the Barcelona Clinic Liver Cancer staging system, many therapies, such as partial liver resection, transplantation, and local ablation, have excellent effects on patients with early-stage HCC (stages 0 and A), providing median survival rates of 60 months and beyond (2, 4). Unfortunately, most patients with HCC, especially in developing countries, are diagnosed at a later disease stage because the symptoms of liver cancer are not obvious until it is in its later stages (3, 5). For more developed stages of HCC, only a few treatments have shown survival benefits. Patients at intermediate stages (stage B) benefit from chemoembolization and have an estimated median survival of 26 months (2, 6). For patients at advanced stages (stage C), only two therapies have been approved for clinical use by the FDA, sorafenib as a first-line treatment and regorafenib as a second-line treatment (7, 8); these drugs extend the overall survival of patients by 2–3 months but are often accompanied by treatment-induced adverse events, such as hypophosphatemia, weight loss, hand–foot skin reaction, hypertension, etc. (7, 8). Therefore, novel strategies for the treatment of advanced HCC, such as immunotherapy with PD-1 antibodies or chimeric antigen receptor T (CAR-T) cells, are currently being tested in clinical trials (2, 3, 9).

Immunotherapy is an effective treatment strategy for several cancers, including HCC. For example, administration of a cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitor enhances antitumor immunity in a murine HCC model, with a tumor rechallenge rejection rate of 90% and an elimination rate of 50% for metastatic tumor (10). In addition, nivolumab (a fully human programmed death-1 inhibitor) shows potential as a treatment for HCC with a manageable safety profile (11). CAR-T-cell therapy is another emerging immunotherapeutic option for cancer treatment (2, 3). CAR-T cells are engineered to express a specific CAR, which recognizes tumor-associated antigens (TAA) on the surface of tumor cells and then kills these cells in a targeted manner (12). However, clinical application of this approach requires the identification of the TAAs and the design of highly specific CARs.

CAR-T immunotherapy has shown promise in the fight against cancer, especially for hematologic malignancies (12, 13). Currently, the FDA has approved two CAR-T therapies for blood cancer: Yescarta (axicabtagene cioleucel), developed by Kite Pharma Inc., and Kymriah (tisangenlecleucel), developed by Novartis International AG (14). However, insufficient persistence of tumor-specific antigens (15), heterogeneity among tumor cells (16, 17), presence of an immunosuppressive microenvironment (16), and toxicity due to off-target effects currently (17) compromise the therapeutic efficiency of CAR-T immunotherapy in solid cancers. There are a few of ongoing preclinical studies of CAR-T therapies for HCC, which target the HCC-associated antigens GPC-3, MUC-1, and CEA. However, the clinical results of CAR-T cells in HCC have been disappointing and associate with severe side effects (18). Therefore, there is a need to further develop CAR-T therapies for the treatment of HCC.

NK group 2 member D (NKG2D) is a type II transmembrane-anchored C-type lectin-like protein receptor expressed on natural killer (NK) cells, CD8+ T cells, subsets of γδ T cells, and some autoreactive CD4+ T cells (19, 20). NKG2D recognizes its ligands (NKG2DL), such as MHC I chain-related molecules A and B (MICA and MICB; ref. 21) and six cytomegalovirus UL16-binding proteins (ULBP1–6; ref. 22). NKG2DLs are generally absent on the surface of normal cells but are overexpressed on tumor cells, and their expression can be further increased by chemotherapy or radiation (23). Accordingly, NKG2DL is a potential target for CAR-T therapy. Previous studies have indicated that ligation of NKG2D with its ligands can activate NK cells and stimulate T cells in vitro (24), and ectopic expression of NKG2DLs on tumor cells was sufficient to cause tumor rejection mediated by NK cells (25). NKG2D-expressing CARs exhibited robust antitumor efficacy in several different xenograft models, including models of multiple myeloma (26), ovarian carcinoma (27), osteosarcoma (28), glioblastoma (29), pancreatic cancer (30), and relapsed/refractory acute myeloid leukemia (31). NKG2DLs are also overexpressed in human HCC, and the expression is significantly and negatively associated with poor prognosis or early recurrence (32, 33). However, no NKG2D-based CAR has been reported for HCC treatment. Therefore, we designed a NKG2D-BBz CAR with high specificity and selectivity for HCC, and evaluated its antitumor activities using HCC cell lines in vitro and in a xenograft mouse model in vivo.

Plasmid construction and lentiviral package

The lentiviral vectors pTomo-pCMV-MICA-IRES-EGFP and pTomo-pCMV-ULBP2-IRES-puro, which were used for overexpression of MICA and ULBP2 in Hep3B cells as described below, were constructed in a pTomo vector backbone (Addgene). The full-length human MICA (accession_NM_000247, primer: Forward, ATGGGGCTGGGCCCGGTCTT; Reverse, CTAGGCGCCCTCAGTGGAGCCAG) and ULBP2 (accession_NM_025217, primer: Forward, ATGGCAGCAGCCGCCGCTACCAAG; Reverse, TCAGATGCCAGGGAGGATGAAG) sequences were PCR amplified using PrimeSTAR HS DNA Polymerase (Takara) and inserted into the plasmids between the XbaI and BamHI restriction sites. For the MICA andULBP2 shRNA plasmids, the target sequences were cloned into a plko.1 puro vector obtained from Addgene according to the manufacturer's protocol (http://www.addgene.org/8453/). The target sequences were as follow: shMICA-1, GCAGAAGATGTCCTGGGAAAT; shMICA-2, ATTCAATTCCCTGCCTGGAT; shULBP2-1, CCTCCTCTTTGACTCAGAGAA; and shULBP2-2, TGAGCACGGTCTTGATCAAAC. A codon-optimized targeting domain comprising the extracellular domain of human NKG2D or CD19 scFv (as shown in Supplementary Table S1) was synthesized (Idobio) and fused to a CAR backbone comprising a human CD8 hinge spacer and transmembrane domain, 4-1BB costimulatory domain, and CD3ζ (BBz; as shown in the Supplementary Table S1). The entire encoding sequence of the CAR expression molecule (as shown in Supplementary Table S1) was cloned into the lentiviral vector LentiGuide-Puro (Addgene) between the SmaI and MluI restriction sites to replace PuroR and an EF1a promoter was inserted in front of the CAR sequences by SmaI single digestion. For lentiviral package, the lentiviral plasmids were cotransfected into HEK293T cells with the packaging plasmids psPAX2 and pCMV-VSVG (Addgene) at a ratio of 10:8:5. Lentivirus was harvested as described previously (34).

Cell lines and culture

The human liver cancer cell lines SMMC-7721, Hep3B, and MHCC97H were purchased from Guangzhou Jennio Biotech Co., Ltd. in March 2018 and validated using short tandem repeat profiling in October 2018.Hep3B cells were infected with pTomo-CMV-ULBP2-IRES-puro and pTomo-CMV-MICA-IRES-EGFP lentivirus [multiplicity of infection (MOI) = 10] to generate Hep3B-ULBP2 and Hep3B-MICA cell lines, respectively. SMMC-7721 cells were infected with pTomo-CMV-luciferase-IRES-puro, plko-shMICA, and plko-shULBP2 lentivirus (MOI = 10) and subsequently selected by puromycin (1 μg/mL) for 2 weeks to generate SMMC-7721-luciferase, SMMC7721-shMICA, SMMC7721-shULPB2, and SMMC7721-shMICA-shULBP2 cell lines, respectively. Hep3B, Hep3B-MICA, and Hep3B-ULBP2 cells were cultured in DMEM (Life Technologies) supplemented with 10% FBS (Life Technologies), 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate (Life Technologies). SMMC-7721 and MHCC97H cells were cultured in RPMI1640 (Life Technologies) supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate. HEK293T cells used for lentiviral package were obtained from A. Lasorella (The Institute for Cancer Genetics, Columbia University Medical Center, New York, NY) in December 2011 and cultured in DMEM (Life Technologies) supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate. HEK293T cells were not validated within the past year. All the cells were cultured at 37°C in a humidified incubator with 5% CO2 and routinely confirmed to be Mycoplasma free by PCR.

Generation of CAR-T cells

Primary T cells were isolated from peripheral blood of three healthy donors and 2 patients with HCC using the RosetteSep Human T Cell Enrichment Cocktail (Stemcell technologies) according to the manufacturer's protocol. The purity of the isolated cells was detected by flow cytometry using phycoerythrin-conjugated anti-human CD3 (BioLegend, 300408). T cells were cultured in RPMI1640 (Gibco) supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin sulfate, and 200 U/mL IL2 (PeproTech). To generate CAR-T cells, T cells were stimulated with CD3/CD28 beads (Life Technologies) at a ratio of 1:1 for 48 hours and then infected with lentiviral particles at a MOI of 10. All the patient studies were approved by the Institutional Review Board at Kunming Institute of Zoology, Chinese Academy of Sciences (approved ID: SMKX-2019022) with written informed consent obtained from participants and conducted in accordance with the international ethical guidelines for biomedical research involving human subjects.

In vitro cytotoxicity assays

The specific cytotoxicity of the CAR-modified T cells was tested against the various HCC cell lines at variable effector-to-target (E/T) ratios of 0.5:1, 1:1, 2:1, 4:1, and 8:1. After 16 hours of culture in RPMI1640 (Gibco) supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin sulfate, cytotoxicity was measured using Cell-Mediated Cytotoxicity Fluorometric Assay Kit (BioVison, K315-100) according to the manufacturer's protocol.

Flow cytometry

Cells were harvested, washed twice with 1 × PBS, and resuspended in cold PBS containing 2% FCS, 1% sodium azide (at a density of 1 × 106 cells/mL). Subsequently, labeled primary antibodies were added into the cell suspension according to the manufacturer's instructions and incubated for 1 hour at 4°C in the dark. To evaluate CAR expression, CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells were incubated with Alexa Fluor 647–conjugated goat anti-mouse F(ab)2 (Jackson ImmunoResearch, 115-606-006) and allophycocyanin (APC)-conjugated anti-NKG2D (BioLegend, 320808), respectively. APC-conjugated MICA (R&D Systems, FAB1300A), MICB (R&D Systems, FAB1599A), ULBP1 (R&D Systems, FAB1380A), ULBP2/5/6 (R&D Systems, FAB1298A), and ULBP3 (R&D Systems, FAB1517A) were used to determine the expression of NKG2DLs on different HCC cells. APC-anti-CD4 (BioLegend, 357408) and FITC-anti-CD8 (BioLegend, 344704) were used to detect the ratio of CD4+ to CD8+ T cells. All flow cytometry readings were performed on the BD LSR Fortessa system and analyzed using FlowJo software.

Cell growth analysis

To detect the proliferation capacity, a 5-ethynyl-uridine (EdU)-labeling assay was performed using Click-iT EdU Imaging Kits (Invitrogen, C10337). Briefly, EdU was added to the cell culture medium at a final concentration 10 μmol/L and incubated for 1 hour at 37°C in a humidified incubator with 5% CO2. Then the cells were harvested and fixed with 4% paraformaldehyde. Permeabilization was performed with 0.3% Triton X-100 followed by incubation with Click-iT reaction cocktail containing Alexa Fluor azide for 30 minutes at room temperature. The EdU incorporation rate was analyzed by flow cytometry. To measure the proportion of apoptotic cells, cells were harvested, washed with 1 × PBS, and resuspended at a density of 1 × 106 cells/mL. Thereafter, 7-aminoactinomycin D (Sangon Biotech, E607304-0200) was added according to the manufacturer's protocol and the ratio of stained cell was analyzed by flow cytometry.

Cytokine release assay

CD19-BBz CAR-T and NKG2D-BBz CAR-T cells were cocultured with SMMC-7721 cells in RPMI1640 (Gibco) supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin sulfate at an E/T ratio of 0:1 and 5:1, respectively, for 16 hours. A total of 10 μL of the supernatant was collected and the concentrations of IFNγ (BD Biosciences, 550612), IL10 (BD Biosciences, 550613), TNFα (BD Biosciences, 550610), and IL2 (BD Biosciences, 550611) were determined using respective ELISA kits as described above according to the manufacturer's instructions. The quantification was performed on the Synergy H1 (BioTek) by measuring absorbance at 450 nm.

In vivo HCC xenograft model

All protocols were approved by the animal ethics committee of the Kunming Institute of Zoology, Chinese Academy of Sciences. Five- to 6-week-old NOD-PrkdcscidIl2rgtm1/Bcgen mice (B-NDG) were purchased from Jiangsu Biocytogen Co., Ltd. A total of 1 × 106 SMMC-7721-luciferase cells were suspended in PBS containing 30% Matrigel (BD Bioscience) and subcutaneously injected into the B-NDG mice. When the mean tumor bioluminescence reached approximately 5 × 106 photons/second at 1-week after tumor cell injection, the mice were anesthetized with 2.5% avertin by intraperitoneal injection (15 mL/kg) followed by the intraperitoneal injection of 150 mg/kg D-luciferin (BioVison). Ten minutes later, bioluminescent signals were recorded using an in vivo imaging software (IVIS) system (Lumina Xr), and the mice were randomly divided into the following four groups: (i) tail intravenous injection of 100 μL of sterile saline only without T cells; (ii) 1 × 107 nontransduced T cells (NTD) in sterile saline; (iii) 1 × 107 genetically modified CD19-BBz CAR-T cells in sterile saline (CD19-BBz CAR); and (iv) 1 × 107 genetically modified NKG2D-BBz CAR-T cells in sterile saline (NKG2D-BBz CAR). After that, the bioluminescent signals were measured approximately every 10 days. The data were quantified using Living Image Software (Caliper Life Science). The mice were sacrificed when the tumor volume reached approximately 2,000 mm3.

Tissue microarray and IHC analysis

IHC analysis was performed as described previously (34). Briefly, sections cut from paraffin-embedded samples were deparaffinized, rehydrated, and processed for antigen retrieval with sodium citrate buffer (Beyotime). The sections were blocked with 10% serum from the same species as the source of the secondary antibody for 1 hour at room temperature and incubated with primary antibodies at 4°C overnight. Then, the sections were washed thrice in TBS 0.025% Triton with gentle agitation and incubated with secondary antibodies for 1 hour at room temperature. Chromogenic staining was performed on the sections using 3,3′-Diaminobenzidine (Beyotime, P0203) according to the manufacturer's protocol. The OD-CT-DgLive02-002 Microarray (Outdo Biotech) containing 32 human liver cancer samples, HOrgN090PT02 Microarray (Outdo Biotech) containing 90 normal tissues from major human organs (including the thyroid, tongue, esophagus, stomach, duodenum, colon, liver, pancreas, trachea, lung, heart, artery, skeletal muscle, skin, seminal vesicle, prostate, testis, bladder, brain, and spleen), and HLivH060CD03 Microarray (Outdo Biotech) containing 7 nontumor cirrhotic liver tissues were immunostained using anti-MICA (Abcam, ab93170) at a dilution ratio of 1:200 or anti-ULBP2 (Thermo Fisher Scientific, PA5-47118) at a dilution ratio of 1:50. To investigate the persistence of the administrated human T cells in the mice, the sections of formalin-fixed, paraffin-embedded lung, liver, bone marrow, hippocampus, spleen, kidney, pancreas, and tumor tissues from the CD19-BBz CAR-T group and NKG2D-BBz CAR-T groups were immuno-stained using an CD3-ξ antibody (Santa Cruz Biotechnology, sc-1239) at a dilution ratio of 1:100.

Karyotype assays

NKG2D-BBz CAR-T cells were collected 10 days after infection with NKG2D-BBz CAR and normal T cells were used as controls. Karyotype assays were conducted as described previously (35). Briefly, cells were treated with colcemid (Sangon Biotech, A600322) at 37°C for 2 hours, then harvested, washed in 0.075 mol/L KCl at 37°C for 10 minutes. Then the cells were fixed in freshly prepared fixative (methanol/glacial acetic acid = 3/1), dropped onto slides, and dried at room temperature. The chromosome images were captured on the Olympus DP71 microscope.

Statistical analysis

All statistical analyses were performed using GraphPad Prism 7.0 statistical software. The data are all presented as mean ± SD. Statistical differences between two groups were analyzed using Student t tests with Welch correction. Statistical differences among three or more groups were analyzed by one-way ANOVA with Sidak correction. Statistical significance was defined as *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.

NKG2DLs were overexpressed in human liver cancer

To clarify the expression of NKG2DLs in clinical samples, we analyzed the RNA sequencing data of paired liver cancer and normal tissues from The Cancer Genome Atlas (N = 50). The results showed that MICA, MICB, ULBP1, ULBP2, ULBP4, and ULBP5 were upregulated compared with those in paired normal tissues (Supplementary Fig. S1). Similarly, IHC in human liver cancer specimens on the OD-CT-DgLive02-002 microarray chip showed that expression levels of MICA and ULBP2 were elevated in 72% (23/32) and 97% (31/32) of the liver cancer tissues, respectively (Fig. 1A and B). Although the leading cause of HCC is cirrhosis and most patients with HCC have liver cirrhosis, the expression of MICA and ULBP2 was absent in nontumor cirrhotic liver tissue (Supplementary Fig. S2). In addition, flow cytometry showed that the expression levels of all NKG2DLs were low in the Hep3B cell line, while MICA and ULBP2 were highly expressed in the SMMC-7721 and MHCC97H cell lines (Fig. 1C). These results clearly supported the possibility of using NKG2DL as a target in HCC therapy.

Figure 1.

NKG2D ligands were overexpressed in liver cancer. The 32 liver cancer specimens in the OD-CT-DgLive02-002 microarray were stained with MICA antibody (A) and ULBP2 antibody (B), respectively. The samples with overexpression of MICA or ULBP2 are marked with a triangle. Scale bar, 500 μm. C, NKG2D ligand expression in Hep3B, SMMC-7721, and MHCC97H cell lines was detected by flow cytometry. Data are representative or two independent experiments. Percentage of positive cells is detailed in the histograms.

Figure 1.

NKG2D ligands were overexpressed in liver cancer. The 32 liver cancer specimens in the OD-CT-DgLive02-002 microarray were stained with MICA antibody (A) and ULBP2 antibody (B), respectively. The samples with overexpression of MICA or ULBP2 are marked with a triangle. Scale bar, 500 μm. C, NKG2D ligand expression in Hep3B, SMMC-7721, and MHCC97H cell lines was detected by flow cytometry. Data are representative or two independent experiments. Percentage of positive cells is detailed in the histograms.

Close modal

NKG2D-BBz CAR-T cells lysed HCC cells in an NKG2DL-dependent manner

We designed the lentiviral expression vectors encoding CD19-BBz and NKG2D-BBz as shown in Fig. 2A. T cells were isolated from peripheral blood mononuclear cells of healthy donors, and 99.2% of the cells were confirmed to be CD3+ by flow cytometry (Supplementary Fig. S3). After activation with CD3/28 beads for 48 hours, T cells were infected with CD19-BBz and NKG2D-BBz lentivirus. After 72 hours, CD19 and NKG2D-BBz CAR were detected in 42.3% and 46.1% of the T cells, respectively (Fig. 2B). The results of the cytotoxicity assay showed that at the E:T ratio of 8:1, NKG2D-BBz CAR-T cells could efficiently lyse SMMC-7721 and MHCC97H cells (∼100%), but not the NKG2DLs-negative Hep3B cell line (less than 30%). In contrast, CD19-BBz CAR-T cells failed to initiate the specific lysis of these HCC cell lines (Fig. 2C). Cytotoxic T cells secrete several cytokines upon killing target cells. To confirm the specific cytotoxicity of NKG2D-BBz CAR-T cells, cytokine were assessed in the cell culture medium, demonstrating that TNFα, IFNγ, IL10, and IL2 were significantly increased in SMMC-7721 cells cultured with NKG2D-BBz CAR-T cells, but not in the culture medium of CD19-BBz CAR-T or NTD T cells (Fig. 2D).

Figure 2.

NKG2D-BBz CAR-T cells efficiently lysed HCC cells. A, Schematic representation of CD19-BBz CAR and NKG2D-BBz CAR. B, CD19 and NKG2D-based CAR expression on human T cells transduced with a lentivirus and analyzed using flow cytometry. Data are representative of three independent experiments. Percentage of positive cells is detailed in the histograms. C, Primary human T cells transduced with the indicated lentivirus were coincubated with the three HCC cell lines at varying E:T ratios for 16 hours, respectively. Cell lysis was determined by a standard nonradioactive cytotoxic assay. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the NKG2D-BBz group and the other two groups was calculated using one-way ANOVA with Sidak correction. *, P < 0.05; ***, P < 0.001. ns, not significant. D, Cytokines released in the coculture supernatant by NTD, CD19-BBz, and NKG2D-BBz CAR-T cells when cocultured with SMMC-7721 cells at E:T ratios of 0:1 and 5:1; TNFα, IL10, IL2, and IFNγ were detected in the supernatant collected 16 hours after the culture. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates and analyzed by two-tailed unpaired Student t test with Welch correction (***, P < 0.001). ns, not significant.

Figure 2.

NKG2D-BBz CAR-T cells efficiently lysed HCC cells. A, Schematic representation of CD19-BBz CAR and NKG2D-BBz CAR. B, CD19 and NKG2D-based CAR expression on human T cells transduced with a lentivirus and analyzed using flow cytometry. Data are representative of three independent experiments. Percentage of positive cells is detailed in the histograms. C, Primary human T cells transduced with the indicated lentivirus were coincubated with the three HCC cell lines at varying E:T ratios for 16 hours, respectively. Cell lysis was determined by a standard nonradioactive cytotoxic assay. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the NKG2D-BBz group and the other two groups was calculated using one-way ANOVA with Sidak correction. *, P < 0.05; ***, P < 0.001. ns, not significant. D, Cytokines released in the coculture supernatant by NTD, CD19-BBz, and NKG2D-BBz CAR-T cells when cocultured with SMMC-7721 cells at E:T ratios of 0:1 and 5:1; TNFα, IL10, IL2, and IFNγ were detected in the supernatant collected 16 hours after the culture. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates and analyzed by two-tailed unpaired Student t test with Welch correction (***, P < 0.001). ns, not significant.

Close modal

To investigate whether the cytotoxicity of NKG2D-BBz CAR-T cell was positively correlated with the cell surface expression of NKG2D ligands, lentiviral particles that induced MICA or ULBP2 silencing were constructed and used to infect SMMC-7721 cells (Supplementary Fig. S4). Silencing MICA and ULBP2 in SMMC7721-shMICA-shULBP2 cells was confirmed by flow cytometry (MICA, 72.5%; ULBP2, 80.1%; Fig 3A). Correspondingly, NKG2D-BBz CAR-T cells showed less potent cytotoxicity against SMMC7721-shMICA-shULBP2 cells compared with other cell lines (Fig. 3B). Ectopic NKG2DL-expressed cell lines Hep3B-MICA and Hep3B-ULBP2 were also generated (Fig. 3C). The cytotoxicity of NKG2D-BBz CAR-T cells toward the Hep3B-MICA or Hep3B-ULBP2 cells was greater than 60%, even at the lowest E:T ratio of 0.5:1 (Fig. 3D), whereas the cytotoxicity toward the wild-type Hep3B cells was only about 10% at the same E:T ratio (Fig. 3D). These data indicate that the cytotoxicity of NKG2D-BBz CAR-T on HCC cells is NKG2DL dependent.

Figure 3.

Cytotoxic effect of NKG2D-BBz CAR-T was dependent on expression of NKG2D ligands. A, MICA and ULBP2 expression in indicated cells was assessed by flow cytometry. Data are representative of two independent experiments. Percentage of positive cells is detailed in the histograms. B, Cytotoxicity of NKG2D-BBz CAR-T cells on SMMC7721-shCOO2, SMMC7721-shMICA, SMMC7721-shULBP2, and SMMC7721-shMICA-shULBP2 cells. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the SMMC7721-shMICA-shULBP2 group and the other three groups was calculated using one-way ANOVA with Sidak correction. *, P < 0.05; **, P < 0.01. C, Flow cytometry analysis of MICA and ULBP2 expression in Hep3B-MICA or Hep3B-ULBP2 cells. Data are representative of three independent experiments. Percentage of positive cells is detailed in the histograms. D, Cytotoxic effect of NKG2D-BBz CAR-T on Hep3B-MICA and Hep3B-ULBP2. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the Hep3B-vector and the other two groups was analyzed by one-way ANOVA with Sidak correction (***, P < 0.001).

Figure 3.

Cytotoxic effect of NKG2D-BBz CAR-T was dependent on expression of NKG2D ligands. A, MICA and ULBP2 expression in indicated cells was assessed by flow cytometry. Data are representative of two independent experiments. Percentage of positive cells is detailed in the histograms. B, Cytotoxicity of NKG2D-BBz CAR-T cells on SMMC7721-shCOO2, SMMC7721-shMICA, SMMC7721-shULBP2, and SMMC7721-shMICA-shULBP2 cells. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the SMMC7721-shMICA-shULBP2 group and the other three groups was calculated using one-way ANOVA with Sidak correction. *, P < 0.05; **, P < 0.01. C, Flow cytometry analysis of MICA and ULBP2 expression in Hep3B-MICA or Hep3B-ULBP2 cells. Data are representative of three independent experiments. Percentage of positive cells is detailed in the histograms. D, Cytotoxic effect of NKG2D-BBz CAR-T on Hep3B-MICA and Hep3B-ULBP2. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the Hep3B-vector and the other two groups was analyzed by one-way ANOVA with Sidak correction (***, P < 0.001).

Close modal

NKG2D-BBz CAR-T cells suppressed the growth of SMMC-7721 xenografts

To explore the therapeutic efficacy of NKG2D-BBz CAR-T cells in vivo, subcutaneous xenografts were established by injecting transfected SMMC-7721-luciferase cells into B-NDG mice, followed by the CAR-T–cell therapy 7 days later. In all mice receiving saline, NTD, or CD19-BBz CAR-T, SMMC-7721 xenografts progressively grew. However, the xenografts in mice receiving NKG2D-BBz CAR-T cells had delayed tumor growth than the three control groups. Overall, 50% (3/6) of the mice showed no tumors 19 days after infusion with NKG2D-BBz CAR-T cells, while the other 3 mice only had minimal residual tumor remaining (Fig. 4A and B). At the end of the study, 4 of the 6 mice in the group receiving the NKG2D-BBz CAR-T cells were tumor free, and the other 2 mice had very small tumors remaining with bioluminescence of approximately 5 × 106 photons/second (Fig. 4A and B). Collectively, these data demonstrate that NKG2D-BBz CAR-T cells can successfully inhibit the tumorigenesis of subcutaneous SMMC-7721 xenografts.

Figure 4.

NKG2D-BBz CAR-T potently suppressed tumorigenesis in an SMMC-7721 xenograft model. A, B-NDG mice bearing SMMC-7721-luciferase xenografts were treated with 100 μL of saline (N = 5), 1 × 107 NTD cells (N = 5), 1 × 107 CD19-BBz CAR-T cells (N = 6), and 1 × 107 NKG2D-BBz CAR-T cells (N = 6) by tail vein injection. All the mice were imaged with an IVIS imager at the indicated times. Tumor growth was assessed by total bioluminescence signals. Data are representative of two independent experiments. B, Growth curve of SMMC-7721-luciferase xenografts treated as described above. C, NKG2D-BBz CAR-T cells accumulated in SMMC-7721-luciferase xenograft tumors. Tumors and normal tissues were collected from mice bearing SMMC-7721-luciferase subcutaneous xenografts treated with CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells. Formalin-fixed, paraffin-embedded tumor sections were consecutively cut and stained for human CD3 expression (brown). Data are representative of two independent experiments. Scale bar, 100 μm.

Figure 4.

NKG2D-BBz CAR-T potently suppressed tumorigenesis in an SMMC-7721 xenograft model. A, B-NDG mice bearing SMMC-7721-luciferase xenografts were treated with 100 μL of saline (N = 5), 1 × 107 NTD cells (N = 5), 1 × 107 CD19-BBz CAR-T cells (N = 6), and 1 × 107 NKG2D-BBz CAR-T cells (N = 6) by tail vein injection. All the mice were imaged with an IVIS imager at the indicated times. Tumor growth was assessed by total bioluminescence signals. Data are representative of two independent experiments. B, Growth curve of SMMC-7721-luciferase xenografts treated as described above. C, NKG2D-BBz CAR-T cells accumulated in SMMC-7721-luciferase xenograft tumors. Tumors and normal tissues were collected from mice bearing SMMC-7721-luciferase subcutaneous xenografts treated with CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells. Formalin-fixed, paraffin-embedded tumor sections were consecutively cut and stained for human CD3 expression (brown). Data are representative of two independent experiments. Scale bar, 100 μm.

Close modal

Because the direct interaction between CAR-T cells and cancer cells is necessary for a therapeutic effect, human T cells in the xenograft tumor and normal tissues were detected via IHC using anti-CD3-ξ. The IHC results showed that NKG2D-BBz CAR-T cells accumulated in SMMC-7721 xenografts, while only small quantities of CD19-BBz CAR-T cells were found in tumors. Human T cells were also detected in the bone marrow of both the NKG2D-BBz CAR-T and CD19-BBz CAR-T groups but were absent in the lung, liver, kidney, and brain (Fig. 4C). These results indicate that NKG2D-BBz CAR-T cells preferentially infiltrated and resided in the HCC tumors, correlating to the efficient suppression of tumor growth.

NKG2D-BBz CAR-T cells derived from patients with HCC showed antitumor activity

Patients with HCC have reported abnormalities in their lymphocyte function (36), thus the antitumor activity of NKG2D-based CAR-T cells derived from HCC patient T cells needed to be verified. Peripheral blood collected from 2 patients with HCC without radiotherapy and chemotherapy was used to isolate T cells. Compared with the T cells of a healthy donor, the patients' T cells proliferated more slowly (Supplementary Fig. S5). The T cells were infected with CD19-BBz and NKG2D-BBz lentiviral particles and the expression of CARs was detected by flow cytometry. The patients' CAR-T cells had similar CAR expression efficiency and CD4/CD8 ratios to that of T cells derived from healthy donor (Supplementary Figs. S6 and S7). To determine the cytotoxicity of NKG2D-BBz CAR-T cells from different sources against HCC cells, we incubated T cells with SMMC7721 cells at different E:T ratios. The results showed that patients' NKG2D CAR-T cell have a comparable antitumor activity with NKG2D-based CAR-T cell derived from a healthy donor (Fig. 5A). Correspondingly, both NKG2D-BBz CAR-T cells showed effective antitumor activity against xenografts formed by SMMC-7721 cells in B-NDG mice (Fig. 5B and C). As expected, xenografts treated with normal saline, or NTD, CD19-BBz CAR-T cells derived from patients with HCC grew rapidly (Fig. 5B and C).

Figure 5.

Patient-derived NKG2D-BBz CAR-T potently suppress liver cancer both in vitro and in vivo. A, Cytotoxic effect of patient-derived NKG2D-BBz CAR-T cells on SMMC-7721 cells. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the NKG2D-BBz group and the corresponding CD19-BBz group was calculated using two-tailed unpaired Student t test with Welch correction. ***, P < 0.001. B, B-NDG mice bearing SMMC-7721-luciferase xenografts were treated with 100 μL of saline or 1 × 107 patient-derived T cells by tail vein injection. NKG2D-BBz CAR-T cells derived from healthy donor were used as the positive control. Mice were imaged at the indicated times. Tumor growth was assessed by total bioluminescence signals. This experiment was done once. C, Growth curve of SMMC-7721-luciferase xenografts treated with indicated T cells or saline (n = 4 per group).

Figure 5.

Patient-derived NKG2D-BBz CAR-T potently suppress liver cancer both in vitro and in vivo. A, Cytotoxic effect of patient-derived NKG2D-BBz CAR-T cells on SMMC-7721 cells. Two independent experiments were performed. Data are presented as the mean ± SD of triplicates. Statistical significance between the NKG2D-BBz group and the corresponding CD19-BBz group was calculated using two-tailed unpaired Student t test with Welch correction. ***, P < 0.001. B, B-NDG mice bearing SMMC-7721-luciferase xenografts were treated with 100 μL of saline or 1 × 107 patient-derived T cells by tail vein injection. NKG2D-BBz CAR-T cells derived from healthy donor were used as the positive control. Mice were imaged at the indicated times. Tumor growth was assessed by total bioluminescence signals. This experiment was done once. C, Growth curve of SMMC-7721-luciferase xenografts treated with indicated T cells or saline (n = 4 per group).

Close modal

Safety evaluation of CAR-T cells

The expression of TAAs on normal cells often leads to severe off-target effects from CAR-T therapy, limiting their clinical application (37). Analysis of the HOrgN090PT02 microarray chip demonstrated the lack of MICA expression in most human tissues (thyroid, tongue, esophageal epithelium, gastric mucosa, jejunal mucous membrane, ileal mucous membrane, appendix, mucous membrane of the rectum, liver, pancreas, trachea, lung, myocardium, artery, skeletal muscle, seminal vesicle, prostate, bladder, testis, medulla oblongata, telencephalon, epencephalon, brainstem, and spleen) except for the skin (3/3; Fig. 6A). Considering gene transfer mediated by lentivirus can possibly induce genome instability and cell malignant transformation, karyotype and proliferation assays were performed to evaluate the safety of CAR expression by lentiviral infection. NKG2D-BBz CAR-T cells maintained a normal karyotype compared with that of untransduced T cells for up to 14 days post-transduction (Fig. 6B). At 72 hours after infection with the lentivirus expressing CD19-BBz CAR and NKG2D-BBz CAR, there were no significant alterations detected in the proliferation and apoptotic status of T cells (Supplementary Fig. S8).

Figure 6.

Safety assessment of NKG2D-BBz CAR-T. A, The 90 normal human tissues in the HOrgN09PT02 microarray were stained with MICA antibody. The samples containing more than 10% MICA-positive cells are marked in red. A1–A4, thyroid; A5–A7, tongue; A8–A11, esophageal epithelium; A12–B5, gastric mucosa; B6 and B7, duodenal mucosa; B8–C1, jejunal mucous membrane; C2–C4, ileal mucous membrane; C5–C9, appendix; C10–D1, mucous membrane of the colon; D2 and D3, mucous membrane of the rectum; D4 and D5, liver; D6 and D7, pancreas; D8–D10, trachea; D11–E3, lung; E4–E6, myocardium; E7–E9, artery; E10–F4, skeletal muscle; F5–F7, skin; F8, seminal vesicle; F9–F11, prostate; F12–G6, testis; G7–G10, bladder; G11, medulla oblongata; G12 and H1, telencephalon; H2 and H3, epencephala; H4, brainstem; and H5 and H6, spleen. Scale bar, 500 μm. B, Karyotype of NTD cells and NKG2D-BBz CAR-T cells. Data are representative of two independent experiments.

Figure 6.

Safety assessment of NKG2D-BBz CAR-T. A, The 90 normal human tissues in the HOrgN09PT02 microarray were stained with MICA antibody. The samples containing more than 10% MICA-positive cells are marked in red. A1–A4, thyroid; A5–A7, tongue; A8–A11, esophageal epithelium; A12–B5, gastric mucosa; B6 and B7, duodenal mucosa; B8–C1, jejunal mucous membrane; C2–C4, ileal mucous membrane; C5–C9, appendix; C10–D1, mucous membrane of the colon; D2 and D3, mucous membrane of the rectum; D4 and D5, liver; D6 and D7, pancreas; D8–D10, trachea; D11–E3, lung; E4–E6, myocardium; E7–E9, artery; E10–F4, skeletal muscle; F5–F7, skin; F8, seminal vesicle; F9–F11, prostate; F12–G6, testis; G7–G10, bladder; G11, medulla oblongata; G12 and H1, telencephalon; H2 and H3, epencephala; H4, brainstem; and H5 and H6, spleen. Scale bar, 500 μm. B, Karyotype of NTD cells and NKG2D-BBz CAR-T cells. Data are representative of two independent experiments.

Close modal

The potential therapeutic efficacy of NKG2D-based CAR-T cells has been tested in several malignant tumors but their efficacy in liver cancer has not been assessed until now. In this study, we designed a novel NKG2D-BBz CAR using the extracellular domain of NKG2D instead of the full-length sequence, followed by 4-1BB and CD3ζ, and successfully produced NKG2D-BBz CAR-T cells that showed strong cytotoxicity against HCC cell lines in vitro as well as a therapeutic effect against HCC cell xenografts in vivo. These results demonstrated that NKG2D-BBz CAR-T can specifically eradicate HCC cells in an NKG2DL-dependent manner, providing a scientific basis for proceeding to a clinical trial for NKG2DL-positive patients.

CAR-T immunotherapy has excellent effects in hematologic malignancies (38). Accordingly, many studies have been performed to extrapolate the success to solid tumors, yet few have shown success (39). To date, several TAAs expressed in liver tumor cells have been exploited for CAR-T therapy, and were demonstrated to lyse HCC cells in vitro and eliminate mouse xenografts in vivo, including GPC-3 (40), MUC1 (41), AFP (42), and CEA (43). However, the clinical results of CAR-T cells in the treatment of HCC have yielded poor therapeutic responses (18, 44). The immunosuppressive tumor microenvironment is one of the main contributors to the limited antitumor effects of CAR-T in liver cancers (18, 36). NKG2D-based CAR-T cells eliminate the inhibitive tumor microenvironment through the following mechanisms: (i) killing the tumor neovasculature expressing NKG2DLs to ameliorate the microenvironment and enhance the immunotherapy effect (45); (ii) killing immunosuppressive myeloid-derived suppressor cells and regulatory T cells; and (iii) recruiting myeloid cells and activated macrophages to modulate the immune tumor microenvironment (46, 47). Tumor heterogeneity is a major cause of tumor immune escape and often leads to recurrence and metastasis. NKG2D-based CAR-T cells can target multiple ligands expressed in tumor cells and thus may be beneficial for the radical treatment of tumors (48). T lymphocytes, both CD4+ Th cells and CD8+ cytotoxic T cells usually play an important role in tumor suppression, and a significant decrease in T-cell activity has been observed in patients with HCC (36). However, in this study, the CD4+/CD8+ ratio in NKG2D CAR-T cells in patients with HCC was still within the normal range (from 0.39 to 7.43; ref. 49). In addition, NKG2D CAR-T derived from patient T cells showed strong killing activity specifically toward liver cancer cells. These findings suggest NKG2D-based CAR-T as a potential multi-functional CAR-T therapy.

A major concern of CAR-T cells in clinical practice is their potential off-tumor effects. For example, treatment with the receptor tyrosine-protein kinase ERBB2-CART resulted in acute respiratory distress syndrome in a patient with colorectal liver metastasis due to the expression of Erbb2 in the lungs (50). In addition, treatment of CEA antigen-directed CAR-T cells in patients with colon cancer resulted in severe colitis due to antigen recognition of the normal colonic tissue (51). Therefore, the specificity of TAAs is of great importance in the application of CAR-T therapy. Using a tissue chip including 96 samples from 27 tissue types, we confirmed that MICA, one of the most important NKG2DLs, is not expressed in most normal tissues, which is in-line with previous reports (52, 53). MICA is localized in the cytoplasm of most MICA-positive epithelial cells (54), suggesting that these MICA-positive epithelial cells would not be targeted by NKG2D-BBz CAR-T cells. CAR NKR-2 (developed by Celyad) was the first-generation NKG2D-based CAR with infusion of full-length NKG2D, DAP10, and the CD3ζ cytoplasmic domain. Although MICA was found to be slightly expressed in the skin, a phase I clinical trial of NKR-2 (NCT02203825) revealed that 7 patients with acute myeloid leukemia and 5 patients with multiple myeloma were successfully treated with NKR-2 cells without obvious toxicities or other adverse events (55). These data demonstrated the safety of NKG2D-based CAR-T therapy.

Taken together, this study clarified the therapeutic roles of NKG2D-BBz CAR-T cells in preclinical HCC models. Considering the proven safety of NKG2D-based CAR-T cells in clinical trials with other cancers, their use can be expected to be applied in clinical trials for NKG2DL-positive patients.

No potential conflicts of interest were disclosed.

Conception and design: B. Sun, D. Yang, H. Dai, X. Zhao

Development of methodology: D. Yang, X. Zhao

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): B. Sun, D. Yang, X. Liu, R. Jia, X. Cui, W. Li, C. Cai, J. Xu

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): B. Sun, D. Yang, H. Dai

Writing, review, and/or revision of the manuscript: B. Sun, D. Yang, H. Dai, J. Xu, X. Zhao

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): D. Yang, H. Dai, J. Xu, X. Zhao

Study supervision: H. Dai, X. Zhao

The authors would like to thank Guolan Ma from the Public Technology Service Center, Kunming Institute of Zoology, Chinese Academy of Sciences for her technical support in the flow cytometric analysis. This work was financially supported by the National Natural Science Foundation of China (U1702289, to X. Zhao, and 81802976, to D. Yang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Bray
F
,
Ferlay
J
,
Soerjomataram
I
,
Siegel
RL
,
Torre
LA
,
Jemal
A
. 
Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries
.
CA Cancer J Clin
2018
;
68
:
394
424
.
2.
Llovet
JM
,
Zucman-Rossi
J
,
Pikarsky
E
,
Sangro
B
,
Schwartz
M
,
Sherman
M
, et al
Hepatocellular carcinoma
.
Nat Rev Dis Primers
2016
;
2
:
16018
.
3.
Llovet
JM
,
Montal
R
,
Sia
D
,
Finn
RS
. 
Molecular therapies and precision medicine for hepatocellular carcinoma
.
Nat Rev Clin Oncol
2018
;
15
:
599
616
.
4.
Yang
JD
,
Roberts
LR
. 
Hepatocellular carcinoma: a global view
.
Nat Rev Gastroenterol Hepatol
2010
;
7
:
448
58
.
5.
Dimitroulis
D
,
Damaskos
C
,
Valsami
S
,
Davakis
S
,
Garmpis
N
,
Spartalis
E
, et al
From diagnosis to treatment of hepatocellular carcinoma: an epidemic problem for both developed and developing world
.
World J Gastroenterol
2017
;
23
:
5282
94
.
6.
Llovet
JM
,
Real
MI
,
Montana
X
,
Planas
R
,
Coll
S
,
Aponte
J
, et al
Arterial embolisation or chemoembolisation versus symptomatic treatment in patients with unresectable hepatocellular carcinoma: a randomised controlled trial
.
Lancet
2002
;
359
:
1734
9
.
7.
Llovet
JM
,
Ricci
S
,
Mazzaferro
V
,
Hilgard
P
,
Gane
E
,
Blanc
JF
, et al
Sorafenib in advanced hepatocellular carcinoma
.
N Engl J Med
2008
;
359
:
378
90
.
8.
Bruix
J
,
Qin
S
,
Merle
P
,
Granito
A
,
Huang
YH
,
Bodoky
G
, et al
Regorafenib for patients with hepatocellular carcinoma who progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial
.
Lancet
2017
;
389
:
56
66
.
9.
Lee
S
,
Loecher
M
,
Iyer
R
. 
Immunomodulation in hepatocellular cancer
.
J Gastrointest Oncol
2018
;
9
:
208
19
.
10.
Chen
ZB
,
Shen
SQ
,
Peng
BG
,
Tao
JP
. 
Intratumoural GM-CSF microspheres and CTLA-4 blockade enhance the antitumour immunity induced by thermal ablation in a subcutaneous murine hepatoma model
.
Int J Hyperther
2009
;
25
:
374
82
.
11.
El-Khoueiry
AB
,
Sangro
B
,
Yau
T
,
Crocenzi
TS
,
Kudo
M
,
Hsu
C
, et al
Nivolumab in patients with advanced hepatocellular carcinoma (CheckMate 040): an open-label, non-comparative, phase 1/2 dose escalation and expansion trial
.
Lancet
2017
;
389
:
2492
502
.
12.
Maude
SL
,
Frey
N
,
Shaw
PA
,
Aplenc
R
,
Barrett
DM
,
Bunin
NJ
, et al
Chimeric antigen receptor T cells for sustained remissions in leukemia
.
N Engl J Med
2014
;
371
:
1507
17
.
13.
Curran
KJ
,
Brentjens
RJ
. 
Chimeric antigen receptor T cells for cancer immunotherapy
.
J Clin Oncol
2015
;
33
:
1703
6
.
14.
Yip
A
,
Webster
RM
. 
The market for chimeric antigen receptor T cell therapies
.
Nat Rev Drug Discov
2018
;
17
:
161
2
.
15.
Kershaw
MH
,
Westwood
JA
,
Parker
LL
,
Wang
G
,
Eshhar
Z
,
Mavroukakis
SA
, et al
A phase I study on adoptive immunotherapy using gene-modified T cells for ovarian cancer
.
Clin Cancer Res
2006
;
12
:
6106
15
.
16.
Gilham
DE
,
Debets
R
,
Pule
M
,
Hawkins
RE
,
Abken
H
. 
CAR-T cells and solid tumors: tuning T cells to challenge an inveterate foe
.
Trends Mol Med
2012
;
18
:
377
84
.
17.
Kakarla
S
,
Gottschalk
S
. 
CAR T cells for solid tumors: armed and ready to go?
Cancer J
2014
;
20
:
151
5
.
18.
Chen
Y
,
E
CY
,
Gong
ZW
,
Liu
S
,
Wang
ZX
,
Yang
YS
, et al
Chimeric antigen receptor-engineered T-cell therapy for liver cancer
.
Hepatobiliary Pancreat Dis Int
2018
;
17
:
301
9
.
19.
Raulet
DH
. 
Roles of the NKG2D immunoreceptor and its ligands
.
Nat Rev Immunol
2003
;
3
:
781
90
.
20.
Zhang
J
,
Basher
F
,
Wu
JD
. 
NKG2D ligands in tumor immunity: two sides of a coin
.
Front Immunol
2015
;
6
:
97
.
21.
Champsaur
M
,
Lanier
LL
. 
Effect of NKG2D ligand expression on host immune responses
.
Immunol Rev
2010
;
235
:
267
85
.
22.
El-Gazzar
A
,
Groh
V
,
Spies
T
. 
Immunobiology and conflicting roles of the human NKG2D lymphocyte receptor and its ligands in cancer
.
J Immunol
2013
;
191
:
1509
15
.
23.
Dhar
P
,
Wu
JD
. 
NKG2D and its ligands in cancer
.
Curr Opin Immunol
2018
;
51
:
55
61
.
24.
Bauer
S
,
Groh
V
,
Wu
J
,
Steinle
A
,
Phillips
JH
,
Lanier
LL
, et al
Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA
.
Science
1999
;
285
:
727
9
.
25.
Cerwenka
A
,
Baron
JL
,
Lanier
LL
. 
Ectopic expression of retinoic acid early inducible-1 gene (RAE-1) permits natural killer cell-mediated rejection of a MHC class I-bearing tumor in vivo
.
Proc Natl Acad Sci U S A
2001
;
98
:
11521
6
.
26.
Barber
A
,
Zhang
T
,
Megli
CJ
,
Wu
JL
,
Meehan
KR
,
Sentman
CL
. 
Chimeric NKG2D receptor-expressing T cells as an immunotherapy for multiple myeloma
.
Exp Hematol
2008
;
36
:
1318
28
.
27.
Barber
A
,
Zhang
T
,
DeMars
LR
,
Conejo-Garcia
J
,
Roby
KF
,
Sentman
CL
. 
Chimeric NKG2D receptor-bearing T cells as immunotherapy for ovarian cancer
.
Cancer Res
2007
;
67
:
5003
8
.
28.
Fernandez
L
,
Metais
JY
,
Escudero
A
,
Vela
M
,
Valentin
J
,
Vallcorba
I
, et al
Memory T cells expressing an NKG2D-CAR efficiently target osteosarcoma cells
.
Clin Cancer Res
2017
;
23
:
5824
35
.
29.
Weiss
T
,
Schneider
H
,
Silginer
M
,
Steinle
A
,
Pruschy
M
,
Polic
B
, et al
NKG2D-dependent antitumor effects of chemotherapy and radiotherapy against glioblastoma
.
Clin Cancer Res
2018
;
24
:
882
95
.
30.
Demoulin
B
,
Cook
WJ
,
Murad
J
,
Graber
DJ
,
Sentman
ML
,
Lonez
C
, et al
Exploiting natural killer group 2D receptors for CAR T-cell therapy
.
Future Oncol
2017
;
13
:
1593
605
.
31.
Sallman
DA
,
Brayer
J
,
Sagatys
EM
,
Lonez
C
,
Breman
E
,
Agaugue
S
, et al
NKG2D-based chimeric antigen receptor therapy induced remission in a relapsed/refractory acute myeloid leukemia patient
.
Haematologica
2018
;
103
:
e424
e6
.
32.
Kamimura
H
,
Yamagiwa
S
,
Tsuchiya
A
,
Takamura
M
,
Matsuda
Y
,
Ohkoshi
S
, et al
Reduced NKG2D ligand expression in hepatocellular carcinoma correlates with early recurrence
.
J Hepatol
2012
;
56
:
381
8
.
33.
Fang
L
,
Gong
JY
,
Wang
Y
,
Liu
RR
,
Li
ZS
,
Wang
Z
, et al
MICA/B expression is inhibited by unfolded protein response and associated with poor prognosis in human hepatocellular carcinoma
.
J Exp Clin Canc Res
2014
;
33
:
76
.
34.
Yang
D
,
Sun
B
,
Zhang
XH
,
Cheng
DM
,
Yu
XP
,
Yan
LZ
, et al
Huwe1 sustains normal ovarian epithelial cell transformation and tumor growth through the histone H1.3-H19 cascade
.
Cancer Res
2017
;
77
:
4773
84
.
35.
Chou
CH
,
Yang
NK
,
Liu
TY
,
Tai
SK
,
Hsu
DS
,
Chen
YW
, et al
Chromosome instability modulated by BMI1-AURKA signaling drives progression in head and neck cancer
.
Cancer Res
2013
;
73
:
953
66
.
36.
Sachdeva
M
,
Chawla
YK
,
Arora
SK
. 
Immunology of hepatocellular carcinoma
.
World J Hepatol
2015
;
7
:
2080
90
.
37.
Bonifant
CL
,
Jackson
HJ
,
Brentjens
RJ
,
Curran
KJ
. 
Toxicity and management in CAR T-cell therapy
.
Mol Ther Oncolytics
2016
;
3
:
16011
.
38.
Gauthier
J
,
Yakoub-Agha
I.
Chimeric antigen-receptor T-cell therapy for hematological malignancies and solid tumors: clinical data to date, current limitations and perspectives
.
Curr Res Transl Med
2017
;
65
:
93
102
.
39.
Harper
K
. 
CAR T-cell therapy for solid tumors?
Cancer Discov
2018
;
8
:
1341
.
40.
Gao
H
,
Li
K
,
Tu
H
,
Pan
X
,
Jiang
H
,
Shi
B
, et al
Development of T cells redirected to glypican-3 for the treatment of hepatocellular carcinoma
.
Clin Cancer Res
2014
;
20
:
6418
28
.
41.
Ma
YD
,
Wang
Z
,
Gong
RZ
,
Li
LF
,
Wu
HP
,
Jin
HJ
, et al
Specific cytotoxicity of MUC1 chimeric antigen receptor-engineered Jurkat T cells against hepatocellular carcinoma
.
Acad J Sec Mil Med Univ
2014
;
35
:
1177
82
.
42.
Liu
H
,
Xu
Y
,
Xiang
J
,
Long
L
,
Green
S
,
Yang
Z
, et al
Targeting alpha-fetoprotein (AFP)-MHC complex with CAR T-cell therapy for liver cancer
.
Clin Cancer Res
2017
;
23
:
478
88
.
43.
Burga
RA
,
Thorn
M
,
Point
GR
,
Guha
P
,
Nguyen
CT
,
Licata
LA
, et al
Liver myeloid-derived suppressor cells expand in response to liver metastases in mice and inhibit the anti-tumor efficacy of anti-CEA CAR-T
.
Cancer Immunol Immunother
2015
;
64
:
817
29
.
44.
Li
K
,
Lan
Y
,
Wang
J
,
Liu
L
. 
Chimeric antigen receptor-engineered T cells for liver cancers, progress and obstacles
.
Tumour Biol
2017
;
39
:
1010428317692229
.
45.
Zhang
T
,
Sentman
CL
. 
Mouse tumor vasculature expresses NKG2D ligands and can be targeted by chimeric NKG2D-modified T cells
.
J Immunol
2013
;
190
:
2455
63
.
46.
Barber
A
,
Rynda
A
,
Sentman
CL
. 
Chimeric NKG2D expressing T cells eliminate immunosuppression and activate immunity within the ovarian tumor microenvironment
.
J Immunol
2009
;
183
:
6939
47
.
47.
Spear
P
,
Barber
A
,
Rynda-Apple
A
,
Sentman
CL
. 
Chimeric antigen receptor T cells shape myeloid cell function within the tumor microenvironment through IFN-gamma and GM-CSF
.
J Immunol
2012
;
188
:
6389
98
.
48.
Soriani
A
,
Fionda
C
,
Ricci
B
,
Iannitto
ML
,
Cippitelli
M
,
Santoni
A
. 
Chemotherapy-elicited upregulation of NKG2D and DNAM-1 ligands as a therapeutic target in multiple myeloma
.
Oncoimmunology
2013
;
2
:
e26663
.
49.
Amadori
A
,
Zamarchi
R
,
Desilvestro
G
,
Forza
G
,
Cavatton
G
,
Danieli
GA
, et al
Genetic-control of the Cd4/Cd8 T-cell ratio in humans
.
Nat Med
1995
;
1
:
1279
83
.
50.
Morgan
RA
,
Yang
JC
,
Kitano
M
,
Dudley
ME
,
Laurencot
CM
,
Rosenberg
SA
. 
Case report of a serious adverse event following the administration of T cells transduced with a chimeric antigen receptor recognizing ERBB2
.
Mol Ther
2010
;
18
:
843
51
.
51.
Parkhurst
MR
,
Yang
JC
,
Langan
RC
,
Dudley
ME
,
Nathan
DAN
,
Feldman
SA
, et al
T cells targeting carcinoembryonic antigen can mediate regression of metastatic colorectal cancer but induce severe transient colitis
.
Mol Ther
2011
;
19
:
620
6
.
52.
Groh
V
,
Bahram
S
,
Bauer
S
,
Herman
A
,
Beauchamp
M
,
Spies
T
. 
Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium
.
Proc Natl Acad Sci U S A
1996
;
93
:
12445
50
.
53.
Groh
V
,
Rhinehart
R
,
Secrist
H
,
Bauer
S
,
Grabstein
KH
,
Spies
T
. 
Broad tumor-associated expression and recognition by tumor-derived gamma delta T cells of MICA and MICB
.
Proc Natl Acad Sci U S A
1999
;
96
:
6879
84
.
54.
Hue
S
,
Mention
JJ
,
Monteiro
RC
,
Zhang
S
,
Cellier
C
,
Schmitz
J
, et al
A direct role for NKG2D/MICA interaction in villous atrophy during celiac disease
.
Immunity
2004
;
21
:
367
77
.
55.
Nikiforow
S
,
Werner
L
,
Murad
J
,
Jacobs
M
,
Johnston
L
,
Patches
S
, et al
Safety data from a first-in-human phase 1 Trial of NKG2D chimeric antigen receptor-T cells in AML/MDS and multiple myeloma
.
Blood
2016
;
128
:
4052
.

Supplementary data