IL12-based local gene therapy of cancer constitutes an active area of clinical research using plasmids, mRNAs, and viral vectors. To improve antitumor effects, we have experimentally tested the combination of mRNA constructs encoding IL12 and IL18. Moreover, we have used a form of IL18 [decoy-resistant IL18 (DR-18)] which has preserved bioactivity but does not bind to the IL18 binding protein decoy receptor. Both cytokines dramatically synergize to induce IFNγ release from mouse splenocytes, and, if systemically cotransferred to the liver, they mediate lethal toxicity. However, if given intratumorally to B16OVA tumor-bearing mice, the combination attains efficacy against the directly treated tumor and moderate tumor-delaying activity on distant noninjected lesions. Cotreatment was conducive to the presence of more activated CD8+ T cells in the treated and noninjected tumors. In keeping with these findings, the efficacy of treatment was contingent on the integrity of CD8+ T cells and cDC1 dendritic cells in the treated mice. Furthermore, efficacy of IL12 plus DR-18 local mRNA coinjection against distant concomitant tumors could be enhanced upon combination with anti–PD-1 mAb systemic treatment, thus defining a feasible synergistic immunotherapy strategy.

Cytokines stimulating anticancer immune responses have been the focus of many translational and early clinical trials, although to date, none of these has become standard of care (1). IL12 is considered one of the most promising candidates, even though if given systemically the therapeutic window is forbiddingly narrow in human patients (2, 3). This is the reason why multiple lines of research intend to confine the effects of IL12 to the tumor microenvironment (4). Such a goal is pursued with local gene therapy strategies (5) with immunocytokines (6–11), using intratumoral transfected cells expressing IL12 (12–15) and tumor-activable pro-cytokines (16, 17). These immunotherapy approaches are usually developed in combination with other agents (18).

The heterodimeric nature of IL12 is greatly simplified by the use of single-chain constructs bound together by linkers (19). IL12 mediates its antitumor therapeutic effects and its toxicity as a result of the induction of large amounts of IFNγ production from T and natural killer (NK) lymphocytes (20, 21).

IL18 is a member of the IL1 family mainly produced by myeloid lineage leukocytes, whose receptor IL18R complex is also restricted to lymphoid cells (22, 23). Indeed, akin to IL12, IL18 is involved in upregulating the production of IFNγ and thereby enhances T cell–mediated immunity (24, 25). IL12 and IL18 synergize to highly induce IFNγ (26–28) and it has been shown that upon combined administration of the recombinant proteins, toxicity is largely exacerbated (29, 30).

IL18 bioactivity is tightly regulated by a soluble decoy receptor termed IL18 binding protein (IL18BP; ref. 31). Indeed, tumors release abundant IL18BP (32) that controls the intratumoral activity of this cytokine. A mutant form of mouse IL18 that does not bind to IL18BP but completely preserves its bioactivity and shows enhanced antitumor activity on transplantable mouse models has been described (33). Such a form is referred to as decoy-resistant IL18 (DR-18).

Local mRNA transient gene transfer of IL12 has been shown to constitute a safe and efficacious form to exploit this cytokine for cancer immunotherapy. In the clinic, a lipo-formulated form of IL12 encoding mRNA, that is very active against mouse models is being tested in a phase I clinical trial in combination with PD-L1 blockade (34–37; ref. NCT03946800). Moreover, naked mRNA encoding IL12 is being intratumorally delivered in mice (38) and humans (39; NCT03871348) in combinations of mRNAs encoding GM-CSF, IFNα, and IL15-sushi.

In this study, we report on the transient gene cotransfer of IL12 and IL18 by means of mRNAs encoding these cytokines chiefly including the DR-18 mutant form. Gene cotransfer to the liver was able to induce large circulating amounts of IFNγ making this systemic approach unmanageable in terms of toxicity. However, local intratumoral administrations were tolerable, synergistic for efficacy. Even though the local approach exerted weak therapeutic effects on distant noninjected concomitant tumors, the intratumoral injections of the mRNAs synergized with systemic anti–PD-1 checkpoint inhibitors for distant effects.

Mice

Mice were housed at the animal facility of the Center for Applied Medical Research (CIMA, Pamplona, Spain). Six-week-old female C57BL/6 mice were purchased from Envigo (Barcelona, Spain). Batf3−/− and Rag1−/− mice were bred in our animal facility (CIMA, Pamplona, Spain; refs. 40, 41).

All animal experiments were approved by the institutional ethics committee and by the regional government of Navarra (Studies 039–21, 077–21, 079–20).

Cell lines and tumor mouse models

HEK293T (293T) and B16F10 cells were procured from the ATCC. B16OVA cells were kindly provided by Dr. Lieping Chen (Yale University, New Haven, CT) in November 2001. MC38 cells were a kind gift from Dr. Karl E. Hellström (University of Washington, Seattle, WA) in September 1998. Cell lines were cultured in RPMI1640 medium (Gibco) supplemented with 10% FBS (Sigma-Aldrich), 100 U/mL penicillin, 100 μg/mL streptomycin (Gibco) and 5 × 10−5 mol/L 2-mercaptoethanol (Gibco). B16OVA cells were supplemented with 400 μg/mL geneticin (Gibco). HEK293T cells were maintained with DMEM high glucose (Gibco) supplemented with 10% FBS, 100 U/mL penicillin and 100 μg/mL streptomycin. All cell lines were grown in a humidified incubator with 5% CO2 at 37°C for at least 7 days before inoculation into mice. Cells were maintained in culture for approximately 10 days before injection in mice. B16OVA, B16F10, and MC38 cell lines were validated by Idexx Radill in 2012 (February) using a panel of microsatellite markers for genotyping. Vials of the frozen master cell bank are thawed approximately every 4 months. All cell lines were routinely tested for Mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).

For the B16OVA unilateral tumor model, C57BL/6 mice were subcutaneously injected with 5 ×105 tumor cells in the right flank. For the B16OVA and MC38 bilateral tumor model, C57BL/6 mice were subcutaneously injected with 5 × 105 B16OVA tumor cells in the right flank and 1.5 × 105 cells in the left flank on day 0, resuspended in a total volume of 50 μL of PBS. For tumor rechallenge, mice that were B16OVA tumor-free at least 6 months after treatment received a subcutaneous injection of 5 × 105 B16OVA and B16F10 cells in the right and in the left flank respectively, in a total volume of 50 μL of PBS.

Plasmids, mRNA synthesis, and ex vivo transfection

The plasmid encoding the mouse single-chain IL12 (scIL12) mRNA has been described (15). The cDNA sequence encoding DR-18 has been published (33). The cDNA sequence encoding the mouse luciferase, GFP, IL18 and the mouse DR-18 mRNA were cloned by GeneScript Inc. in the pUC57-Kan vector containing a T7 promoter upstream of the cDNAs and followed by 2 tandem repetitions of the 3′UTR sequence of the human β2-Globin cDNA and a 60 poly A tail.

The mRNA encoding sequences in the cloning vectors were linearized by the HindIII restriction enzyme (New England Biolabs) prior to mRNA in vitro synthesis. The T7 mScriptTM Standard mRNA Production System (CELLSCRIPT) was used to generate capped IVT mRNA from the cloning vectors according to the manufacturer's instructions. The IVT mRNA was purified using phenol/chloroform extraction, and the purified mRNA was eluted in RNase-free water and stored frozen at 1 to 2 mg/mL without RNase inhibitors. For some experiments, the mRNAs were formulated with the TransIT-mRNA Transfection Kit (Mirus Bio) for 293T cell transfections of cultured cells, according to the manufacturer's instructions.

mRNA formulations for in vivo transient gene transfer

mRNAs encoding cytokines were administered by intravenous or intratumoral injections.

For intravenous administration in tumor-free mice, a total of 20 μg of mRNA was mixed with cold DMEM and with 5.6 μL of TransIT-mRNA reagent and 3.6 μL of TransIT Boost reagent. Such mRNA formulations were incubated at room temperature for 2 minutes and intravenously injected into mice, as previously reported (42). For combined mRNA treatments, 10 μg of mRNA encoding luciferase, scIL12, IL18, and DR-18 were injected as shown in the figures and described in figure legends.

For intratumoral administration, mRNAs were mixed in Ringer's lactate (Grifols) and then injected into the tumor. For the control group, 10 μg of mRNA encoding luciferase were used. For the combination treatments, 5 μg of each mRNA encoding luciferase or cytokines were given. The total injection volume for 10 μg of formulated mRNA to be delivered intratumorally was 50 μL. Only for MC38 tumor-bearing mice, 10 μg of each mRNA were used in combination treatments.

In the experiments in which 10 μg mRNAs were intravenously administered simultaneously with intratumoral mRNA injections, 5 μg of each mRNA encoding luciferase, scIL12, IL18, and DR-18 were administered intratumorally as described above.

T-cell activation

C57BL/6 mouse spleens were processed to obtain single-cell splenocyte suspensions as previously described (43). 2 × 105 splenocytes were seeded in 96-well plates and resuspended in a total 200 μL of conditioned medium of 293T cells transfected with mRNA encoding for luciferase, scIL12, IL18, or DR-18 per well. Conditioned media retrieved 24 hours later was used to resuspend the splenocyte cultures. When two conditioned media were used, 100 μL of each were added. Cells were then incubated in a humidified incubator with 5% CO2 at 37°C for 48 hours. Supernatants were collected and analyzed by ELISA and cells were harvested for RNA extraction and RT-PCRs were performed as described above. Splenocytes were collected either baseline or after 48-hour culture with IFNγ (Miltenyi) at 100 U/mL or control medium and immediately processed for RNA extraction.

Design of mRNA in vivo treatment experiments

To determine IL12 or IFNγ concentrations in tumor extracts and blood, mRNAs were intravenously or intratumorally injected. To quantify IL12 and IFNγ tumoral protein concentrations, tumors were excised and homogenized using VWR Disposable Pellet Mixers in PBS containing cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail (Roche).

To study the cell types expressing the reporter transgenes, unilateral tumor-bearing mice received a single intratumoral injection of 30 μg of GFP-encoded mRNA diluted in Ringer's lactate buffer. Six hours later, injected tumors were excised and single-cell suspensions were analyzed by flow cytometry.

To evaluate the toxicity of systemically injected mRNA-encoding cytokines, mice were intravenously injected on day 0, 3, and 6 and survival and body weight were recorded.

To assess the effects of mRNA encoding cytokines in the tumor microenvironment, tumor-bearing mice were intratumorally injected with mRNA-encoding cytokines diluted in Ringer's lactate on days +9 and +12 after tumor cell subcutaneous implantation. On day +14, mice were euthanized and contralateral untreated tumors were excised to derive cell suspensions that were analyzed by flow cytometry.

To evaluate the therapeutic efficacy of mRNA encoded cytokines, tumor-bearing mice were intratumorally injected with mRNAs diluted in Ringer's lactate on days +7, +10, and +13 after tumor cell subcutaneous implantation. Tumor sizes were measured every 3/4 days.

For combination studies with anti–PD-1 mAb, 200 μg of control IgG (BE0094) antibody or anti–PD-1 mAb (RMP1–14) were intraperitoneally administered simultaneously with intratumoral Ringer's lactate formulated RNA.

For immune cell depletion studies, 100 μg of control (IgG, BE0094), anti-CD8β (53–5.8), anti-CD4 (GK15), anti-NK1.1 (PK136) antibodies were intraperitoneally administered on days +6, +9, +14, +17 and once a week thereafter until the end of the experiment. Efficient depletion of CD4+, CD8+, or NK cells was checked on day +14 in peripheral blood samples.

All the antibodies used for in vivo studies were purchased from BioXcell.

ELISA determinations of cytokine concentrations and ELISpot assays

IL12p70 and IL18 protein in 293T cell supernatants were quantified using commercially available ELISA kits (BD OptEIA Mouse IL12 (p70) ELISA Set, catalog no. 555256; IL18 ELISA Kit, Mouse, catalog no. SEK50073 respectively), according to the manufacturers’ instructions.

To assess IL12p70 and IFNγ concentrations in the serum of tumor-free and tumor-bearing mice, 100 to 150 μL of peripheral blood were collected in 50 μL of Heparin (Hospira). Cytokine concentrations were assessed using commercially purchased ELISA kits (BD OptEIA Mouse IFNγ ELISA Set, catalog no. 555138) according to the manufacturer's instructions.

Ovalbumin (OVA) specific CD8 T-cell response was assessed ex vivo by a mouse IFNγ Enzyme-linked Immunosorbent Spot (ELISpot) Assay kit (BD Biosciences). Ninety-six–well Multiscreen IP Plates (Millipore) were coated with 100 μL of assay diluent containing anti–IFNγ mAb and incubated overnight at 4°C. The plates were washed and then blocked with RPMI1640 medium containing 10% FBS for 90 minutes at room temperature. Splenocytes depleted of erythrocytes or cell suspensions from tumor-draining lymph nodes (TDLN) were added to the wells (8 × 105 cells) where they were stimulated with synthetic OVA257–264 peptide (1 μg/mL) for 24 hours. IFNγ-producing cells were assessed by counting the spots referred to input cells according to the manufacturer´s instructions.

RNA extraction and quantitative RT-PCR

Total RNA was extracted from splenocytes with the Maxwell RSC simplyRNA extraction kit (Promega) according to the manufacturer's instructions and subsequently retrotranscribed into cDNA using M-MLV enzyme kit (Invitrogen). Real-time PCR reaction was performed using the Bio-rad CFX qPCR system with customized primers for mIL18BP (FW 5´- GAGGGCCACACAAGTCGC and RV 5´- GCTGGGCCAGAATGATGTGA).

Multiplexed immunofluorescence

A five-color multiplex immunofluorescence panel based on tyramide signal amplification was used for simultaneous detection of CD3 (T cells), CD8 (cytotoxic T lymphocytes), Foxp3 [regulatory T cells (Treg)], CD4 (CD4 T cells), and diamidino-2-phenylindole (DAPI) on tumor sections from formalin-fixed, paraffin-embedded (FFPE) samples. The validation pipeline for the multiplex immunofluorescence protocol has been previously described by our group (41). Briefly, 4-μm thick sections obtained from FFPE tissue blocks were deparaffinized and rehydrated from ethanol to water. Antigen retrieval with citrate (pH6, PerkinElmer) or EDTA (pH9, Dako) target retrieval solution was performed at the beginning of each sequential round of antibody staining. Each round consisted of heat-induced antigen retrieval followed by protein blocking (Antibody Diluent/Block, Akoya Bioscience), incubation with primary antibody, anti-rabbit secondary antibody (Opal Polymer anti-rabbit horseradish peroxidase Kit, Perkin Elmer) finishing with Opal fluorophore incubation diluted in 1XPlus Amplification Diluent (Akoya Bioscience). The panel included the following primary antibodies: CD3 (rabbit monoclonal, clone SP7, 1:100, Abcam, REF. ab16669), CD8 (rabbit monoclonal, clone D4W2Z, 1:500, Cell Signaling Technology, REF. 98941), Foxp3 (rabbit monoclonal, clone D6O8R, 1:500, Cell Signaling Technology, REF. 12653), and CD4 (rabbit monoclonal, 1:200, Cell Signaling Technology, REF. 25229). At the end of the protocol, nuclei were counterstained with spectral DAPI (Akoya Biosciences) and sections were mounted with Faramount Aqueous Mounting Medium (Dako).

Tissue imaging, spectral unmixing, and phenotyping

Multiplexed immunofluorescence slides were scanned on a Vectra-Polaris Automated Quantitative Pathology Imaging System (Akoya Biosciences) as described previously (44, 45). Whole tissue present in a single FFPE tissue section was imaged, spectrally unmixed and exported as component TIF image tile using Akoya Biosciences’ Inform software (version 2.4.8). Component TIF image tiles were then imported into the open source digital pathology software QuPath version 0.2.0-m9 and stitched together using the x-y coordinates to create a new pyramidal TIF file for image analysis. Image analysis was performed in the whole tissue sections.

Cell segmentation was performed in the whole multispectral image using QuPath software version 0.2.0-m9 (46). Nuclear detection was carried out on the DAPI channel using a custom, unsupervised watershed algorithm as described earlier (44). A random trees algorithm classifier was generated to further subclassified the cells as CD3+, CD8+, CD4+, Foxp3+. Cell algorithm classifiers were trained separately for each cell marker using the features generated by having an experienced pathologist annotate regions in a subset of images (a training set) obtained from all cases used in this study, with interactive feedback on classification performance provided during training in the form of markup image, as described previously (44, 46). Cells close to the border of the images were removed from the analysis to reduce the risk of artifacts. CD4+ T cells were defined as CD3+ CD8. Cells negative for these markers were defined as “other cell types”. Measurements were calculated as cell densities (cells/mm2).

Flow cytometry and bioluminescence analyses

Tumor samples were collected and incubated in collagenase/DNase A for 15 minutes at 37°C. All the specimens were then mechanically disaggregated and filtered through a 70-μm cell strainer (Thermo Fisher Scientific) to obtain single cell suspensions. Samples were treated with FcR-Block (anti-CD16/32 clone 93; BD Biosciences), and then surface stained with the following fluorochrome-labeled antibodies purchased from BioLegend: anti-CD45-PeCy7 (30-F11), anti-NK1.1-PE-Dazzle (PK-136), anti-CD31-AF488 (MEC13.3), anti-CD25-BV421 (PC61), anti-CD137-APC (17B5), anti-CD11b-BV650 (M1/70), anti-Ly6G-BV510 (1A8), anti-Ly6C-AF647 (HK1,4), anti-F4/80-BV421 (BM8), anti-CD11c-BV605 (M1/70), and the following fluorochrome-labeled antibodies purchased from BD: anti-CD4-BUV496 (GK1.5), anti-CD8-BUV395 (53–6.7), anti-CD45-BUV661 (30-F11).

For intracellular staining cells were permeabilized after surface staining with True-Nuclear (BioLegend) for 45 to 60 minutes following the manufacturer's instructions and intracellularly stained with anti-Ki67-AF700 (16A8, BioLegend) and anti–FoxP3-Prcp5.5 (FJK-16S, Invitrogen). Zombie NiR (BioLegend) and Promofluor (PromoCell) were used to exclude cell death by gating. Samples were acquired on a CytoFlex LX system (Beckman Coulter).

For in vivo luciferase detection, B16OVA bilaterally tumor-bearing mice on day 7 were intratumorally injected with saline-formulated mRNA encoding luciferase as a single agent or in combination with mRNAs encoding luciferase and scIL12, IL18, or DR-18. Bioluminescence imaging (PhotonIMAGER) was performed 6 hours after intratumoral mRNA injection using luciferin infusions (Promega).

Bioinformatic analysis

The bioinformatic analysis of The Cancer Genome Atlas (TCGA) data sets (https://www.cancer.gov/tcga) were performed on a workstation equipped with 16x Intel Xeon W-2245 @ 4.7 GHz and 256 GB of RAM in a Linux system (Ubuntu 20.04) for Transcriptomic data (RNA sequencing). The statistical environment was R/Bioconductor (v. 4.1; ref. 47). The accession to the raw TCGA counts was made possible through TCGAbiolinks (v.2.21.7; ref. 48). TCGA tissues for which no normal tissue samples were available were discarded. Before normalization of the selected tissues, low expressed genes with less than 5 counts in more than 50% of samples in each condition were removed. Normalization of counts was performed using the TMM method from the package edgeR and expression values were transformed in Log2 (v.3.35; ref. 49). Subsequently, differential expression analysis was performed between tumor versus normal samples with edgeR pipeline. Tissues in which the IL18BP transcript was more highly expressed in tumors are shown. To test IL18BP expression in tissues with more T-cell infiltration, tumor cases were separated into two groups based on the mean of CD8A marker expression. For each tumor type, the number of cases was: BLCA (n = 414); PRAD (n = 498); ESCA (n = 161), LIHC (n = 371), HNSC (n = 500), CHOL (n = 36), STAD (n = 375), KIRC (n = 538).

Statistical methods

Flow cytometry analyses were performed with CytExpert software. Means and standard deviations of the mean are presented as averages and error bars unless otherwise indicated in the figure legends. GraphPad Prism V.8 (LA Jolla, CA) was used for statistical analysis as indicated in figure legends. When differences are statistically significant, the significance is represented with asterisks according to the following values: *, P < 0.05; **, P < 0.01; ***, P < 0.001; and ****, P < 0.0001.

Data availability statement

The raw data generated in this study are available upon reasonable request from the corresponding author. TCGA raw data were accessed via https://www.cancer.gov/tcga.

mRNA as a platform to confer coexpression of functional scIL12 and IL18

Given the synergy of IL12 and IL18 to elicit IFNγ production from T and NK cells (26–28), we sought to devise a method to achieve transient gene coexpression of both cytokines.

First, we constructed and optimized mRNA molecules synthetized from templates as previously described (50) which encoded mouse scIL12, mouse IL18 and a form of IL18 (DR-18) with six point mutations (33) that make it irrepressible by IL18BP as a soluble decoy receptor (Fig. 1A). To ascertain if such mRNA constructs were functional, we transfected 293T cells with the TransIT lipid-conjugated mRNAs and measured IL12 or IL18 in the culture supernatants to demonstrate by ELISA assays that over 72 hours, growing quantities of the cytokines accumulated in the cell-culture supernatants (Fig. 1B). Of note, DR-18 is not detected by available IL18 ELISA assays. Moreover, we exposed total mouse splenocytes to such supernatants from 293T cells which had been transfected with the scIL12, IL18, and DR-18 mRNAs 24 hours earlier (Fig. 1C). As shown in Fig. 1D, the supernatant of the splenocyte cultures recovered 48 hours later contained measurable amounts of IFNγ as measured by ELISA. Importantly, coexposure of the splenocytes to mixed conditioned media from 293T cells that had been transfected with scIL12 and DR-18 mRNAs, gave rise to very large quantities, especially when the DR-18 mRNA had been used in the transfection (Fig. 1D). The repression of IL18 by IL18BP is considered relevant in the cancer immunotherapy setting, because IL18BP is detectable in bulk RNA sequencing from solid tumors in TGCA, especially when densely infiltrated by CD8+ T cells (Supplementary Fig. S1A). Moreover, IL18BP mRNA expression is detectable in mouse splenocytes and this was augmented upon culture in the presence of IFNγ (Supplementary Fig. S1B). Treatment of splenocytes with 293T-cell supernatants transfected with IL18, IL12, and/or DR-18 mRNAs also showed an enhancement of IL18BP transcripts, perhaps as a negative feedback mechanism (Supplementary Fig. S1C).

Figure 1.

scIL12 and IL18 mRNAs synergize to induce IFNγ. A, Schematic representation of mouse scIL12, IL18, and DR-18 as the proteins encoded in optimized mRNAs for expression. Point mutations in DR-18 as compared with WT IL18 are provided. B, Content of IL12 and IL18 in the supernatants of 293T cells transfected with the indicated TransIt lipocomplexed mRNAs. Of note, mutant DR-18 could not be detected by commercial sandwich ELISAs. C and D, Conditioned media from experiments in B elicited IFNγ production detectable in the supernatants from mouse splenocytes stimulated for 48 hours with such conditioned media. Results are representative of three repetitions. Data are expressed as mean ± SEM and analyzed in D by one-way ANOVA followed by Sidak post test. **, P ≤ 0.01.

Figure 1.

scIL12 and IL18 mRNAs synergize to induce IFNγ. A, Schematic representation of mouse scIL12, IL18, and DR-18 as the proteins encoded in optimized mRNAs for expression. Point mutations in DR-18 as compared with WT IL18 are provided. B, Content of IL12 and IL18 in the supernatants of 293T cells transfected with the indicated TransIt lipocomplexed mRNAs. Of note, mutant DR-18 could not be detected by commercial sandwich ELISAs. C and D, Conditioned media from experiments in B elicited IFNγ production detectable in the supernatants from mouse splenocytes stimulated for 48 hours with such conditioned media. Results are representative of three repetitions. Data are expressed as mean ± SEM and analyzed in D by one-way ANOVA followed by Sidak post test. **, P ≤ 0.01.

Close modal

Next, we formulated the mRNAs in TransIT lipocomplexes and injected them intravenously into mice to achieve liver gene transfer and expression of the cytokines causing their release into the systemic circulation (42). Using this route of administration, the sera of groups of mice were monitored for the concentrations of circulating IFNγ (Fig. 2A). Although scIL12 and IL18 mRNAs elicited elevations in circulating IFNγ concentrations, the combinations of scIL12 and IL18 were clearly synergistic in this regard. Importantly, scIL12 + DR-18 mRNAs conferred higher and more durable circulating IFNγ (Fig. 2B). In separate animals, when dosing the combination of scIL12 and DR-18 (Fig. 2C), we found it to be severely toxic and in 6 days, it killed 5 of 6 mice (Fig. 2D), which had shown signs of sickness including weight loss (Fig. 2E). In those mice receiving repeated administrations (Fig. 2C), synergistic effects in terms of eliciting circulating IFNγ were documented as early as 6 hours following intravenous delivery of mRNA lipocomplexes (Fig. 2F).

Figure 2.

scIL12 and DR-18 transient mRNA gene transfer to liver cells leads to toxic high abundance of circulating IFNγ. A, Schema of experiments in which mice were intravenously given TransIt-lipoplexed mRNA encoding the indicated cytokines. B, Serial determinations of the circulating concentration of IFNγ upon intravenous treatment with the indicated mRNAs or the indicated mRNA combinations. C, Scheme of experiments in which mice were repeatedly intravenously infused with the indicated mRNAs to achieve transient liver gene transfer. D and E, Weight and overall survival follow-up. F, Circulating concentration of IFNγ in the indicated groups of mice 6 hours following treatment. Experiments were repeated twice. Longitudinal data were fitted to a third-order polynomial equation and compared with an extra sum-of-squares F test (B and E). Statistical comparisons were made using the log-rank test (D) and one-way ANOVA followed by Sidak post-test (F). Data are expressed as mean ± SD. **, P ≤ 0.01; ****, P ≤ 0.0001.

Figure 2.

scIL12 and DR-18 transient mRNA gene transfer to liver cells leads to toxic high abundance of circulating IFNγ. A, Schema of experiments in which mice were intravenously given TransIt-lipoplexed mRNA encoding the indicated cytokines. B, Serial determinations of the circulating concentration of IFNγ upon intravenous treatment with the indicated mRNAs or the indicated mRNA combinations. C, Scheme of experiments in which mice were repeatedly intravenously infused with the indicated mRNAs to achieve transient liver gene transfer. D and E, Weight and overall survival follow-up. F, Circulating concentration of IFNγ in the indicated groups of mice 6 hours following treatment. Experiments were repeated twice. Longitudinal data were fitted to a third-order polynomial equation and compared with an extra sum-of-squares F test (B and E). Statistical comparisons were made using the log-rank test (D) and one-way ANOVA followed by Sidak post-test (F). Data are expressed as mean ± SD. **, P ≤ 0.01; ****, P ≤ 0.0001.

Close modal

Intratumoral delivery of mRNAs

Given the toxicity seen following transient liver gene transfer, we considered the possibility of delivering the mRNAs to be expressed inside transplanted B16OVA-derived subcutaneous tumors. For this purpose, we injected the mRNAs diluted in Ringer's Lactate buffer as previously reported (51).

With these conditions, a similarly synthetized luciferase-encoding mRNA attained intratumoral expression (Fig. 3A) visible by bioluminescence 6 hours later without noticeable expression detectable elsewhere in the mice. Of note, when luciferase-encoding mRNA was coinjected with those encoding scIL12 or the IL18 variant DR-18, no reduction in luciferase gene transfer was substantiated (Fig. 3A). Hence, coadministrations of mRNAs are feasible.

Figure 3.

Naked mRNAs in Ringer's lactate are expressed by malignant and stromal cells upon B16OVA intratumoral injection. A, Representative bioluminescence images following intratumoral injection of mRNA encoding luciferase as a single molecule or in a combination of mRNAs encoding scIL12, IL18, or DR-18 as indicated. A color scale for photon emission is provided. Mice were carrying bilateral tumors but no luminescence was observable from noninjected tumors. B and C, Using mRNA encoding GFP in a similar intratumoral injection setting, the cell types expressing the transgene 6 hours following injection were assessed by multicolor flow cytometry on tumor-derived cell suspensions. Experiments were repeated twice. Data are expressed as mean ± SD.

Figure 3.

Naked mRNAs in Ringer's lactate are expressed by malignant and stromal cells upon B16OVA intratumoral injection. A, Representative bioluminescence images following intratumoral injection of mRNA encoding luciferase as a single molecule or in a combination of mRNAs encoding scIL12, IL18, or DR-18 as indicated. A color scale for photon emission is provided. Mice were carrying bilateral tumors but no luminescence was observable from noninjected tumors. B and C, Using mRNA encoding GFP in a similar intratumoral injection setting, the cell types expressing the transgene 6 hours following injection were assessed by multicolor flow cytometry on tumor-derived cell suspensions. Experiments were repeated twice. Data are expressed as mean ± SD.

Close modal

In similar experiments using GFP-encoding mRNA, we studied which cell types in the tumor tissue were expressing the transgenes. In B16OVA tumor-derived cells suspensions, about 10% of CD45-negative tumor cells expressed the transgene (Fig. 3B), and minor fractions (<5%) of lymphocytes and myeloid leukocytes also attained transgene expression (Fig. 3B). Of note, expression in tumor cells was much higher than those in any other cell type as assessed by fluorescence intensity in FACS analyses (Fig. 3C). We also studied the pattern of expression of the transgene among CD11c+ dendritic cells that are known to be crucial for antitumor immune responses (52). About 4% to 5% of dendritic cells were transduced including cDC1 and cDC2 cells (Supplementary Fig. S2A and S2B). Checking transgene expression using GFP mRNA intratumoral injection, we confirmed that expression was mainly found in CD45 tumor cells as well as intratumoral leukocytes (Supplementary Fig. S2C). The transgene was not detectable in TDLN, in circulation or in the spleen. Using luciferase as a reporter gene, it was observed that the expression following intratumoral injection peaked at 24 hours and became undetectable at 48 hours (Supplementary Fig. S2D). In mice bearing established MC38-derived tumors and treated with mRNA encoding scIL12, we detected high concentrations of IL12 in the tumor as early as 6 hours after intratumoral delivery with limited but detectable amounts also in circulation (Supplementary Fig. S3A). Furthermore, when combinations of scIL12 and IL18 encoding mRNAs were used in MC38 tumor-bearing mice, synergistic elevations of IFNγ were detected in the excised tumor tissue as well as in circulation (Supplementary Fig. S3B). The abundance of IFNγ reached in the tumor and in circulation were higher for DR-18 mRNA than for the natural form of IL18 mRNA. Of note, circulating concentrations of IFNγ were reduced by at least 95% at 6 hours following injection and also remained lower over time as compared with systemic delivery (Supplementary Fig. S3C). Indeed, treated mice showed normal behavior and nutritional status suggesting better tolerability. Taking these results together, local immunotherapy with at least two naked mRNAs encoding these cytokines was considered feasible.

Intratumorally delivered mRNAs encoding scIL12 and IL18 exert therapeutic synergistic effects

To explore therapeutic activity on transplanted mouse tumors, we first treated groups of mice bearing subcutaneous MC38-derived tumors. In mice bearing 7-day established bilateral MC38 tumors, we injected three doses of the mRNAs diluted in Ringer's lactate buffer, given every 3 days to only one of the tumor lesions. In this setting, the mRNA encoding scIL12 was very effective at causing tumor regression of the injected and noninjected lesions (Supplementary Fig. S4A–S4C). IL18 mRNA in this scenario was ineffective as compared with control vehicle but the DR-18 mutant achieved regression in 2 of 5 treated tumors and some delays in contralateral tumor growth when compared with control mice (Supplementary Fig. S4A–S4C). These efficacy results of intratumoral scIL12 mRNA precluded the exploration of combinations in the MC38 mouse tumor model. However, the B16OVA bilateral melanoma model is considered less sensitive to immunotherapy and permitted such combinatorial experiments (41, 53). For this reason, in preliminary experiments, we treated B16OVA models attaining limited efficacy with IL12 mRNA as a single agent. We found in this bilateral model that three repeated injections every 3 days attained better efficacy than a single dose (Supplementary Fig. S4D)

We then performed experiments in groups of mice bearing subcutaneous tumors derived from B16OVA cells (Fig. 4A). Treatments were given on days +7, +10, and +13. Follow-up of tumor sizes revealed that scIL12 attained some level of suboptimal local and contralateral therapeutic activity and hence the model was suitable to explore combinations (Fig. 4B). Indeed, IL18 and DR-18 mRNAs were unable to elicit any complete regression, even though DR-18 delayed progression in some instances. As shown in Fig. 4B and C, the intratumoral combination of scIL12 and DR-18 mRNAs was markedly synergistic at inducing local and contralateral efficacy. We also tried to use scIL12 mRNA locally while giving lipoplexed DR-18 systemically as in Fig. 2. The efficacy of this combination was comparable with the local coadministration but mice lost weight and showed signs of systemic inflammation even though all of them survived (Supplementary Fig. S5A–S5C).

Figure 4.

The combination of scIL12 and DR-18 mRNAs exerts synergistic efficacy against established bilateral B16OVA-derived tumors. A, Schematic representation of the experiments. B, Individual follow up of the sizes of the directly injected and noninjected tumors with the indicated mRNAs or mRNA combinations on days +7, +10, +13. The fraction of mice completely regressing their tumors is provided. C, Summary of the data and statistical comparisons. Dotted lines represent the dates of mRNA treatments. D, Mice bilaterally cured by combination of mRNAs encoding scIL12 and DR-18 were rechallenged at least 6 months later and compared with a group of naïve mice. Individual tumor sizes were followed up as indicated. Experiments are representative of three performed (B and C) and for D mice cured in the different experiments were pooled for rechallenges. Tumor size data were fitted to a third-order polynomial and compared using an extra sum-of-squares F test. Luciferase encoding mRNA was used as a control where indicated. Data are expressed as mean ± SD. **, P ≤ 0.01; ****, P ≤ 0.0001.

Figure 4.

The combination of scIL12 and DR-18 mRNAs exerts synergistic efficacy against established bilateral B16OVA-derived tumors. A, Schematic representation of the experiments. B, Individual follow up of the sizes of the directly injected and noninjected tumors with the indicated mRNAs or mRNA combinations on days +7, +10, +13. The fraction of mice completely regressing their tumors is provided. C, Summary of the data and statistical comparisons. Dotted lines represent the dates of mRNA treatments. D, Mice bilaterally cured by combination of mRNAs encoding scIL12 and DR-18 were rechallenged at least 6 months later and compared with a group of naïve mice. Individual tumor sizes were followed up as indicated. Experiments are representative of three performed (B and C) and for D mice cured in the different experiments were pooled for rechallenges. Tumor size data were fitted to a third-order polynomial and compared using an extra sum-of-squares F test. Luciferase encoding mRNA was used as a control where indicated. Data are expressed as mean ± SD. **, P ≤ 0.01; ****, P ≤ 0.0001.

Close modal

Mice cured by the combination in repeated experiments were rechallenged with B16OVA or with B16F10 tumors (Fig. 4D; Supplementary Fig. S6) at least 6 months after complete regression and showed remarkable immune memory at rejecting such tumor cell inoculations, indicating that memory had been established and that it was directed not only to the OVA antigen. This is considered important in immunotherapy to prevent relapses.

Injected and contralateral tumors were analyzed in treated mice at day +14. Weight of the excised tumors indicated therapeutic activity (Supplementary Fig. S7A). Flow cytometry experiments on tumor-derived cell suspensions from the treated tumors showed increase of CD8+ T cells infiltrating the tumor upon treatment with the combination (Supplementary Fig. S7B). Moreover, such results were recapitulated using multiplex tissue immunofluorescence that confirmed more pronounced density of CD8+ T cells and Treg cells upon scIL12+DR-18 combined intratumoral treatment (Supplementary Fig. S7C)

To explain the modest systemic effects, we explored the immune composition of the contralateral tumor microenvironment on day +14 according to the scheme in Fig. 5A. As shown in Fig. 5B, we did not find by FACS analyses of single-cell suspensions any significant changes in the content of total lymphocytes or T cells. Discrete reductions of CD45CD31+ endothelial cells were observed probably in relation with the described antiangiogenic effect of IL12 (54, 55). However, when analyzing the activation state of such CD8+ T cells in the contralateral tumor, we observed evident signs of lymphocyte activation upon scIL12 and DR-18 mRNAs cotreatment of the contralateral tumor, such as increased CD137 (4–1BB) expression (Fig. 5C), increased CD25 expression (Fig. 5D) and increased Ki67 expression (Fig. 5E). The CD4+ Treg compartment remained similar with respect to the controls. There were also signs of more active proliferation among CD4+ T cells observed in terms of Ki67 staining in the noninjected contralateral tumors (Fig. 5F).

Figure 5.

CD8+ T cells in contralateral tumors show signs of activation upon intratumoral coinjection of mRNAs encoding scIL12 and DR-18. A, Schema of treatments and contralateral tumor excisions. B, Multicolor flow cytometry analyses of the content of the indicated lymphocyte and endothelial cell subsets in the stroma of the contralateral tumor lesions in response to intratumoral mRNAs delivered to the concomitant contralateral tumor as indicated. CE, Multicolor flow cytometry assessment of activated CD8+CD137+ (4-1BB), CD8+CD25+, and CD8+Ki67+ as indicated measuring the percentage of cells costained and the relative intensity of fluorescence for each activation marker. F, Multicolor FACS analyses of the indicated CD4+ T cells. The color code is used to indicate the mRNAs or mRNA combinations and one-way ANOVA tests followed by Sidak post-test were used for statistical comparisons among groups. Experiment was repeated three times. Data are expressed as mean ± SD. ***, P ≤ 0.001; ****, P ≤ 0.0001.

Figure 5.

CD8+ T cells in contralateral tumors show signs of activation upon intratumoral coinjection of mRNAs encoding scIL12 and DR-18. A, Schema of treatments and contralateral tumor excisions. B, Multicolor flow cytometry analyses of the content of the indicated lymphocyte and endothelial cell subsets in the stroma of the contralateral tumor lesions in response to intratumoral mRNAs delivered to the concomitant contralateral tumor as indicated. CE, Multicolor flow cytometry assessment of activated CD8+CD137+ (4-1BB), CD8+CD25+, and CD8+Ki67+ as indicated measuring the percentage of cells costained and the relative intensity of fluorescence for each activation marker. F, Multicolor FACS analyses of the indicated CD4+ T cells. The color code is used to indicate the mRNAs or mRNA combinations and one-way ANOVA tests followed by Sidak post-test were used for statistical comparisons among groups. Experiment was repeated three times. Data are expressed as mean ± SD. ***, P ≤ 0.001; ****, P ≤ 0.0001.

Close modal

To address if the treatments were enhancing antigen-specific CD8 adaptive immunity, we performed IFNγ-ELISpot assays on splenocytes and TDLN lymphocytes from treated mice as described in Supplementary Fig. S8A, whose lymphocytes were stimulated with OVA257–264 peptide (Supplementary Fig. S8B–S8G). As can be seen, combinations of IL12+DR-18 mRNAs attained more CD8 reactivity to the surrogate tumor antigen (Supplementary Fig. S8B–S8G).

CD8+ T cells mediate the synergy of intratumorally coinjected scIL12+DR-18 mRNAs

To ascertain the immune requirements for antitumor activity, we performed antibody-mediated depletions targeting CD8β, CD4 and NK1.1 (Fig. 6A). Our results excluded any necessary role for CD4, NK, or NKT lymphocytes. However, depletion of CD8+ T cells curtailed the efficacy of the combined treatment (Fig. 6AC; Supplementary Table S1).

Figure 6.

CD8 T cells are required for the antitumoral effects of intratumoral scIL12+DR-18 mRNAs. A, Individual follow-up of tumor sizes of mice intratumorally treated with combined IL12 and DR-18 mRNAs that were antibody-depleted from CD8β, CD4, or NK1.1 lymphocytes since 1 day before the mRNA treatments. B, Summary of their size data with statistical comparisons. C, Survival follow-up of the indicated groups of mice D, Experiments as in A performed in WT mice, BATF3−/− and Rag1−/− mice. E, Summary of data and statistical comparisons. F, Survival follow-up of groups of mice in C and D. The fraction of mice completely regressing their tumors is provided (A and D). Dotted lines represent the dates of mRNA treatments (B and E). Experiments were repeated twice. Data were fitted to a third-order polynomial and compared using an extra sum-of-squares F test (B and E). Statistical comparisons were made using the log-rank test (C and F). Data are expressed as mean ± SD. *, P ≤ 0.05; ***, P ≤ 0.001; ****, P ≤ 0.0001.

Figure 6.

CD8 T cells are required for the antitumoral effects of intratumoral scIL12+DR-18 mRNAs. A, Individual follow-up of tumor sizes of mice intratumorally treated with combined IL12 and DR-18 mRNAs that were antibody-depleted from CD8β, CD4, or NK1.1 lymphocytes since 1 day before the mRNA treatments. B, Summary of their size data with statistical comparisons. C, Survival follow-up of the indicated groups of mice D, Experiments as in A performed in WT mice, BATF3−/− and Rag1−/− mice. E, Summary of data and statistical comparisons. F, Survival follow-up of groups of mice in C and D. The fraction of mice completely regressing their tumors is provided (A and D). Dotted lines represent the dates of mRNA treatments (B and E). Experiments were repeated twice. Data were fitted to a third-order polynomial and compared using an extra sum-of-squares F test (B and E). Statistical comparisons were made using the log-rank test (C and F). Data are expressed as mean ± SD. *, P ≤ 0.05; ***, P ≤ 0.001; ****, P ≤ 0.0001.

Close modal

cDC1 dendritic cells are crucial to mount antitumor CD8+ T-cell responses and are required for most immunotherapy strategies (56, 57). In Figure 6D, we show that the intratumoral scIL12+DR-18 mRNA treatment combination failed to attain efficacy in cDC1-deficient BATF3 −/− mice, similarly to what happened in T- and B- cell deficient Rag1−/− mice (Fig. 6DF).

Combinations of local scIL12 and DR-18 mRNAs with systemic anti–PD-1 mAb achieve bilateral synergy

Considering that IFNγ is a potent inducer of the PD-1/PD-L1 pathway (53) that could curtail efficacy of the mRNA local immunotherapy combinations, we studied the therapeutic performance of the combination upon systemic PD-1 blockade. Experiments in bilateral B16OVA-derived tumors indicated that an anti–PD-1 single agent was conducive to partial bilateral efficacy, as was the case with local scIL12+DR-18 mRNAs injected into only one of the two concomitant tumor lesions. The majority of mice achieved complete regression of their tumors when systemic anti–PD-1 mAb was combined with the local intratumoral delivery of the mRNAs (Fig. 7AC). These therapeutic effects translated into long-term survival (Fig. 7D).

Figure 7.

Anti–PD-1 mAb systemic treatment synergizes with intratumoral mRNAs encoding scIL12 and DR-18. A, Scheme of the timeline of experiments in mice baring bilateral B16OVA tumors. B, Experiments following bilateral tumor sizes as in Fig. 4, comparing systemic anti–PD-1 (arrows) plus intratumoral control luciferase-encoding mRNA or the combination of mRNAs encoding scIL12 and DR-18 (dotted lines) plus anti–PD-1 mAb, as indicated. The fraction of mice completely regressing their tumors is provided. C, Summary of results and statistical comparisons. D, Survival follow-up of the experimental groups as indicated. Experiments were repeated twice. Data were fitted to a third order polynomial and compared using an extra sum-of-squares F test (C). Statistical comparisons were made using the log-rank test (D). Data are expressed as mean ± SD. *, P ≤ 0.05; ***, P ≤ 0.001; ****, P ≤ 0.0001.

Figure 7.

Anti–PD-1 mAb systemic treatment synergizes with intratumoral mRNAs encoding scIL12 and DR-18. A, Scheme of the timeline of experiments in mice baring bilateral B16OVA tumors. B, Experiments following bilateral tumor sizes as in Fig. 4, comparing systemic anti–PD-1 (arrows) plus intratumoral control luciferase-encoding mRNA or the combination of mRNAs encoding scIL12 and DR-18 (dotted lines) plus anti–PD-1 mAb, as indicated. The fraction of mice completely regressing their tumors is provided. C, Summary of results and statistical comparisons. D, Survival follow-up of the experimental groups as indicated. Experiments were repeated twice. Data were fitted to a third order polynomial and compared using an extra sum-of-squares F test (C). Statistical comparisons were made using the log-rank test (D). Data are expressed as mean ± SD. *, P ≤ 0.05; ***, P ≤ 0.001; ****, P ≤ 0.0001.

Close modal

This study focused on the proof-of-concept of a combination of mRNAs encoding cytokines for the local immunotherapy of cancer (1). Several combinations of mRNAs encoding cytokines have been studied in mouse models, with at least two advancing in the clinical arena, namely combinations of mRNAs encoding IL12, IL15-sushi, GM-CSF, and IFNα (39) or OX40L, IL23, and IL36γ (58). The goal of a local approach with such cytokine mRNAs is to start the antitumor immune fight from inside (34, 38), modifying the tumor microenvironment or at least the microenvironment of one of the metastatic lesions.

One of the advantages of such an approach is that the encoded soluble cytokines will reach draining lymph nodes from the tumors. An important potential caveat of the approach is that only one or a few of the tumor lesions could be injected in a multimetastatic disease setting.

Intratumoral injection of mRNAs to be expressed conceivably requires vehicles to ensure transfection. Indeed, lipoplexing to cross plasma membranes seems to be desirable as pioneered by Moderna and BioNTech (59–61). However, several reports from the laboratory of Kris Thielemans showed that intratumoral injection of naked mRNA diluted in Ca2+-containing Ringer's lactate was also effective and certainly simpler at achieving transient gene transfer of mouse tumors in vivo (51). Therefore, after replicating such results, we chose to follow this simpler and clinically feasible method.

Our approach was based on the combination of scIL12 and IL18 that had been described as synergistic in terms of IFNγ induction from NK cells and CD8+ T lymphocytes (26–28). We confirmed such a strong synergism both ex vivo and following in vivo mRNA delivery. To make the most of the combined strategy, we chose to use a powerful mutant form of IL18 that cannot bind to IL18BP and thereby is not amenable to be functionally repressed (DR-18).

In addition to being irrepressible by IL18BP, DR-18 reportedly has more potent intrinsic bioactivity for reasons that remain to be investigated (33). The use of DR-18 is also warranted due to the fact that IL18BP is expressed by human tumors and by T lymphocytes, therefore suggesting that this repressive mechanism is operational in tumor immunotherapy settings.

The combination of scIL12 and DR-18 transient gene transfer achieved the production of extremely high amounts of IFNγ both in cultures of splenic lymphocytes and upon systemic delivery to mice of the scIL12+DR-18 encoding mRNAs. Regardless of our efforts to modulate such systemic effects, they usually resulted in lethal toxicity, and the systemic approach had to be rejected. However, this combination offered an opportunity for local codelivery as a way to broaden the therapeutic window (62). Indeed, the local approach was therapeutically successful, and impressive effects were seen against locally treated tumors with evidence for modest systemic effects on contralateral noninjected tumors. We also tried to use scIL12 mRNA locally in the tumors while less toxic DR-18 was expressed systemically in the liver, but the therapeutic effects were not better and induced obvious signs of toxicity, albeit not lethal. Of note, DR-18 by itself upon intratumoral mRNA delivery exerted weak antitumor efficacy. We cannot rule out if there is a contribution to the antitumor effect of the combination because of mRNA transfer to nontransformed stromal or peritumoral cells.

CD8-mediated antitumor responses are responsible for the efficacy of this strategy. Depletion experiments were conclusive in that regard, in conjunction with the evidence that in mice lacking cDC1 dendritic (40) cells, efficacy was lost. Notably, cDC1 cells are responsible for antigen cross-presentation to CD8+ T cells (52). Furthermore, in contralateral noninjected tumors, we could detect more activated and proliferating CD8+ T cells. Our IFNγ-ELISpot assays conclusively demonstrate enhanced numbers of anti-OVA CD8+ T cells upon combined treatment against OVA-expressing tumors. Given the large amount of IFNγ, we cannot exclude an antiangiogenic effect exerted via the IFNγ–CXCL10–CXCR3 axis and the role of secondary chemokines at chemoattracting T and NK cells (54, 55). The role of NK cells needs further investigation as a source of IFNγ in the system, even if NK1.1 depletion did not impair antitumor activity of the combination.

The goal of immunotherapy for metastatic cancer patients is necessarily systemic. Hence, even if we plan for the injection of multiple tumor sites in oligometastatic patients, efficacy on noninjected metastases, including micrometastases, is required. We provide evidence that if an anti–PD-1 checkpoint inhibitor is added to the local mRNA treatment, systemic efficacy is markedly increased. The safety of the local combination of IL12+DR-18 mRNAs was not jeopardized by systemic anti–PD-1 mAb concurrently given to the mice.

Indeed, intratumoral mRNAs encoding cytokines already in the clinic are being combined with systemic anti–PD-1 or anti–PD-L1 mAbs. Namely, mRNA encoding scIL12 with the anti–PD-L1 mAb durvalumab (NCT03946800) and the combination of mRNAs encoding IL12, IL15-sushi, IFNα, and GM-CSF with the anti–PD-1 mAb cemiplimab (NCT03871348).

The combination of IL12 and IL18 acting on T cells in our hands exerts quantitative and qualitative distinct effects that are not induced by either cytokine alone. Changes in lymphocyte traffic patterns and metabolic adaptation are prominent and may underlie the efficacy on distant tumors, especially when PD-1 is simultaneously blocked (unpublished observations).

The use of naked mRNA versus lipid-formulated versions needs further comparative translational research, because ideally novel formulations could bypass the need for frequently repeated intratumoral administrations given the short duration of protein expression as achieved by naked mRNA.

All in all, our results advocate for an immunotherapy strategy consisting of naked mRNAs encoding scIL12 and DR-18 injected into metastatic lesions combined with simultaneous or sequential addition of systemic checkpoint anti–PD-(L)1 inhibitors. If the local approach was sufficiently safe in humans, such treatment could be given at earlier stages to surgically amenable cancer patients in neoadjuvant schemes to ensure the greatest benefit. Our experimental work adds a potent and feasible combination of mRNA-encoding cytokines to be added to the intratumoral immunotherapy armamentarium (62).

M.F. Sanmamed reports grants from Roche; grants and personal fees from BMS; and personal fees from MSD outside the submitted work. I. Melero reports grants and personal fees from BMS, Roche, Bioncotech, AstraZeneca, Genmab; personal fees from PharmaMar, Numab, Gossamer, Alligator, Highlight Therapeutics, Biolinerx, Amunix, Bright Peak, F-star, Pieris; and personal fees from Merus outside the submitted work. No disclosures were reported by the other authors.

A. Cirella: Conceptualization, data curation, validation, investigation, writing–original draft, writing–review and editing. E. Bolaños: Data curation, validation, investigation, writing–review and editing. C.A. Di Trani: Data curation, formal analysis, investigation, methodology, writing–review and editing. C.E. de Andrea: Formal analysis, visualization, methodology, writing–review and editing. S. Sánchez-Gregorio: Data curation, formal analysis, validation, investigation, writing–review and editing. I. Etxeberria: Conceptualization, methodology, writing–review and editing. J. Gonzalez-Gomariz: Formal analysis, writing–review and editing. I. Olivera: Validation, methodology, writing–review and editing. D. Brocco: Data curation, formal analysis, validation, investigation, writing–review and editing. J. Glez-Vaz: Validation, investigation, writing–review and editing. C. Luri-Rey: Validation, investigation, writing–review and editing. A. Azpilikueta: Data curation, investigation, methodology. I. Rodriguez: Validation, investigation, methodology, writing–review and editing. M. Fernandez-Sendin: Methodology, writing–review and editing. J. Egea: Investigation, methodology, writing–review and editing. I. Eguren: Validation, methodology, writing–review and editing. M.F. Sanmamed: Conceptualization, formal analysis, supervision, methodology, writing–review and editing. B. Palencia: Data curation, methodology, project administration, writing–review and editing. A. Teijeira: Conceptualization, supervision, writing–review and editing. P. Berraondo: Conceptualization, resources, software, supervision, funding acquisition, methodology, writing–original draft, writing–review and editing. I. Melero: Conceptualization, resources, data curation, supervision, funding acquisition, methodology, writing–original draft, writing–review and editing.

Jun Wang (Yale) is acknowledged for advice with DR-18. We are grateful to Eneko Elizalde and Elena Ciordia for their excellent work in the animal facility and to Diego Alignani for his excellent technical support in the flow cytometry facility. Helpful discussions with Drs. Hervas-stubbs, Rouzaut, Castañón, and Rodriguez-Ruiz are also acknowledged. We are grateful to Paul Miller for English editing. Figures 1A, 2A, 2C, 4A, 5A, 7A; Supplementary Fig. S8A were created using the BioRender website platform.

This project has received funding from the European Union's Horizon 2020 research and innovation programme under the Marie Sklodowska-Curie grant agreement No 765394. This work was supported by Spanish Ministry of Economy and Competitiveness and Spanish Ministry of Research [MINECO SAF2014–52361-R and SAF 2017–83267-C2–1R and PID2020–112892RB-100, PID2020–113174-RA-100 (AEI/FEDER, UE)], Cancer Research Institute under the CRI-CLIP, Asociación Española Contra el Cancer (AECC) Foundation under Grant GCB15152947MELE, Joint Translational Call for Proposals 2015 (JTC 2015) TRANSCAN-2 (code: TRS-2016–00000371), projects PI14/01686, PI13/00207, PI16/00668, PI19/01128, funded by Instituto de Salud Carlos III and cofunded by European Union (ERDF, “A way to make Europe”), Gobierno de Navarra Salud, Gobierno de Navarra Proyecto LINTERNA Ref: 0011–1411, Mark Foundation, Fundación BBVA and Fundación Olga Torres. A. Teijeira is supported by the Ramon y Cajal program from the Spanish Ministry of Science (RyC 2019–026406-I).

The publication costs of this article were defrayed in part by the payment of publication fees. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 USC section 1734.

Note: Supplementary data for this article are available at Cancer Immunology Research Online (http://cancerimmunolres.aacrjournals.org/).

1.
Berraondo
P
,
Sanmamed
MF
,
Ochoa
MC
,
Etxeberria
I
,
Aznar
MA
,
Pérez-Gracia
JL
, et al
.
Cytokines in clinical cancer immunotherapy
.
Br J Cancer
2018
;
120
:
6
15
.
2.
Atkins
MB
,
Robertson
MJ
,
Gordon
M
,
Lotze
MT
,
DeCoste
M
,
DuBois
JS
, et al
.
Phase I evaluation of intravenous recombinant human interleukin 12 in patients with advanced malignancies
.
Clin Cancer Res
1997
;
3
:
409
17
.
3.
Leonard
JP
,
Sherman
ML
,
Fisher
GL
,
Buchanan
LJ
,
Larsen
G
,
Atkins
MB
, et al
.
Effects of single-dose interleukin 12 exposure on interleukin 12–associated toxicity and interferon gamma production
.
Blood
1997
;
90
:
2541
8
.
4.
Cirella
A
,
Luri-Rey
C
,
di Trani
CA
,
Teijeira
A
,
Olivera
I
,
Bolaños
E
, et al
.
Novel strategies exploiting interleukin 12 in cancer immunotherapy
.
Pharmacol Ther
2022
;
239
:
108189
.
5.
Sangro
B
,
Melero
I
,
Qian
C
,
Prieto
J
.
Gene therapy of cancer based on interleukin 12
.
Curr Gene Ther
2005
;
5
:
573
81
.
6.
Halin
C
,
Rondini
S
,
Nilsson
F
,
Berndt
A
,
Kosmehl
H
,
Zardi
L
, et al
.
Enhancement of the antitumor activity of interleukin 12 by targeted delivery to neovasculature
.
Nat Biotechnol
2002
;
20
:
264
9
.
7.
Halin
C
,
Gafner
V
,
Villani
ME
,
Borsi
L
,
Berndt
A
,
Kosmehl
H
, et al
.
Synergistic therapeutic effects of a tumor targeting antibody fragment, fused to interleukin 12 and to tumor necrosis factor α
.
Cancer Res
2003
;
63
:
3202
10
.
8.
Gafner
V
,
Trachsel
E
,
Neri
D
.
An engineered antibody-interleukin 12 fusion protein with enhanced tumor vascular targeting properties
.
Int J Cancer
2006
;
119
:
2205
12
.
9.
Lo
KM
,
Lan
Y
,
Lauder
S
,
Zhang
J
,
Brunkhorst
B
,
Qin
G
, et al
.
huBC1-IL12, an immunocytokine which targets EDB-containing oncofetal fibronectin in tumors and tumor vasculature, shows potent antitumor activity in human tumor models
.
Cancer Immunol Immunother
2007
;
56
:
447
57
.
10.
Fallon
J
,
Tighe
R
,
Kradjian
G
,
Guzman
W
,
Bernhardt
A
,
Neuteboom
B
, et al
.
The immunocytokine NHS-IL12 as a potential cancer therapeutic
.
Oncotarget
2014
;
5
:
1869
84
.
11.
Strauss
J
,
Heery
CR
,
Kim
JW
,
Jochems
C
,
Donahue
RN
,
Montgomery
AS
, et al
.
First-in-human phase I trial of a tumor-targeted cytokine (NHS-IL12) in subjects with metastatic solid tumors
.
Clin Cancer Res
2019
;
25
:
99
109
.
12.
Melero
I
,
Duarte
M
,
Ruiz
J
,
Sangro
B
,
Galofré
JC
,
Mazzolini
G
, et al
.
Intratumoral injection of bone-marrow derived dendritic cells engineered to produce interleukin 12 induces complete regression of established murine transplantable colon adenocarcinomas
.
Gene Ther
1999
;
6
:
1779
84
.
13.
Mazzolini
G
,
Alfaro
C
,
Sangro
B
,
Feijoó
E
,
Ruiz
J
,
Benito
A
, et al
.
Intratumoral injection of dendritic cells engineered to secrete interleukin 12 by recombinant adenovirus in patients with metastatic gastrointestinal carcinomas
.
J Clin Oncol
2005
;
23
:
999
1010
.
14.
Kang
WK
,
Park
C
,
Yoon
HL
,
Kim
WS
,
Yoon
SS
,
Lee
MH
, et al
.
Interleukin 12 gene therapy of cancer by peritumoral injection of transduced autologous fibroblasts: outcome of a phase I study
.
Hum Gene Ther
2001
;
12
:
671
84
.
15.
Etxeberria
I
,
Bolaños
E
,
Quetglas
JI
,
Gros
A
,
Villanueva
A
,
Palomero
J
, et al
.
Intratumor adoptive transfer of IL12 mRNA transiently engineered antitumor CD8+ T cells
.
Cancer Cell
2019
;
36
:
613
29
.
16.
Skrombolas
D
,
Sullivan
M
,
Frelinger
JG
.
Development of an interleukin 12 fusion protein that is activated by cleavage with matrix metalloproteinase 9
.
J Interferon Cytokine Res
2019
;
39
:
233
45
.
17.
Xue
D
,
Moon
B
,
Liao
J
,
Guo
J
,
Zou
Z
,
Han
Y
, et al
.
A tumor-specific pro-IL12 activates preexisting cytotoxic T cells to control established tumors
.
Sci. Immunol.
2022
;
7
:
eabi6899
.
18.
Perez-Gracia
JL
,
Labiano
S
,
Rodriguez-Ruiz
ME
,
Sanmamed
MF
,
Melero
I
.
Orchestrating immune check-point blockade for cancer immunotherapy in combinations
.
Curr Opin Immunol
2014
;
27
:
89
97
.
19.
Lieschke
GJ
,
Rao
PK
,
Gately
MK
,
Mulligan
RC
.
Bioactive murine and human interleukin 12 fusion proteins which retain antitumor activity in vivo
.
1996
;
15
:;
35
40
.
20.
Kobayashi
BYM
,
Fitz
L
,
Ryan
M
,
Hewick
RM
,
Clark
SC
,
Chan
S
, et al
.
Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes
.
J Exp Med
1989
;
170
:
827
45
.
21.
Stern
AS
,
Podlaski
FJ
,
Hulmes
JD
,
Pan
YCE
,
Quinn
PM
,
Wolitzky
AG
, et al
.
Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells
.
Proc Natl Acad Sci USA
1990
;
87
:
6808
12
.
22.
Sareneva
T
,
Julkunen
I
,
Matikainen
S
.
IFN-alpha and IL12 induce IL18 receptor gene expression in human NK and T cells
.
J Immunol
2000
;
165
:
1933
8
.
23.
Debets
R
,
Timans
JC
,
Churakowa
T
,
Zurawski
S
,
de Waal Malefyt
R
,
Moore
KW
, et al
.
IL18 receptors, their role in ligand binding and function: anti-IL1RAcPL antibody, a potent antagonist of IL18
.
J Immunol
2000
;
165
:
4950
6
.
24.
Okamura
H
,
Tsutsul
H
,
Komatsu
T
,
Yutsudo
M
,
Tanimoto
T
,
Torigoe
K
, et al
.
Cloning of a new cytokine that induces IFNγ production by T cells
.
Nature
1995
;
378
:
88
91
.
25.
Nakanishi
K
,
Yoshimoto
T
,
Tsutsui
H
,
Okamura
H
.
Interleukin 18 regulates both Th1 and Th2 responses
.
Annu Rev Immunol
2001
;
19
:
423
74
.
26.
Okamura
H
,
Kashiwamura
SI
,
Tsutsui
H
,
Yoshimoto
T
,
Nakanishi
K
.
Regulation of interferon-gamma production by IL12 and IL18
.
Curr Opin Immunol
1998
;
10
:
259
64
.
27.
Tominaga
K
,
Yoshimoto
T
,
Torigoe
K
,
Kurlmoto
M
,
Matsui
K
,
Hada
T
, et al
.
IL12 synergizes with IL18 or IL1β for IFNγ production from human T cells
.
Int Immunol
2000
;
12
:
151
60
.
28.
Nakahira
M
,
Ahn
H-J
,
Park
W-R
,
Gao
P
,
Tomura
M
,
Park
C-S
, et al
.
Synergy of IL12 and IL18 for IFNγ gene expression: IL12-induced STAT4 contributes to IFNγ promoter activation by upregulating the binding activity of IL18-induced activator protein 1
.
J Immunol
2002
;
168
:
1146
53
.
29.
Nakamura
S
,
Otani
T
,
Ijiri
Y
,
Motoda
R
,
Kurimoto
M
,
Orita
K
.
IFN-gamma–dependent and –independent mechanisms in adverse effects caused by concomitant administration of IL18 and IL12
.
J Immunol
2000
;
164
:
3330
6
.
30.
Carson
WE
,
Dierksheide
JE
,
Jabbour
S
,
Anghelina
M
,
Bouchard
P
,
Ku
G
, et al
.
Coadministration of interleukin 18 and interleukin 12 induces a fatal inflammatory response in mice: critical role of natural killer cell interferon-gamma production and STAT-mediated signal transduction
.
Blood
2000
;
96
:
1465
73
.
31.
Dinarello
CA
,
Novick
D
,
Kim
S
,
Kaplanski
G
.
Interleukin-18 and IL18 binding protein
.
Front Immunol
2013
;
4
:
1
10
.
32.
Vidal-Vanaclocha
F
,
Mendoza
L
,
Telleria
N
,
Salado
C
,
Valcárcel
M
,
Gallot
N
, et al
.
Clinical and experimental approaches to the pathophysiology of interleukin 18 in cancer progression
.
Cancer Metastasis Rev
2006
;
25
:
417
34
.
33.
Zhou
T
,
Damsky
W
,
Weizman
OE
,
McGeary
MK
,
Hartmann
KP
,
Rosen
CE
, et al
.
IL18BP is a secreted immune checkpoint and barrier to IL18 immunotherapy
.
Nature
2020
;
583
:
609
14
.
34.
Hewitt
SL
,
Bailey
D
,
Zielinski
J
,
Apte
A
,
Musenge
F
,
Karp
R
, et al
.
Intratumoral IL12 mRNA therapy promotes TH1 transformation of the tumor microenvironment
.
Clin Cancer Res
2020
;
26
:
6284
98
.
35.
Cirella
A
,
Berraondo
P
,
di Trani
CA
,
Melero
I
.
Interleukin 12 message in a bottle
.
Clin Cancer Res
2020
;
26
:
6080
2
.
36.
Luheshi
N
,
Hewitt
S
,
Garcon
F
,
Burke
S
,
Watkins
A
,
Arnold
K
, et al
. Abstract
5017: MEDI1191, a novel IL12 mRNA therapy for intratumoral injection to promote TH1 transformation of the patient tumor microenvironment
.
Cancer Res
2019
;
79
:
5017–
.
37.
Hamid
O
,
Hellman
M
,
Carneiro
B
,
Marron
T
,
Subbiah
V
,
Mehmi
I
, et al
.
19O Preliminary safety, antitumor activity, and pharmacodynamics results of HIT-IT MEDI1191 (mRNA IL12) in patients with advanced solid tumors and superficial lesions
.
Ann Oncol
2021
;
32
:
S9
.
38.
Hotz
C
,
Wagenaar
TR
,
Gieseke
F
,
Bangari
DS
,
Callahan
M
,
Cao
H
, et al
.
Local delivery of mRNA-encoding cytokines promotes antitumor immunity and tumor eradication across multiple preclinical tumor models
.
Sci Transl Med
2021
;
13
:
eabc7804
.
39.
Bechter
O
,
Utikal
J
,
Baurain
J-F
,
Massard
C
,
Sahin
U
,
Derhovanessian
E
, et al
.
391 A first-in-human study of intratumoral SAR441000, an mRNA mixture encoding IL12sc, interferon alpha2b, GM-CSF, and IL15sushi as monotherapy and in combination with cemiplimab in advanced solid tumors
.
J Immunother Cancer
2020
;
8
:
A237.2
A238
.
40.
Hildner
K
,
Edelson
BT
,
Purtha
WE
,
Diamond
M
,
Matsushita
H
,
Kohyama
M
, et al
.
Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T-cell immunity
.
Science
2008
;
322
:
1097
100
.
41.
Alvarez
M
,
Molina
C
,
de Andrea
CE
,
Fernandez-Sendin
M
,
Villalba
M
,
Gonzalez-Gomariz
J
, et al
.
Intratumoral co-injection of the poly I:C-derivative BO-112 and a STING agonist synergize to achieve local and distant antitumor efficacy
.
J Immunother Cancer
2021
;
9
:
e002953
.
42.
Stadler
CR
,
Bähr-Mahmud
H
,
Celik
L
,
Hebich
B
,
Roth
AS
,
Roth
RP
, et al
.
Elimination of large tumors in mice by mRNA-encoded bispecific antibodies
.
Nat Med
2017
;
23
:
815
7
.
43.
Etxeberria
I
,
Bolaños
E
,
Teijeira
A
,
Garasa
S
,
Yanguas
A
,
Azpilikueta
A
, et al
.
Antitumor efficacy and reduced toxicity using an anti-CD137 Probody therapeutic
.
Proc Natl Acad Sci USA
2021
;
118
:
e2025930118
.
44.
Abengozar-Muela
M
,
Esparza
MV
,
Garcia-Ros
D
,
Vásquez
CE
,
Echeveste
JI
,
Idoate
MA
, et al
.
Diverse immune environments in human lung tuberculosis granulomas assessed by quantitative multiplexed immunofluorescence
.
Mod Pathol Mod Pathol
2020
;
33
:
2507
19
.
45.
Martinez-Valbuena
I
,
Valenti-Azcarate
R
,
Amat-Villegas
I
,
Riverol
M
,
Marcilla
I
,
de Andrea
CE
, et al
.
Amylin as a potential link between type 2 diabetes and Alzheimer disease
.
Ann Neurol Ann Neurol;
2019
;
86
:
539
51
.
46.
Bankhead
P
,
Fernández
JA
,
McArt
DG
,
Boyle
DP
,
Li
G
,
Loughrey
MB
, et al
.
Integrated tumor identification and automated scoring minimizes pathologist involvement and provides new insights to key biomarkers in breast cancer
.
Lab Invest Lab Invest;
2018
;
98
:
15
26
.
47.
Huber
W
,
Carey
VJ
,
Gentleman
R
,
Anders
S
,
Carlson
M
,
Carvalho
BS
, et al
.
Orchestrating high-throughput genomic analysis with Bioconductor
.
Nat Methods
2015
;
12
:
115
21
.
48.
Colaprico
A
,
Silva
TC
,
Olsen
C
,
Garofano
L
,
Cava
C
,
Garolini
D
, et al
.
TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data
.
Nucleic Acids Res
2015
;
44
:
71
.
49.
Chen
Y
,
Lun
ATL
,
Smyth
GK
,
Burden
CJ
,
Ryan
DP
,
Khang
TF
, et al
.
From reads to genes to pathways: differential expression analysis of RNA-seq experiments using Rsubread and the edgeR quasi-likelihood pipeline
.
F1000Res
2016
;
5
:
1438
.
50.
Zhao
Y
,
Moon
E
,
Carpenito
C
,
Paulos
CM
,
Liu
X
,
Brennan
AL
, et al
.
Multiple injections of electroporated autologous T cells expressing a chimeric antigen receptor mediate regression of human disseminated tumor
.
Cancer Res
2010
;
70
:
9053
61
.
51.
van Lint
S
,
Renmans
D
,
Broos
K
,
Goethals
L
,
Maenhout
S
,
Benteyn
D
, et al
.
Intratumoral delivery of TriMix mRNA results in T-cell activation by cross-presenting dendritic cells
.
Cancer Immunol Res
2016
;
4
:
146
56
.
52.
Wculek
SK
,
Cueto
FJ
,
Mujal
AM
,
Melero
I
,
Krummel
MF
,
Sancho
D
.
Dendritic cells in cancer immunology and immunotherapy
.
Nat Rev Immunol
2020
;
20
:
7
24
.
53.
Quetglas
JI
,
Labiano
S
,
Aznar
,
Bolaños
E
,
Azpilikueta
A
,
Rodriguez
I
, et al
.
Virotherapy with a semliki forest virus-based vector encoding IL12 synergizes with PD-1/PD-L1 Blockade
.
Cancer Immunol Res
2015
;
3
:
449
54
.
54.
Tannenbaum
CS
,
Tubbs
R
,
Armstrong
D
,
Finke
JH
,
Bukowski
RM
,
Hamilton
TA
.
The CXC chemokines IP-10 and Mig are necessary for IL12-mediated regression of the mouse RENCA tumor
.
J Immunol
1998
;
161
:
927
32
.
55.
Romagnani
P
,
Annunziato
F
,
Lasagni
L
,
Lazzeri
E
,
Beltrame
C
,
Francalanci
M
, et al
.
Cell cycle–dependent expression of CXC chemokine receptor 3 by endothelial cells mediates angiostatic activity
.
J Clin Invest
2001
;
107
:
53
63
.
56.
Sánchez-Paulete
AR
,
Cueto
FJ
,
Martínez-López
M
,
Labiano
S
,
Morales-Kastresana
A
,
Rodríguez-Ruiz
ME
, et al
.
Cancer immunotherapy with immunomodulatory anti-CD137 and anti–PD-1 monoclonal antibodies requires BATF3-dependent dendritic cells
.
Cancer Discov
2016
;
6
:
71
9
.
57.
Salmon
H
,
Idoyaga
J
,
Rahman
A
,
Leboeuf
M
,
Remark
R
,
Jordan
S
, et al
.
Expansion and activation of CD103(+) dendritic cell progenitors at the tumor site enhances tumor responses to therapeutic PD-L1 and BRAF inhibition
.
Immunity
2016
;
44
:
924
38
.
58.
Patel
M
,
Jimeno
A
,
Wang
D
,
Stemmer
S
,
Bauer
T
,
Sweis
R
, et al
.
Phase I study of mRNA-2752, a lipid nanoparticle encapsulating mRNAs encoding human OX40L/IL23/IL36g, for intratumoral (ITU) injection ±durvalumab in advanced solid tumors and lymphoma 1
.
38
:
15s
,
2020
(
suppl. abstr. 3092
).
59.
Kranz
LM
,
Diken
M
,
Haas
H
,
Kreiter
S
,
Loquai
C
,
Reuter
KC
, et al
.
Systemic RNA delivery to dendritic cells exploits antiviral defense for cancer immunotherapy
.
Nature
2016
;
534
:
396
401
.
60.
Sabnis
S
,
Kumarasinghe
ES
,
Salerno
T
,
Mihai
C
,
Ketova
T
,
Senn
JJ
, et al
.
A novel amino lipid series for mRNA delivery: improved endosomal escape and sustained pharmacology and safety in nonhuman primates
.
Mol Ther
2018
;
26
:
1509
19
.
61.
Sahin
U
,
Oehm
P
,
Derhovanessian
E
,
Jabulowsky
RA
,
Vormehr
M
,
Gold
M
, et al
.
An RNA vaccine drives immunity in checkpoint inhibitor–treated melanoma
.
Nature
2020
;
585
:
107
12
.
62.
Melero
I
,
Castanon
E
,
Alvarez
M
,
Champiat
S
,
Marabelle
A
.
Intratumoral administration and tumor tissue targeting of cancer immunotherapies
.
Nat Rev Clin Oncol
2021
;
18
:
558
76
.