FOXF1 Defines the Core-Regulatory Circuitry in Gastrointestinal Stromal Tumor

Gastrointestinal stromal tumor (GIST) is one of the most common subtypes of human soft-tissue sarcoma. GIST arises from the interstitial cells of Cajal (ICC), a cell lineage that requires KIT, the principal signaling regulator, and ETV1, a lineage-specific master transcription factor, for lineage specification and survival (1–3). Physiologically, normal levels of KIT activation by the KIT ligand stabilize the ETV1 protein through active downstream MAPK signaling, and result in physiologic transcriptional output critical for ICC lineage specification and development. GIST is characterized by frequent activating mutations in KIT. Mutant KIT aberrantly activates downstream MAPK signaling, which stabilizes the ETV1 protein, and stabilized ETV1 in turn enhances mutant KIT expression. Therefore, mutant KIT and ETV1 form a positive feedback loop and cooperate in GIST oncogenesis (4). The lineage-specific expression of KIT and ETV1 and their interplay in GIST underline the exquisite therapeutic sensitivity and clinical success of targeting the lineage dependence on KIT and ETV1 (5–8). However, how KIT and ETV1 are regulated and what defines the cellular context in GIST remain unclear.

In addition to GIST, ETV1 is involved in the tumorigenesis of multiple cancer types, including prostate cancer and melanoma, where it regulates distinct transcriptional programs (1, 9–11). The enhancer landscape of accessible chromatin defines cellular lineage and the distinct cistrome and transcriptional output of individual transcription factors in different cell types. We thus speculate that additional master regulator(s) may function as “pioneer factor(s)” that modulate chromatin accessibility and help define and maintain the cistrome of ETV1, analogous to the pioneer function of FOXA1 to androgen receptor (AR) in prostate cancer and estrogen receptor-α in breast cancer (12–17). Here, we describe the discovery of FOXF1, as a novel ICC/GIST lineage-specific master regulator that directly regulates KIT, ETV1 expression, and the ICC/GIST lineage-specific transcriptome. Moreover, FOXF1 functions as a pioneer factor required to maintain open chromatin and ETV1 binding at many lineage-specific ETV1-binding sites. We further demonstrate that FOXF1 functionally is required for GIST cell growth and survival in vitro and GIST tumor growth and maintenance in genetically engineered mouse models. Overall, our data demonstrate a unique regulatory hierarchy of FOXF1 that distinguishes itself from other pioneer factors, e.g., FOXA1, in that beyond chromatin context modulation and active recruitment of ETV1, it also directly controls the expression of ETV1 and the cooperative signaling factor KIT.

To identify critical factor(s) that regulate the lineage-specific cellular context for oncogenic transformation, we focused our initial analyses on ETV1, a transcription factor that drives tumorigenesis in two distinct cancer types: prostate cancer and GIST (1, 9, 10). We generated genome-wide localization of ETV1 by chromatin immunoprecipitation sequencing (ChIP-seq) in two human GIST cell lines (GIST-T1 and GIST48) and two prostate cancer cell lines that harbor aberrant expression of full-length ETV1 due to translocation of its entire coding locus (LNCaP and MDA-PCa2b; refs. 1, 9, 10, 18–20). ETV1 cistrome analyses demonstrated that the majority of the ETV1 promoter binding sites (TSS ± 1 kb) were shared between prostate cancer and GIST, whereas the majority of nonpromoter (referred as “enhancer” hereafter) binding sites were distinct between the two cancer types (Fig. 1A and B). Unsupervised k-means clustering divided enhancer ETV1-binding sites into three distinct clusters of GIST-specific (C1), prostate-specific (C2), and shared (C3) sites. This is consistent with previous observation that enhancer landscape is more lineage-specific than promoter (12, 14, 15, 17, 21–24). The observation that ETV1 binds to distinct enhancer regions in prostate cancer and GIST suggests that additional factors are involved in lineage enhancer specification and maintenance. To identify potential lineage-specific transcription factors that colocalize with ETV1 at enhancer sites, we performed de novo motif analysis. We identified the FOX motif as the second most enriched motif, behind the ETS motif, at both the prostate cancer–specific (P = 1 × 10⁻¹⁹⁸) and GIST-specific (P = 1 × 10⁻¹⁵³) ETV1-bound enhancer sites, and to a lesser significance at the shared enhancer regions (P = 1 × 10⁻²³), but not at ETV1-bound promoters (Fig. 1A; Supplementary Tables S1–S4). Other enriched motifs at the GIST-specific ETV1-bound enhancer sites included RUNX (P = 1 × 10⁻³⁹), HOXA9/B9/C9 (P = 1 × 10⁻²⁹), bHLH (P = 1 × 10⁻²²), and HOXD9 (P = 1 × 10⁻²⁰; Supplementary Table S1). Hence, we focused on the most significantly enriched FOX motif.

In the prostate lineage, FOXA1 is a well-known pioneer factor that has the ability to modulate chromatin accessibility and regulate the binding of other transcription factors such as AR (12–14, 25). We examined ETV1 and FOXA1 expression in multiple cancer types from the Gene Expression across Normal and Tumor Tissue (GENT) database (26) and confirmed high ETV1 expression level in GIST and a subset of prostate cancer (Fig. 1C), and high FOXA1 expression in prostate cancer and breast cancer (Fig. 1D). However, FOXA1 expression is low in GIST tumors as well as cell lines (Fig. 1D; Supplementary Fig. S1A and S1B).

We thus speculate that a different FOX family transcription factor is involved in the modulation of the ETV1 cistrome in GIST. We examined the expression of all FOX factors and uncovered that FOXF1 is the highest in both absolute expression and significance of differential expression in GIST compared with other cancer types (Fig. 1E; Supplementary Fig. S1A and Supplementary Table S5). We further examined RNA-seq profiles of GIST48 and GIST882 cells and observed that FOXF1 was the highest-expressing FOX family member (Supplementary Fig. S1B). We confirmed the presence of FOXF1 protein in all three human GIST cell lines, but not in the negative control melanoma cell lines (OMIM1.3, A375, and A2058; Fig. 1F). Furthermore, we examined FOXF1 protein expression in tissue microarrays (TMA) of GIST and several other sarcoma subtypes from MSK-archived tumor specimens by immunohistochemistry (IHC). Independent review by two sarcoma pathologists confirmed positive FOXF1 staining in >98% of all human GIST samples regardless of KIT/PDGFRA mutational status, but rarely in other sarcoma subtypes, including myxofibrosarcoma, myxoid liposarcoma, and synovial sarcoma (Fig. 1G and H). These data demonstrate that FOXF1 is nearly universally and uniquely expressed in human GISTs, and it can be used as a novel sensitive and specific diagnostic marker for GIST.

To determine whether FOXF1 is enriched at ETV1 enhancer sites in GIST, we performed FOXF1 ChIP-seq in GIST48 and GIST-T1 cells. FOXF1-binding sites primarily localized to enhancers (∼94% of all FOXF1 peaks) and were highly concordant between the two GIST cell lines. Approximately 35% of high-confidence ETV1 enhancer binding sites overlapped with high-confidence FOXF1 binding sites (P = 0), including ICC/GIST lineage-specific enhancers such as KIT, GPR20, and ETV1 (Fig. 2A and B; Supplementary Fig. S2A). Among “ETV1-only” peaks, many exhibited modest FOXF1 binding, but the FOXF1 ChIP-seq signals did not meet the peak calling significance threshold (q < 10⁻³). In addition, these ETV1-only peaks also contained the FOX motif that correlated with FOXF1 binding strength (Fig. 2A; Supplementary Fig. S2B), suggesting that the actual co-occupancy of ETV1 and FOXF1 at GIST enhancers may be underestimated. De novo motif analysis of high-confidence ETV1/FOXF1 cobound sites revealed the expected high frequency of FOX motifs (71%) and ETV1 motifs (71%). Further, we found combined FOX/ETS motifs with no orientation preference but with a gap preference of either directly adjacent (no gap) or 11 base pairs, corresponding to one turn of helical DNA (Fig. 2A; Supplementary Fig. S2C).

Given their significant colocalization at lineage-specific enhancers, we next performed whole-transcriptome analyses of the FOXF1-regulated and the ETV1-regulated transcriptomes in GIST48 cells using siRNA-mediated downregulation of FOXF1 and ETV1, respectively. To minimize individual siRNA off-target effects, we averaged two independent siRNAs specific for ETV1, FOXF1, or scramble controls (SCR; Supplementary Fig. S3A). Exploring the interplay between FOXF1 and ETV1, we found that siETV1 decreased ETV1 RNA expression by approximately 8-fold without significantly affecting FOXF1 RNA levels, whereas siFOXF1 decreased FOXF1 RNA expression by approximately 8-fold and ETV1 RNA levels by approximately 3-fold (Fig. 2C and D; Supplementary Fig. S3B and S3C). There was a highly significant correlation between transcriptome changes induced by siFOXF1 and siETV1, respectively (R = 0.58, P = 3.8 × 10⁻³⁷; Fig. 2C). Consistent with prior observations, ETV1 downregulation caused downregulation of ICC/GIST lineage-specific genes, including DUSP6, GPR20, ANO1, and KIT (1, 4). Notably, FOXF1 knockdown led to a greater magnitude of downregulation of these genes. In particular, KIT expression level was reduced by approximately 2-fold with ETV1 knockdown and by approximately 8-fold with FOXF1 knockdown (Fig. 2C and D), suggesting that FOXF1 is a more robust regulator of KIT RNA expression than ETV1 in GIST. The differential effects of FOXF1 and ETV1 on each other and on KIT expression were confirmed by immunoblot (Fig. 2E). Gene Set Enrichment Analysis (GSEA) using >8,300 gene sets from the Molecular Signatures Database (MSigDB; ref. 27) and custom ICC and GIST signatures (1) revealed that the human GIST (EXPO GIST Signature) and the myenteric ICC (Mouse ICC-MY Signature) were among the most negatively enriched gene sets with both siFOXF1- and siETV1-mediated perturbations in GIST (Fig. 2F–I; Supplementary Tables S6–S8). Additional highly negatively enriched gene sets with FOXF1 knockdown included significantly downregulated genes with shRNA-mediated ETV1 knockdown in GIST cells (ETV1 KD GIST48 DN), significantly downregulated genes with imatinib (a KIT inhibitor) treatment in GIST882 cells, as well as cell-cycle regulated genes (Supplementary Fig. S3D–S3F). Integrative analyses of the FOXF1 and ETV1 cistromes with corresponding transcriptomes revealed that the genes with more FOXF1 or ETV1 enhancer peaks were significantly correlated with expression changes in FOXF1 knockdown (Fig. 2J).

Because KIT and downstream MAPK signaling stabilize ETV1 protein levels, we examined their effect on FOXF1 protein levels in imatinib-sensitive GIST882 and GIST-T1 cell lines. Consistent with prior observations, short-term (2-hour) and relatively long-term (24-hour) treatment with imatinib resulted in effective inhibition of KIT and its downstream MAPK pathway signaling, which led to ETV1 protein degradation. Treatment with single-agent MEK162 (a MEK inhibitor) resulted in short-term inhibition of MAPK pathway signaling and gradual reactivation of MAPK signaling by 24 hours, with corresponding recovery of ETV1 protein levels (Supplementary Fig. S3G). In contrast, FOXF1 protein levels were not significantly perturbed under these conditions.

These data demonstrate that FOXF1 directly transcriptionally regulates ETV1, KIT, and the ICC/GIST lineage-specific genes mainly through enhancer binding, whereas KIT signaling and ETV1 transcriptional activity do not affect FOXF1, thus placing FOXF1 at the top of the lineage regulatory hierarchy.

To explore mutual requirements between ETV1 and FOXF1 chromatin binding and the role of each transcription factor in the maintenance of enhancer chromatin landscape, we examined the effect of FOXF1 and ETV1 depletion on the FOXF1 and ETV1 cistrome and enhancer chromatin landscape in GIST. Compared with siSCR control, siETV1 led to a similar decrease of ETV1 binding at all ETV1-binding sites including ETV1-only and ETV1/FOXF1 colocalized (both) enhancers, and ETV1-bound promoters, without significant perturbation of FOXF1 binding (Fig. 3A). On the contrary, FOXF1 downregulation by siFOXF1 resulted in not only decreased FOXF1 binding, but also significant reduction of ETV1 binding. At ETV1-bound enhancer sites, we quantified the change in ETV1 binding induced by either siETV1 or siFOXF1 and correlated with the level of FOXF1 binding. As expected, siETV1 resulted in global reduction of ETV1 RNA and protein levels, which resulted in reduction of ETV1 binding at both ETV1-only and ETV1/FOXF1 colocalized (both) enhancer sites without significant difference (Fig. 3B). As a result of its direct transcriptional effect on ETV1 RNA in GIST, siFOXF1 led to reduction of total ETV1 protein levels and corresponding global reduction of ETV1 chromatin binding at all ETV1-binding sites, including ETV1-bound promoters and enhancers. In contrast to siETV1, there is significantly more reduction of ETV1 binding at the ETV1/FOXF1 colocalized enhancers than ETV1-only enhancers (effect size d = 0.71, P = 10⁻¹⁰⁴; Fig. 3B), suggesting that FOXF1 regulates ETV1 chromatin binding beyond simple transcriptional regulation of ETV1 dosage. Moreover, we compared the ETV1 enhancer binding signal changes induced by siETV1 and siFOXF1 in reference to FOXF1 binding strength measured by FOXF1 ChIP signal. siFOXF1-mediated reduction in ETV1 enhancer binding was highly correlated with the signal strength of FOXF1 binding (Fig. 3C), indicating that FOXF1 binding to chromatin may influence ETV1 binding. Examination of representative ETV1/FOXF1 cobound peaks (e.g., KIT and GPR20 loci) and ETV1-only enhancer and promoter peaks (e.g., ACTB and SNAP29) illustrates the differential effect of FOXF1 knockdown on ETV1 binding (Fig. 3D; Supplementary Fig. S4A and S4B).

To further determine if FOXF1 is required for ETV1 binding to cobound enhancer sites beyond its regulation of ETV1 protein level, we examined the enhancer binding of exogenously expressed HA-tagged ETV1 (HA-ETV1) that is not under FOXF1 transcriptional control in two human GIST cell lines (Fig. 3E). Although siFOXF1 did not significantly affect the HA-ETV1 protein level, it resulted in significant reduction of HA-ETV1 binding at the ETV1/FOXF1 colocalized KIT enhancers, but not in ETV1-only HES1 enhancers (Fig. 3F). These data suggest that FOXF1, in addition to direct transcriptional regulation of ETV1, also regulates the ETV1 cistrome by recruiting ETV1 to bind to the ETV1/FOXF1 colocalized enhancers.

To address the mechanistic basis for the requirement of FOXF1 on ETV1 enhancer binding, we first examined whether FOXF1 directly interacts with ETV1 endogenously. Coimmunoprecipitation (co-IP) of FOXF1 and ETV1 in two human GIST cell lines revealed no evidence of direct binding (Supplementary Fig. S4C). We next assessed characteristic chromatin marks of enhancers and promoters, H3K4me1 and H3K4me3 respectively. As expected, ETV1-bound promoters exhibited a bimodal H3K4me3 enrichment with a central depleted nucleosome and depletion of H3K4me1 marks (Fig. 3A; Supplementary Fig. S4B). This promoter chromatin landscape was not affected by either siETV1 or siFOXF1. All three classes of enhancers defined by ETV1 and FOXF1 binding exhibited a bimodal H3K4me1 signal indicating central depleted nucleosome that allows binding of transcription factors, with ETV1/FOXF1 cobound sites showing strongest H3K4me1 enrichment. ETV1 knockdown did not significantly affect the H3K4me1 landscape. However, FOXF1 knockdown changed H3K4me1 to a more unimodal profile, suggesting loss of the nucleosome-depleted region at the FOXF1-only and ETV1/FOXF1 cobound enhancers (Fig. 3A).

To directly examine whether FOXF1 can modulate chromatin accessibility and help guide binding of other transcription factors, we performed an assay for transposase-accessible chromatin coupled with next-generation sequencing (ATAC-seq; refs. 28, 29) in GIST48, GIST882, and GIST-T1 cells (21, 22, 30–32). Knockdown of ETV1 caused a modest median decrease in chromatin accessibility, especially in ETV1/FOXF1 cobound sites. Knockdown of FOXF1 caused a more dramatic reduction in ATAC signal preferentially at FOXF1-only and ETV1/FOXF1 cobound enhancers in all three GIST cells lines (Fig. 4A and B; Supplementary Fig. S4A and S4B). Among enhancers bound by ETV1, the FOXF1 binding strength correlated with changes in ATAC signal induced by FOXF1 knockdown (Fig. 4C). These data posit FOXF1 as a pioneer factor that has the ability to modulate chromatin accessibility and regulate and maintain enhancer chromatin characteristics, as well as recruit the lineage-specific master regulator ETV1, in GIST.

To evaluate the functional significance of FOXF1 in GIST pathogenesis, we established cells stably expressing doxycycline-inducible GFP with mirE-based hairpins specific for FOXF1 (shFOXF1) or Renilla luciferase control (shREN) in GIST48, GIST882, and GIST-T1 cells. We confirmed doxycycline-inducible FOXF1 knockdown and consequent downregulation of KIT and ETV1 protein (Fig. 5A; Supplementary Fig. S5A). We further assessed the effect of FOXF1 downregulation on KIT expression at the individual cell level using fluorescence-activated cell sorting (FACS) analysis of GFP and KIT immunostaining of shRNA-expressing GFP-positive cells in the presence of parental control cells (Fig. 5B). Because mutant KIT has previously been shown to preferentially localize to the endoplasmic reticulum (ER) and the Golgi apparatus, and wild-type KIT to the plasma membrane (33–35), we analyzed the cell-surface and total (including both intracellular and surface) KIT protein levels. We observed a dramatic reduction of both cell-surface KIT and total KIT protein levels with FOXF1 downregulation (Fig. 5C; Supplementary Fig. S5B and S5C), suggesting that FOXF1 regulates both wild-type and mutant KIT expression levels. The shFOXF1-mediated reduction of total KIT and phospho-KIT proteins in GIST also led to consistent reduction of known KIT downstream signaling pathways in all GIST cell lines, including the MAPK and AKT pathways, but the STAT3 signaling pathway was less affected (Fig. 5A; Supplementary Fig. S5A).

We next assessed the effect of FOXF1 downregulation on cell-cycle regulation and cell growth by quantification of shRNA-expressing GFP-positive cells in the presence of parental control cells over time using FACS (Fig. 5B). In all three GIST cell lines, after doxycycline administration, there was an increased percentage of cells in G₁ phase and decreased percentage of cells in S phase (Fig. 5D and E; Supplementary Fig. S6A–S6D). These data indicate that FOXF1 is required for GIST cell-cycle progression in vitro. The changes in cell-cycle progression were accompanied by a steady decrease in the percentage of GFP-positive shFOXF1-expressing GIST cells but not that of GFP-positive shREN control–expressing cells in competition cell-growth assays (Fig. 5F; Supplementary Fig. S6E and S6F). These effects were confirmed using siRNA-mediated downregulation of FOXF1 and independent cell-growth assays (Supplementary Fig. S6G–S6J). These data indicate that FOXF1 is required for GIST cell growth and fitness, and its effect is likely mediated through regulation of the signaling and transcriptional survival factors KIT and ETV1.

To examine the functional significance of FOXF1 in GIST pathogenesis in vivo, we generated a conditional HA-tagged Foxf1 knockin mouse model, where exon 1 containing the forkhead DNA-binding domain of Foxf1 was flanked by LoxP sites and an HA-tag was added to the amino-terminus of Foxf1 (Fig. 6A; Supplementary Fig. S7A and S7B). Homozygous Foxf1^{f-HA-Foxf1/f-HA-Foxf1} mice were viable, fertile, and born with Mendelian ratios, indicating that the HA-tag did not perturb the normal function of Foxf1. HA-tag and KIT coimmunofluorescence of the GI tract showed that HA-FOXF1 is expressed in all ICC subclasses, including ETV1-high myenteric and intramuscular ICCs that give rise to GIST (Fig. 6B, arrow heads) and ETV1-low submucosal ICCs (Fig. 6B, arrows), as well as smooth muscle cells, consistent with prior gene expression data of murine GI tract (ref. 36; Supplementary Fig. S8A). These data suggest that FOXF1 has a broader spectrum of expression pattern than ETV1 in KIT-positive ICCs and is well-positioned at the top of the regulatory hierarchy to regulate KIT and ETV1 in GIST and its precursor ICCs.

Next, we studied the role of Foxf1 in a genetically engineered mouse model of GIST driven by the germline Kit^V558Δ/+ mutation. These mice develop GIST-like tumors and ICC hyperplasia of large intestine with 100% penetrance (4, 37). We generated the compound Kit^V558Δ/+; Foxf1^{f-HA-Foxf1/f-HA-Foxf1f}; Rosa26^Cre-ERT2 mice and conditionally deleted the HA-Foxf1 by tamoxifen (TAM) administration in adult mice with already-developed GIST-like tumors. Compared with corn oil control, TAM administration led to expected deletion of HA-Foxf1 in cecal GIST and resulted in significant reduction of KIT protein levels by immunofluorescence (IF) and IHC (Fig. 6C and H). HA-Foxf1 deletion in murine GIST tumors also resulted in profound reduction of ETV1 and KIT levels by immunoblots, significant reduction of tumor weight and proliferation index by Ki67, as well as a significant increase in apoptosis measured by cleaved caspase-3 IHC (Fig. 6D–H). In addition, these effects are accompanied by increased fibrosis by trichrome stain (Fig. 6H, blue). Furthermore, HA-Foxf1 ablation also resulted in reduction of the ICC hyperplasia of the large intestine of the murine models (Supplementary Fig. S8B). These data demonstrate that FOXF1 is required for GIST cell growth and survival in vitro, and FOXF1 is required for GIST tumor growth and maintenance in vivo.

GIST is highly resistant to conventional systemic chemotherapy and radiotherapy, yet highly sensitive to therapeutics targeting the lineage-specific master regulators KIT and ETV1 (5–8, 38), pointing to the critical role of lineage-specific cellular context.

Here, we uncovered that FOXF1 is at the top of a unique regulatory hierarchy for the GIST lineage-specific cellular context through direct transcriptional regulation of the key survival factors KIT and ETV1; FOXF1 also functions as a pioneer factor that can modulate chromatin accessibility and maintain lineage-specific enhancers, and recruits ETV1 to lineage-specific enhancers to regulate the ETV1-dependent GIST lineage-specific transcriptome. The pioneering function of FOXF1 in guiding ETV1 in GIST resembles that of FOXA1 in guiding ER and AR localization in the context of breast cancer and prostate cancer, respectively (12–14, 25). Importantly in GIST pathogenesis, FOXF1 differs from FOXA1 in prostate cancer in that FOXA1 does not regulate AR expression, and that FOXA1 loss results in redistribution of AR chromatin binding, whereas FOXF1 loss results in decreased ETV1 protein and global loss of ETV1 chromatin binding.

Although both ETV1 and FOXF1 directly regulate KIT expression through enhancer binding in GIST, it is important to note that the strength of FOXF1-mediated regulation of KIT is significantly stronger than that of ETV1 (Fig. 2C and D). This is likely due to a combination of FOXF1′s ability to directly regulate KIT enhancer chromatin accessibility and expression, as well as its indirect effect on KIT through regulation of ETV1 dosage and cistrome. The direct regulation of KIT by FOXF1 is also inferred from our observations in the murine GI tract: FOXF1 is expressed in all ICC subclasses, including the myenteric ICCs (ICC-MY), intramuscular ICCs (ICC-IM), and submucosal plexus ICCs (ICC-SMP) in the large intestine (Fig. 6B), whereas ETV1 is expressed only in ICC-MY and ICC-IM, but not in ICC-SMP (1). These data indicate that the regulatory circuitry hierarchy in GIST may be predetermined in its precursor ICCs.

How FOXF1 is regulated in GIST remains unclear. During development, Hedgehog signaling pathways have been indicated to regulate FOXF1 expression in murine GI development (39). More recently, the lncRNA LINC01081 has been described to regulate the expression of FOXF1 in fetal lung fibroblasts (40). Whether these signaling pathways continue to remain functionally significant in FOXF1 regulation beyond development remains unclear. A recent report has described Hedgehog signaling pathway dysregulation through GLI-mediated regulation of KIT expression in human GISTs (41). Whether the Hedgehog pathway dysregulation also directly affects FOXF1 regulation in GIST pathogenesis remains to be investigated.

We had previously described the KIT and MAPK signaling–dependent regulation of ETV1 protein stability (1, 4). Here, we observed that in contrast to ETV1, the FOXF1 protein levels were not significantly affected with either KIT or MAPK pathway perturbations. Nevertheless, whether the KIT and/or MAPK signaling activities modulate the FOXF1 transcriptional activity on the chromatin template remains an open question. It is conceivable that signaling can cross-talk with FOXF1 at multiple levels, including signaling-dependent modification of FOXF1 itself that may affect FOXF1 binding affinity and/or specificity to chromatin and its transcriptional activity, signaling-dependent modification of the chromatin template that FOXF1 operates as recently demonstrated in breast cancer (42), or signaling-dependent modification of FOXF1 coactivator and other cofactor binding to chromatin. These areas shall be the focus of future investigations.

The forkhead domain is structurally similar to linker H1 histones, and thus FOX family transcription factors have the ability to bind compacted chromatin and establish enhancers de novo. During early development, FOXF1/2 are expressed in the mesoderm and are involved in early mesoderm specification, extra-embryonic and lateral plate mesoderm differentiation, whereas FOXA1/2/3 are involved in endoderm specification (43–49). How two pioneer transcription factors that bind to very similar primary DNA sequences can have such disparate cistromes and drive opposing developmental processes represents a fundamental question.

In summary, our data indicate that FOXF1 represents not only a novel diagnostic biomarker, but also a potential novel therapeutic target in GIST. We speculate that the unique regulatory logic set forth by the FOXF1–KIT/ETV1 hierarchy provides a highly enforced dependence on lineage-specific context for GIST pathogenesis and creates a special therapeutic opportunity to target the cellular context for all GISTs, including those that do not have druggable mutations, such as SDH-deficient GIST. Traditionally, transcription factors are difficult to target with the exception of nuclear hormone receptors. However, new development in Proteolysis Targeting Chimeras that use bifunctional small molecules to link targeted proteins to the E3 ubiquitin ligase system for targeted protein degradation has provided new promise for targeting transcription factors (50–55).

The GIST48 and GIST882 cell lines were obtained from Dr. Jonathan A. Fletcher (Dana-Farber Cancer Institute) in 2009. The GIST-T1 cell line was obtained from Dr. Takahiro Taguchi (Kochi University) in 2010 (56). All GIST cell lines were maintained as previously described (1). The A2058 and A375 cell lines were obtained from Dr. Joan Massagué [Memorial Sloan Kettering Cancer Center (MSKCC)] in 2014, and the OMIM1.3 cell line was obtained from Dr. Boris C. Bastian (University of California, San Francisco) in 2011. All media were supplemented with l-glutamine (2 mmol/L), penicillin (100 U/mL), and streptomycin (100 μg/mL), and 10% heat-inactivated FBS, except the medium used for GIST882 cells was supplemented with 15% FBS. All cell lines were cultured at 37°C in 5% CO₂ and biochemically tested negative for Mycoplasma contamination by the MycoAlert Plus MycoPlasma Detection Kit (Lonza), most recently in October 2016. To authenticate cell lines, all next-generation sequencing data were analyzed to confirm known SNPs.

The following primary antibodies were used: rabbit anti-human FOXF1 (Abcam; ab168383) for immunoblot, immunoprecipitation, IHC, and ChIP; rabbit anti-ETV1 (Abcam; ab184120) for immunoblot, immunoprecipitation, and ChIP; rabbit anti-H3K4me3 for ChIP (active motif; 39159); rabbit anti-H3K4me1 for ChIP (Abcam; ab8895); horseradish peroxidase (HRP)–conjugated anti-beta ACTIN (Abcam; ab49900) for immunoblot; GAPDH (Abcam; ab9385) for immunoblot; rabbit anti-KIT (Cell Signaling Technology; #3074) for immunoblot and IHC; rabbit anti–phospho-c-KIT (Tyr703; Cell Signaling Technology; #3073); rabbit anti-AKT (pan; Cell Signaling Technology; #4691); rabbit anti–phospho-AKT (Ser473; Cell Signaling Technology; #4060); rabbit anti-MEK1/2 (Cell Signaling Technology; #9122), rabbit anti–phospho-MEK1/2 (Ser217/221; Cell Signaling Technology; #9154); phospho-AKT (Ser473; D9E; XP Rabbit mAb #4060); rabbit anti-STAT3 (Cell Signaling Technology; #12640); rabbit anti–phospho-STAT3 (Tyr705; Cell Signaling Technology; #9145); rabbit anti-p44/42 MAPK (ERK1/2; Cell Signaling Technology; #4695), rabbit anti–phospho-p44/42 MAPK (ERK1/2; Thr202/Tyr204; Cell Signaling Technology; #4370) for immunoblot; rat anti-mouse KIT (Cedarlane; CL8936ap) for IF; APC-conjugated anti-human CD117 (c-KIT; BioLegend; 313205) for FACS; rabbit anti-HA tag (Cell Signaling Technology; #3724) for immunoblot; rabbit anti-HA tag (Abcam; ab9110) for ChIP; rabbit anti-cleaved caspase-3 (Asp175; Cell Signaling Technology; #9661) for IHC; and rabbit anti-Ki67 (Abcam; ab16667) for IHC.

Clinical samples from patients with GIST and other sarcomas were obtained according to MSKCC Institutional Review Board protocol, and frozen and paraffin-embedded tissue samples were banked, and TMAs were generated. All GISTs and other sarcomas were pathologically reviewed and confirmed by a sarcoma expert (C.R. Antonescu) at MSKCC. The FOXF1 IHC stainings were reviewed and scored independently by two independent sarcoma pathologists (C.R. Antonescu, MSKCC; and K. Deniz, MSKCC and Erciyes University, Kayseri, Turkey).

GIST cells were transfected with siRNAs using DharmaFECT2 (GE Healthcare) according to the manufacturer's protocol. In brief, transfection was performed under serum-free conditions, using 20 nmol/L siRNA in Opti-MEM. Two independent siRNAs targeting the ETV1 coding region (catalog #: J-003801-06-0002 and J-003801-07-0002) and one siRNA-customized siRNA targeting the ETV1 UTR (targeting sequence: CGUCAAAGAAUAUGAGGAAUU) were purchased from GE Healthcare Dharmacon. Two independent siRNAs targeting FOXF1 (Catalog#: 4392420 s5220 and s5221) and two nontargeting control siRNAs (Catalog#: 4390843 and 4390846) were purchased from Thermo Fisher Scientific.

For tissue culture cells, RNA was isolated using E.Z.N.A total RNA kit (Omega). For qRT-PCR, RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ABI), and PCR was run using Power SYBR Master Mix (ABI) on a Realplex machine (Eppendorf). Expression was normalized to the ribosomal protein RPL27.

The following primer pairs were used:

• hETV1-Exon67: F: CTACCCCATGGACCACAGATTT, R: CTTAAAGCCTTGTGGTGGGAAG;

• hKIT: F: GGGATTTTCTCTGCGTTCTG, R: GATGGATGGATGGTG GAGAC;

• hFOXF1: F: AGCCCCTGTCCCCCTGTAACCC, R: CTGGGCGACTGCG AGTGATACC

• hGPR20: F: TCCCATCTCCAGCCTGCCCG, R: CGCTGGCATTGGT CCGCACT

• hDUSP6: F: TGCCGGGCGTTCTACCTGGA, R: GGCGAGCTGCTGC TACACGA;

• hRPL27: F: CATGGGCAAGAAGAAGATCG, R: TCCAAGGGGATATC CACAGA.

Total RNA was isolated from tissue culture cells using QIAGEN RNeasy kits (#74104; Qiagen) after designed experimental perturbation. Transcriptional profiles were generated by RNA-seq in the MSKCC Integrative Genomics Operation facility using poly-A capture. The RNA-seq libraries were sequenced on the Illumina HiSeq2500 platform with 50-bp single reads to obtain at least 30 million reads for each sample. The sequence data were processed and mapped to the human reference genome (hg19) using STAR v2.3 (57). Gene expression was quantified to reads-per-kilobase mapped (RPKM) using Cufflinks (58) and log₂ transformed.

GSEA was performed using the JAVA program (http://www.broadinstitute.org/gsea) as described (59). We performed GSEA on two transcriptional profiles: GIST48 cells treated with siETV1 versus siSCR control; and GIST48 cells treated with siFOXF1 versus siSCR control. To identify gene sets enriched among siETV1- and siFOXF1-downregulated genes in GIST48, we used >83,000 gene sets from the MSigDB as well as custom gene sets of ETV1-dependent, KIT signaling–dependent GIST signatures (Supplementary Tables S6–S8).

Heat maps were generated using GENE-E software (http://www.broadinstitute.org/cancer/software/GENE-E).

Chromatin isolation from GIST48, GIST882, and GIST-T1 cells was performed as previously described (1). For siRNA knockdown experiments, chromatin was isolated 72 hours after siRNA transfection.

The human ChIP-qPCR primers pairs were:

• KIT enhancer: F: GGGGAAGCACGAAAAACACC, R: TCGAAGACT TGTCCCTTGGC;

• DUSP6 enhancer: F: TTGTTTGCACTGGGGCTTAT, R: GCTGGAA CAGGTTGTGTTGA;

• HES1 enhancer: F: TAATTATACGGCCTCGGGCA, R: ATCCGGAC GCAGTTTGGAG;

• PSA promoter: F: TGGGCGTGTCTCCTCTGC, R: CCTGGATGCAC CAGGCC;

• GPR20 enhancer: F: CCCTCCCAGGCTCTCCCCAC, R: TCCGGGC CTGCTCTCTGTCC.

Chromatin isolation was performed as previously described (1). Next-generation sequencing was performed on an Illumina HiSeq2500 platform with 50-bp single reads. Reads were aligned to the human genome (hg 19) using the Bowtie alignment software (60), and duplicate reads were eliminated for subsequent analysis. Peak calling was performed using MACS 2.1 (61) comparing immunoprecipitated chromatin with input chromatin, using an FDR cutoff of q < 10⁻³. We discarded peaks mapped to blacklisted genomic regions identified by ENCODE (62, 63).

For each analysis, we merged peaks called for each condition or cell line using Homer mergePeaks (17) and considered overlap if peak summits were within 250 bp. For overlapping peaks, the summit of the merged peak is the center of the summit in the individual experiments. We use Homer annotatePeaks to categorize each peak as promoter (TSS±1kb) or enhancer (nonpromoter), quantify number of reads in each condition at each peak (summit ± 250 bp), identify the nearest gene, and identify the presence of ETS and FOX motif within the peak (summit ± 250 bp). For de novo motif analysis, we employed two software suites, Homer and MEME-ChIP (64), using summit ± 250 bp as input. For visualization, we generated coverage “Bigwig” files using bamCoverage command from deepTools2 (65), normalizing to total reads and human genome size. The ChIP-seq density plots of Bigwig files were generated using either SeqPlots (66) or deepTools2, and ChIP-seq profiles of Bigwig files were generated using Integrated Genome Browser software (67).

Analysis of ETV1 peaks between two GIST and two prostate cancer cell lines was performed as above. The merged promoter and nonpromoter peaks were log₂ transformed and separately clustered using K-means algorithm (n = 3 groups) and plotted using SeqPlots. Analysis of ETV1 and FOXF1 peaks in GIST48 and GIST-T1 cell lines was performed as above. ETV1-only peaks were defined as MACS2 called peaks in either cell line and no FOXF1 peaks in both cell lines. Similarly, FOXF1-only peaks were called in either cell line, and no ETV1 peaks in both cell lines. ETV1/FOXF1 peaks were called for ETV1 in either cell line and for FOXF1 in either cell line. Peaks were log₂ transformed and plotted using SeqPlots.

For analysis of ETV1, FOXF1, H4K3me1, and H4K3me3 ChIP-seq and ATAC-seq in GIST48 cells after siSCR, siETV1 (siETV1-1), and siFOXF1 (siFOXF1-2) transfection, we used ETV1 and FOXF1 peaks at baseline condition (siSCR) and merged and annotated the peaks as above. By using MACS2 peak caller with cutoff of q < 10⁻³, we noted a number of ETV1 enhancer peaks that were not called as a FOXF1 peak but exhibited modest FOXF1 binding and contained FOX motif (Fig. 2A; Supplementary Fig. S2B). Thus, to determine the effect of FOXF1 on ETV1 binding and chromatin accessibility, we restricted “ETV1-only peaks” to those with FOXF1 ChIP signal < 4 (log₂ = 2) and “ETV1/FOXF1 both peaks” to those with FOXF1 ChIP signal > 8 (log₂ = 3; see Fig. 3A–C and Fig. 4A–C). Integrative ChIP-seq and ATAC-seq profile and density plot were generated using deepTools2 in linear scale.

For integrative analysis of ChIP-seq and RNA-seq, we annotated each expressed gene (FKPM >4) by the number of FOXF1 or ETV1 enhancer peaks mapped to the gene and grouped them by the number of peaks. We calculated the mean change by FOXF1 knockdown (siFOXF1-1 and siFOXF2-2 vs. siSCR-1 and siSCR-2) and ETV1 knockdown for all genes in each group.

ATAC-seq was performed as previously described (28). To examine the initial changes in chromatin, we harvested nuclei from GIST48, GIST-T1, and GIST882 cells with siRNA-mediated downregulations of FOXF1, ETV1, or SCR at a time point (48 to 72 hours after siRNA transfection) before any remarkable growth suppression or cell death was observed. For each sample, cell nuclei were prepared from 50,000 cells and incubated with 2.5 μL of transposase (Illumina) in a 50 μL reaction for 30 minutes at 37°C. After purification of transposase-fragmented DNA, the library was amplified by PCR and subjected to paired-end 50 base-pair high-throughput sequencing on an Illumina HiSeq2500 platform.

ATAC-seq reads were quality and adapter trimmed using “trim_galore” before aligning to human genome assembly hg19 with Bowtie2 using the default parameters. Aligned reads with the same start position and orientation were collapsed to a single read before subsequent analysis. Density profiles were created by extending each read to the average library fragment size and then computing density using the BEDTools suite, with subsequent normalization to a sequencing depth of ten million reads for each library. Subsequent data analysis and display are as described in the ChIP-seq analysis section.

Two miRE-based shRNA constructs against FOXF1 and scrambled controls were purchased from Mirimus, Inc. shRNA sequences were subcloned into doxycycline-inducible LT3GEPIR (pRRL) vector. LT3GEPIR is a single lentiviral vector with doxycycline-inducible GFP and mirE with constitutive puromycin and rTTA (68). Targeting sequences were as follows: FOXF1sh1: AGGAGTTTGTCTTCTCTTTCA; FOXF1sh2: TCCTTCCTCACTCCTTTCCTTCCTCACTCCTT. ETV1 cDNA (Open Biosystems) was cloned into MSCV-FLAG-HA-IRES-GFP vector (Addgene). All constructs were confirmed by Sanger sequencing. Viruses were generated and infected as previously described (1). Stable cell lines were validated by immunoblot.

For growth competition assay by FACS analysis, cells (a mixture of parental GIST cells and the GIST cells containing doxycycline-inducible GFP and shRNA construct) were plated at 2 × 10⁶ cells per well of 6-well plate on day 0 in triplicate and treated with 1 μg/mL doxycycline to induce GFP and concomitant shRNA expression. GFP and KIT surface protein were analyzed by FACS twice weekly after doxycycline treatment, and the percentage of GFP-positive cells was followed overtime. Total (surface plus intracellular) KIT proteins of cells were detected similarly by FACS after fixing and permeabilizing the cells with FOXP3/Transcription Factor Staining Buffer Set (eBioscience). For all competition assays, media were replaced every 3 to 4 days, and the GFP-positive cells were tracked using LSRFortessa cytometer (BD Biosciences).

For cell-cycle analysis, cells were prepared by a click-iT EdU pacific blue flow cytometry assay kit (Thermo Fisher Scientific) before FACS. Cell-cycle analysis was performed using FlowJo software.

The number of viable cells was measured using CellTiter-Glo 2.0 Luminescent Cell Viability Assay (Promega) according to the manufacturer's instructions. GIST-T1, GIST882, and GIST48 cells were plated at 10,000, 40,000, and 50,000 cells, respectively, per well in triplicate on a 96-well plate on day 0 and transfected with two individual siRNAs targeting FOXF1 along with scrambled siRNA controls. The cells were cultured and their viability was assessed on days 1, 3, and 6 after transfection with siRNAs. RNA was collected on day 3 to check for knockdown efficiency.

Cell lysates were prepared in RIPA buffer supplemented with proteinase/phosphatase inhibitor. Proteins were resolved in NuPAGE Novex 4%–12% Bis-Tris Protein Gels (#NP0321BOX; Life Technologies) and transferred electrophoretically onto a nitrocellulose 0.45 μm membrane (#162-0115; Bio-Rad). Membranes were blocked for 1 hour at room temperature in Blocking Buffer and were incubated overnight at 4°C with the primary antibodies as described in the reagent section. Signal was visualized either with secondary HRP-conjugated antibodies and ECL or secondary antibodies (IRDye 800CW goat anti-Rabbit #926-32211, 1:20,000, LI-COR; IRDye 680RD goat anti-mouse #926-68070, 1:20,000, LI-COR) in 50% Odyssey Blocking Buffer in PBS plus 0.1% Tween 20 and a LI-COR Odyssey CLx scanner and adjusted using LI-COR Image Studio. Immunoblots were independently performed at least twice, and a representative experiment is shown.

For ETV1 and FOXF1 co-IP, GIST48 and GIST-T1 cells were lysed in 20 mmol/L Tris-HCl (pH 7.5), 1% Triton X-100, 150 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT, 1 mmol/L PMSF, and proteinase/phosphatase inhibitors. After incubation and centrifugation, 120 μL supernatant was used as input, and 1,000 μL for immunoprecipitation using the following antibodies: 0.5 μg of anti-ETV1 antibody, 0.5 μg of anti-FOXF1 antibody, and 0.5 μg of rabbit IgG as control. Twenty microliters of Protein A/G UltraLink Resin (#53133; Thermo Scientific) were used for immunoprecipitation. The immunoprecipitated material was eluted in 4 × SDS loading buffer for immunoblotting. Co-IP was independently performed at least 3 times, and a representative immunoblot is shown.

All mouse studies are approved by the MSKCC Institutional Animal Care and Use Committee under protocol 11-12-029.

We used the pEZ-Frt-lox-DT (Addgene #11736) that contains cloning site for 5′ and 3′ homology arms, and a central targeting region flanked by LoxP sites, a neomycin cassette flanked by FRT sites, and the Diphtheria toxin gene outside the homology region. To generate Foxf1-targeting vector, we cloned mouse Foxf1 with an amino-terminal HA-tag using the SalI site, the 3′ arm between ClaI and NotI sites, and the 5′ arm between XhoI and HindIII sites. The Foxf1^f-HA-Foxf1-targeting vector was used for electroporation of mouse ES cells, which were selected for neo (G418) resistance. Correct targeting was confirmed using Southern blotting with 5′ Probe digested of HindIII-digested DNA and 3′ Probe of BglII-digested DNA. ES cells with the appropriate Foxf1^f-HA-Foxf1-targeted locus were used to generate chimeric mice by injecting Foxf1^f-HA-Foxf1 ES cells into mouse blastocysts. To produce Foxf1^f-HA-Foxf1/+ mice, chimeric mice were bred with C57BL/6 mice in the MSKCC animal facility. The Neo cassette was deleted by breeding of HA-Foxf1^fl/+ mice with Actb-FlpE mice (Jackson Lab).

Genotyping of 5′ LoxP site and 3′ LoxP site was performed using the following primers:

• Foxf1a-5′ LoxP: F: CGGGTCCAGGTCGGCAGAGG, R: TGCAGTGTCC GATCCCCCGT

• Foxf1a-3′ LoxP: F: AGCAAAGGCCCTGTGTATCTA, R: GGCTTGGAGGCTGAAAGCTA

The Kit^Δ558V/+ knockin mouse was a generous gift from Dr. Peter Besmer (MSKCC; ref. 37), and the Rosa26^Cre-ERT2 mice were a generous gift from Dr. Andrea Ventura (MSKCC). Kit^Δ558V/+;Foxf1^{f-HA-Foxf1/f-HA-Foxf1}; Rosa26 ^Cre-ERT2/+ and Kit^Δ558V/+; Foxf1^{f-HA-Foxf1/f-HA-Foxf1}; Rosa26 ^{Cre-ERT2/Cre-ERT2} mice were generated through standard mouse breeding within the MSKCC animal facility.

For TAM or corn oil treatment, TAM (Toronto Research Chemicals) was dissolved at 20 mg/mL in corn oil and TAM (at a dose of 2 mg) or corn oil was injected intraperitoneally into 5- to 6-week-old age-matched Kit^Δ558V/+;Foxf1^{f-HA-Foxf1/f-HA-Foxf1}; Rosa26 ^Cre-ERT2 mice every other day for two doses to induce HA-Foxf1 ablation. The GI tract and GIST tumors were harvested 7 days after TAM or corn coil administration for analyses.

For IF of cryostat sections of the mouse gastrointestinal tract, mouse stomach, small intestine, large intestine, and cecum (or cecal tumor) were dissected and fixed in 4% paraformaldehyde for 2 hours followed by an overnight incubation in 30% sucrose. They were then embedded in optimal cutting temperature compound, flash-frozen, and cut into 5-μm sections using a cryostat. Tissue sections were blocked for 1 hour using 5% goat serum and incubated with primary antibodies at 4°C overnight and secondary antibody for 2 hours at room temperature. Slides were mounted using Prolong Gold (Invitrogen), and images were taken on a Nikon Eclipse TE2000-E microscope using a Photometric Coolsnap HQ camera. Images were taken with ×20 (numerical aperture, 0.75) objectives. Monochrome images taken with DAPI, FITC, and Texas Red filter sets were pseudocolored blue, green, and red, respectively, and merged using ImageJ. The exposure, threshold, and maximum were identical between TAM-treated and corn oil–treated controls of Foxf1^{f-HA-Foxf1/f-HA-Foxf1}; Rosa26^CreERT2/+ or Kit^Δ558V/+; Foxf1^{f-HA-Foxf1/f-HA-Foxf1}; Rosa26^{CreERT2/CreERT2} images.

Tissue paraffin embedding, sectioning, and hematoxylin and eosin staining were performed by the Histoserv, Inc. IHC of mouse formalin-fixed, paraffin-embedded and human TMA tumor samples was performed by the MSKCC Human Oncology and Pathogenesis Program automatic staining facility using a Ventana BenchMark ULTRA automated stainer.

All statistical comparisons between two groups were performed by GraphPad Prism software 6.0 using a two-tailed unpaired t test, unless otherwise noted in the figure legend. The variance between the statistically compared groups was similar.

• GSE22852: ETV1 ChIP-seq in steady-state GIST48 cells from our previous study (1).

• GSE47120: ETV1 ChIP-seq in steady-state LNCaP cells from our previous study (10).

• GSE106626:

  • RNA-seq expression profile of ETV1 or FOXF1 knockdown (siSCR vs. siETV1 vs. siFOXF1) in GIST48 cells;

  • ETV1 ChIP-seq in steady-state MDA-PCa2b cells;

  • ETV1 ChIP-seq and FOXF1 ChIP-seq in steady-state GIST-T1 cells;

  • FOXF1 ChIP-seq in steady-state GIST48 cells;

  • ETV1 ChIP-seq, FOXF1 ChIP-seq, H3K4Me1 ChIP-seq, and H3K4Me3 ChIP-seq of ETV1 or FOXF1 knockdown (siSCR vs. siETV1 vs. siFOXF1) in GIST48 cells;

  • ATAC-seq of ETV1 or FOXF1 knockdown (siSCR vs. siETV1 vs. siFOXF1) in GIST48 cells, GIST882 and GIST-T1 cells.

No potential conflicts of interest were disclosed.

Conception and design: L. Ran, Y. Chen, Y. Xie, Y. Chen, P. Chi

Development of methodology: L. Ran, Y. Chen, E.W.P. Wong, D. Li, S. Shukla, Y. Xie, Y. Chen, P. Chi

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): L. Ran, Y. Chen, J. Sher, E.W.P. Wong,D. Murphy, J.Q. Zhang, D. Li, K. Deniz, K.Y. Li, A. Chramiec, C.R. Antonescu, Y. Chen, P. Chi

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): L. Ran, Y. Chen, D. Li, A. Chramiec, D. Zheng, R.P. Koche, C.R. Antonescu, Y. Chen, P. Chi

Writing, review, and/or revision of the manuscript: L. Ran, Y. Chen, J. Sher, D. Li, Z. Cao, Y. Guan, D. Zheng, C.R. Antonescu, Y. Chen, P. Chi

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): L. Ran, D. Murphy, D. Li, I. Sirota, Z. Cao, S. Wang, Y. Xie, Y. Chen, P. Chi

Study supervision: Z. Cao, Y. Chen, P. Chi

This work was supported by grants from the NCI (K08CA140946, Y. Chen; R01CA193837, Y. Chen; P50CA092629, Y. Chen; P50CA140146, P. Chi and C.R. Antonescu; K08CA151660, P. Chi; DP2 CA174499, P. Chi); US DOD (W81XWH-10-1-0197, P. Chi); Prostate Cancer Foundation (Y. Chen); Geoffrey Beene Cancer Research Center (Y. Chen and P. Chi); Gerstner Family Foundation (Y. Chen); Bressler Scholars Fund (Y. Chen); GIST Cancer Research Fund (P. Chi and C.R. Antonescu); Shuman Fund (P. Chi and C.R. Antonescu); and GIST Cancer Awareness Fund (P. Chi). We thank the following MSKCC core facilities: Tri-institutional Gene Targeting (C. Yang); Mouse Genetics Core (W. Mark and P. Romanienko); Integrated Genomics Operation (A. Viale); Molecular Cytogenetics (M. Leversha); and Molecular Cytology (K. Manova). We thank Drs. Massague, Fletcher, Bastian, and Taguchi for cell lines. Next-generation sequencing for RNA-seq, ChIP-seq, and ATAC-seq was done at the MSKCC Integrated Genomics Operation Facility.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.